ID: 1166577450

View in Genome Browser
Species Human (GRCh38)
Location 19:43855664-43855686
Sequence CATCCCTGCCCCATTGGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166577450_1166577454 -6 Left 1166577450 19:43855664-43855686 CCAACACCAATGGGGCAGGGATG No data
Right 1166577454 19:43855681-43855703 GGGATGAGCTCTGCCAAGGGTGG No data
1166577450_1166577456 4 Left 1166577450 19:43855664-43855686 CCAACACCAATGGGGCAGGGATG No data
Right 1166577456 19:43855691-43855713 CTGCCAAGGGTGGAGAGTAAGGG No data
1166577450_1166577453 -9 Left 1166577450 19:43855664-43855686 CCAACACCAATGGGGCAGGGATG No data
Right 1166577453 19:43855678-43855700 GCAGGGATGAGCTCTGCCAAGGG No data
1166577450_1166577458 15 Left 1166577450 19:43855664-43855686 CCAACACCAATGGGGCAGGGATG No data
Right 1166577458 19:43855702-43855724 GGAGAGTAAGGGAAGAATTGTGG No data
1166577450_1166577459 16 Left 1166577450 19:43855664-43855686 CCAACACCAATGGGGCAGGGATG No data
Right 1166577459 19:43855703-43855725 GAGAGTAAGGGAAGAATTGTGGG No data
1166577450_1166577455 3 Left 1166577450 19:43855664-43855686 CCAACACCAATGGGGCAGGGATG No data
Right 1166577455 19:43855690-43855712 TCTGCCAAGGGTGGAGAGTAAGG No data
1166577450_1166577452 -10 Left 1166577450 19:43855664-43855686 CCAACACCAATGGGGCAGGGATG No data
Right 1166577452 19:43855677-43855699 GGCAGGGATGAGCTCTGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166577450 Original CRISPR CATCCCTGCCCCATTGGTGT TGG (reversed) Intergenic
No off target data available for this crispr