ID: 1166581539

View in Genome Browser
Species Human (GRCh38)
Location 19:43904291-43904313
Sequence CACTTACCACACCAAGAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166581536_1166581539 20 Left 1166581536 19:43904248-43904270 CCTCAGATCAGAAAACCAAAAAT No data
Right 1166581539 19:43904291-43904313 CACTTACCACACCAAGAACTGGG No data
1166581537_1166581539 5 Left 1166581537 19:43904263-43904285 CCAAAAATGTTCAGTTCTAACAG No data
Right 1166581539 19:43904291-43904313 CACTTACCACACCAAGAACTGGG No data
1166581535_1166581539 26 Left 1166581535 19:43904242-43904264 CCAGAGCCTCAGATCAGAAAACC No data
Right 1166581539 19:43904291-43904313 CACTTACCACACCAAGAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166581539 Original CRISPR CACTTACCACACCAAGAACT GGG Intergenic
No off target data available for this crispr