ID: 1166588715

View in Genome Browser
Species Human (GRCh38)
Location 19:43975378-43975400
Sequence TAGATCATCCAGGACATGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 171}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166588712_1166588715 9 Left 1166588712 19:43975346-43975368 CCATGGAATACTATGCAAACATA 0: 9
1: 750
2: 26226
3: 13868
4: 8223
Right 1166588715 19:43975378-43975400 TAGATCATCCAGGACATGGATGG 0: 1
1: 0
2: 0
3: 16
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166588715 Original CRISPR TAGATCATCCAGGACATGGA TGG Intronic
901737560 1:11322061-11322083 GAGATCACCCAGGCCATGGCAGG + Intergenic
905033275 1:34901809-34901831 TCGATTATGAAGGACATGGAAGG + Intronic
905654396 1:39676783-39676805 CCGATCATGCAGGACCTGGAGGG + Intergenic
907924764 1:58944832-58944854 TAGATCATCCAGGACCTTATGGG + Intergenic
909488388 1:76199161-76199183 TGGATCCTCCAAGACATAGAAGG + Intronic
910152765 1:84172109-84172131 TAGAGCATCAAGGATATGGTGGG + Intronic
910707434 1:90144829-90144851 TAGATTATTCAAGACATTGAAGG - Intergenic
914820449 1:151098056-151098078 TAGATTTTCCAGGAGATGAATGG + Intronic
918997728 1:191783935-191783957 TAGAGCATGCAGGTCATGTAGGG + Intergenic
922728455 1:227937513-227937535 AAGATCATCCCAGACATGGTGGG + Intronic
923453201 1:234139317-234139339 TATCTCTTCCAGGACATGGTGGG + Intronic
923476096 1:234332629-234332651 TAGATATTTCAGGACATGTAGGG - Intergenic
923582835 1:235234677-235234699 TAGATTATCCAGCAGCTGGAAGG - Intronic
1063287951 10:4711160-4711182 TAGTTCATCAAGGATATGCAAGG + Intergenic
1067459406 10:46446326-46446348 TAGAATATCCAGTACATGGCAGG - Intergenic
1067627788 10:47938304-47938326 TAGAATATCCAGTACATGGCAGG + Intergenic
1070751494 10:78966614-78966636 TAGAAGACCCAGGACCTGGATGG + Intergenic
1070751842 10:78968508-78968530 TAGAAGACCCAGGACCTGGATGG + Intergenic
1073376771 10:103041897-103041919 GAGATCACCTAGGCCATGGATGG - Intronic
1075933460 10:126319544-126319566 TAGGTCATCAAGGACAAGGAAGG + Intronic
1077975707 11:7246354-7246376 TATATTACCCAGGACCTGGAAGG + Intronic
1078713573 11:13818007-13818029 TATTAGATCCAGGACATGGAGGG + Intergenic
1078846525 11:15123755-15123777 TAGACCATACAGGAGATAGAAGG + Intronic
1080389824 11:31834607-31834629 TAGATGAACCAGGACCTGGAAGG - Intronic
1081639307 11:44742091-44742113 TAGATCACCCAGCAGGTGGAGGG + Intronic
1082094605 11:48119103-48119125 TACAGCATCTGGGACATGGACGG + Intronic
1082650873 11:55791163-55791185 TAATTCATCCAGTACATTGAAGG - Intergenic
1083529709 11:63408761-63408783 TAGATGATCCAGGGCAGGGGTGG - Exonic
1084533078 11:69740789-69740811 GAGATCATCCTGGACTAGGATGG - Intergenic
1088091430 11:106044412-106044434 TAAATCATCTAGGACAGGCATGG - Intergenic
1088475004 11:110226529-110226551 GAGAACATCCTGGAGATGGATGG + Intronic
1089150663 11:116361386-116361408 GAGTTCCTCCAGGACAGGGAAGG - Intergenic
1090874258 11:130774874-130774896 TGAATCCTCCAGGACTTGGATGG - Intergenic
1091897971 12:4120087-4120109 GAGATCATCCAGGTCAAGGGTGG + Intergenic
1094004946 12:25739294-25739316 TAGATCATCCAGGACAGTCCTGG - Intergenic
1096558831 12:52421674-52421696 AAGAACATCCAGGACATGGTAGG - Intergenic
1100016070 12:90012263-90012285 TAAATCATCCAGGACCTTGTTGG - Intergenic
1102921694 12:116796395-116796417 AAGATGATTCAGGATATGGAAGG - Intronic
1104427347 12:128688648-128688670 TAGAACATCCAGGATACAGAAGG + Intronic
1106318607 13:28617809-28617831 TAAATCATCCAATACATGAATGG + Intergenic
1106446374 13:29835923-29835945 TAGATCATGCAGGACCCTGAAGG + Intronic
1107053548 13:36078425-36078447 CAGATCATCAAGGGCTTGGAGGG - Intronic
1109339931 13:61043120-61043142 GAGATCATTCAGGACATTGAAGG + Intergenic
1114306338 14:21426756-21426778 GAGAAGATACAGGACATGGAAGG + Intronic
1117094343 14:52282300-52282322 TAGAACATGCAGGAGAAGGAGGG - Intergenic
1119875902 14:78059109-78059131 GAAATCATCCAGGACCTGGGTGG + Intergenic
1123000468 14:105291283-105291305 TGGGTCTTTCAGGACATGGAGGG - Intronic
1124422225 15:29532975-29532997 TAGAGGCTCCAGCACATGGAGGG - Intronic
1124904386 15:33855148-33855170 TAGATCAACCAGGAGAGGGAGGG + Intronic
1125744662 15:41990140-41990162 TACATCATCCTTGACATTGATGG + Exonic
1130679748 15:85986122-85986144 CTGATCATCCAAGCCATGGAGGG + Intergenic
1135189188 16:20341085-20341107 TTCATCATCCAGGACAGGTAAGG - Exonic
1136268567 16:29134952-29134974 TTGATCATCCAGCACATGGGTGG + Intergenic
1137433255 16:48435284-48435306 TAGATGAGCCAAGACATGGGAGG + Intronic
1139366189 16:66434917-66434939 TAGCTCCTCGAGGGCATGGAGGG - Intronic
1139926382 16:70489798-70489820 TAGATCTTCCAGCACATAGTTGG - Intronic
1142071878 16:88095319-88095341 TTGATCATCCAGCACATGGGTGG + Intronic
1143540823 17:7567769-7567791 TAGATCATGTAAGACATGTACGG + Intronic
1143546347 17:7598554-7598576 TAGATCATGTAAGACATGTACGG - Intronic
1146507893 17:33421357-33421379 CAGATCATCAAGGATATGGATGG - Intronic
1147337414 17:39735911-39735933 AAGATCATCCTGGATATTGAAGG - Intergenic
1149262014 17:54890569-54890591 TAAATCATCAAGGAGATGAAAGG - Intergenic
1156512903 18:37655992-37656014 CAGATCATCCAGCACAAGGTAGG + Intergenic
1159917806 18:74201912-74201934 TAGATCATACTGGATTTGGATGG + Intergenic
1162828761 19:13270910-13270932 TAGATCATGCAGGAACTGGGAGG - Intronic
1163031314 19:14545968-14545990 TAGAGCCCCCAGGACATGGCTGG + Intronic
1166588715 19:43975378-43975400 TAGATCATCCAGGACATGGATGG + Intronic
927258053 2:21057846-21057868 TAGATCACCCAGCATGTGGAAGG - Intergenic
928764122 2:34621550-34621572 TAGATGTTACAGGACTTGGAGGG + Intergenic
929165441 2:38876589-38876611 CAGTTCCTCCAGGACACGGATGG - Intronic
931744875 2:65282982-65283004 TAAATCATCCAGGGCAGGGTAGG + Intergenic
932549517 2:72753702-72753724 GAGATAATGCTGGACATGGAGGG - Intronic
932612484 2:73210165-73210187 CAGATCACCCAGGACCTGGAAGG - Intronic
935529282 2:104213072-104213094 TTCATCATTCTGGACATGGAGGG + Intergenic
936382651 2:112000445-112000467 AAGATCATCAAAGACAAGGAAGG - Intronic
938144386 2:128821655-128821677 TACATTAACCAGGACAGGGATGG + Intergenic
939096966 2:137843365-137843387 TAGATCATCCAGGAAATAACAGG + Intergenic
939594904 2:144111115-144111137 TAGATGAGCCAGGCCATAGAGGG - Intronic
940736042 2:157453633-157453655 TAGAACATGCAGGACCTTGAAGG - Intronic
941220957 2:162780249-162780271 TATATCATCGAGGAAATGAAAGG - Intronic
942428134 2:175880757-175880779 TAGATCATGCAGGACCTTCACGG + Intergenic
942712863 2:178857262-178857284 TAGACCAGCCAGGACATTGGTGG + Intronic
943878974 2:193113667-193113689 TAGAGCATGCAGAACATAGAAGG + Intergenic
945523516 2:210859612-210859634 TAGAGCAGCCAGAACATGGCAGG - Intergenic
946460688 2:219865894-219865916 TAGATCTTGCAGGACCTTGAAGG - Intergenic
946548861 2:220777994-220778016 TAGATCATTCTGGACAACGAAGG + Intergenic
946872255 2:224094728-224094750 GAGATCATCCTGGATTTGGATGG + Intergenic
948525110 2:238566658-238566680 TAGATCAGACTGGACAGGGATGG + Intergenic
1170021360 20:11840082-11840104 TGGAGCAAGCAGGACATGGAAGG - Intergenic
1170257068 20:14356793-14356815 TAGATCCTCCAGGCCAGGCACGG - Intronic
1170479580 20:16752720-16752742 GAGCTCATCCAGGAGTTGGAAGG + Intronic
1170594575 20:17795309-17795331 GAGATCATCCAGGCCAGGGAGGG + Intergenic
1170923585 20:20702245-20702267 AACACCATCCAGGAAATGGATGG + Intronic
1171079177 20:22160644-22160666 TACAGCATCCAGGACATTCAGGG + Intergenic
1174173201 20:48629589-48629611 GAGCTCATCCAGGGCATTGATGG + Exonic
1176167066 20:63679922-63679944 CAGATCATCCAGCACCTGGCAGG + Exonic
1176958184 21:15129999-15130021 TAGATCATGCAGGATCTTGAAGG + Intergenic
1177493140 21:21854376-21854398 TGAATCATCCAGGATATGAATGG + Intergenic
1181142823 22:20819761-20819783 AAGCTCTTCCAGGACACGGAGGG + Exonic
1183996141 22:41634115-41634137 GAGCTCAGGCAGGACATGGAGGG + Intronic
1184201106 22:42970346-42970368 AAAATCATCAAGGACCTGGATGG + Intronic
1185195458 22:49466627-49466649 CAGACCAGCCAGGACATGGTGGG - Intronic
954327630 3:49872229-49872251 TAGCTCTTCCAGGGCAGGGACGG + Intergenic
954702534 3:52457846-52457868 TACATCATCCAGGTCACTGATGG + Exonic
954920834 3:54189490-54189512 TAGATCTCAAAGGACATGGAAGG - Intronic
957163558 3:76641490-76641512 TAGATCATGAAGGACAAGGAAGG + Intronic
957303581 3:78425957-78425979 AAGATAATCCAGGACATATATGG + Intergenic
958481529 3:94651114-94651136 TATTTGATCCATGACATGGATGG + Intergenic
959833913 3:110896302-110896324 CAGATCATCAAGGACCTGTAGGG - Intergenic
960082125 3:113552886-113552908 TAGTTCCTCCAGAACATGCAAGG + Intronic
960132202 3:114069173-114069195 CAGATCAACAAGGACATAGATGG - Intronic
964647178 3:158970666-158970688 TAACTCATCCAGGCCATGGCTGG - Intronic
964814171 3:160698966-160698988 TAGCTCATTCAGGACACTGAAGG - Intergenic
965285743 3:166817581-166817603 TAGATCACCTAGGACATTGTAGG - Intergenic
965322967 3:167270121-167270143 TAGATGATCAAGGATATGTATGG - Intronic
967645469 3:191917963-191917985 TAGAACAGCTAGGCCATGGAAGG + Intergenic
975188480 4:71431484-71431506 AAGACCATGGAGGACATGGAGGG + Intronic
975224976 4:71860835-71860857 TAGAACATCCACGACATGCTTGG + Intergenic
977761978 4:100748946-100748968 TAGACCATTCATGACATGGTTGG - Intronic
979348634 4:119620000-119620022 TAGATTTTCCATCACATGGATGG + Intronic
987067320 5:14302973-14302995 TTGATGATCCTGGAGATGGAGGG + Intronic
987067389 5:14303261-14303283 TTGATGATCCTGGAGATGGAGGG + Intronic
987067405 5:14303331-14303353 TTGATGATCCTGGAGATGGAGGG + Intronic
987067420 5:14303401-14303423 TTGATGATCCTGGAGATGGAGGG + Intronic
987067434 5:14303473-14303495 TTGATGATCCTGGAGATGGAGGG + Intronic
987067449 5:14303545-14303567 TTGATGATCCTGGAGATGGAGGG + Intronic
987067464 5:14303614-14303636 TTGATGATCCTGGAGATGGAGGG + Intronic
987067477 5:14303686-14303708 TTGATGATCCTGGAGATGGAGGG + Intronic
987781363 5:22440591-22440613 TAGAGCAACCAGAACAAGGATGG - Intronic
988366250 5:30304087-30304109 TATTGCATACAGGACATGGAAGG - Intergenic
988924410 5:35974930-35974952 TAGATCATCATGGACTTGCAAGG + Intronic
989791765 5:45412696-45412718 TACAACCTCCAGGCCATGGAAGG - Intronic
992025779 5:72667351-72667373 CAAGTCCTCCAGGACATGGATGG + Intergenic
992296299 5:75330233-75330255 TAGATAATCCAGGACTAGCATGG - Intergenic
994344048 5:98664190-98664212 AAGACCATCCAGGAAAAGGAGGG + Intergenic
995394825 5:111676203-111676225 TAGATAATTCAGGAGAAGGAGGG + Intronic
997211671 5:132080569-132080591 CAAATCATCTAGAACATGGAGGG + Intergenic
997844181 5:137271076-137271098 TCCTTCATCCTGGACATGGATGG - Intronic
999060512 5:148629379-148629401 TTGATCAAGCATGACATGGAAGG + Intronic
999156070 5:149458437-149458459 TCGCTCATCCAGGACTTGAACGG - Intergenic
1003394374 6:5740721-5740743 CACATTATCCAGGACATTGAAGG + Intronic
1003527741 6:6911934-6911956 TAGATGATGCAGGAAAAGGAGGG - Intergenic
1003911047 6:10744127-10744149 TTGATCATTCAACACATGGACGG - Intergenic
1006648623 6:35532971-35532993 TAGATCATTCAGGCCAGGAATGG - Intergenic
1006746558 6:36346884-36346906 GAGATCATCCGGGATTTGGAGGG + Intergenic
1007022517 6:38535910-38535932 GAAACCCTCCAGGACATGGAGGG + Intronic
1011656230 6:89554407-89554429 CAGATAATCCAGGACATCAACGG + Intronic
1015513767 6:134064837-134064859 TAGAGCAGCCAGGAAAGGGATGG - Intergenic
1015644088 6:135367743-135367765 TAAATGATACAGGATATGGATGG - Intronic
1017249370 6:152262958-152262980 AAGGTGATACAGGACATGGAGGG + Intronic
1017264746 6:152429937-152429959 TATATAATCCAAGACATGTAAGG - Intronic
1018230059 6:161666720-161666742 TATATCATTCAGGACAGTGAGGG - Intronic
1019469590 7:1211644-1211666 TGGACCAACCATGACATGGACGG - Intergenic
1020002088 7:4761924-4761946 TAGATCCTGCTGGACATCGACGG - Intronic
1020940107 7:14522568-14522590 TAGTTCAACCAGGACAGGGCAGG - Intronic
1022678033 7:32518722-32518744 TAGATCATTCACGACATGCTTGG - Intronic
1022812654 7:33885117-33885139 TAGCTCATCCAGGCCATGCAAGG + Intergenic
1023086037 7:36571093-36571115 GAGATCACACAGGACAGGGAGGG + Intronic
1023473846 7:40555214-40555236 GAGAACTTCCAGGAAATGGATGG + Intronic
1023768337 7:43532484-43532506 TAGATCATGCCGGACTTGGCAGG - Intronic
1023866361 7:44240268-44240290 CAGCTCATCCAGAACTTGGAAGG + Intronic
1024367181 7:48534901-48534923 AATATAATACAGGACATGGAAGG - Intronic
1024979177 7:55143302-55143324 TAGACCATCCAGGAGGTGGCTGG + Exonic
1027690317 7:81337106-81337128 GAAATCATCAAGGACATGTATGG + Intergenic
1030016270 7:105225441-105225463 TACTTCATTCAGGACATGGAGGG - Intronic
1031584522 7:123518464-123518486 TAGATCATTTAGGACCTTGAAGG - Intronic
1032647059 7:133836439-133836461 TAAACCATCCAGCACATGAAAGG - Intronic
1041121406 8:54590140-54590162 TAGATTTTCCAAGACAGGGAAGG - Intergenic
1043052007 8:75395881-75395903 TAGCTCACCCAGCACATGGCAGG - Intergenic
1044658959 8:94577206-94577228 TAGACCATCCATGACATGCCTGG + Intergenic
1044945183 8:97382719-97382741 CAGATCATCCAGCCCAAGGAGGG + Intergenic
1048624912 8:136174523-136174545 TAGGTCATCCAGGACTTTGCAGG + Intergenic
1049441880 8:142613292-142613314 GAGATCATCCAGTACGTGGTGGG - Exonic
1050091949 9:2024337-2024359 AAGATCCTGCAGGACACGGAGGG - Intronic
1052385652 9:27820976-27820998 TAGAGCATCCAGTACATAGAGGG + Intergenic
1057176968 9:93007610-93007632 GATGTCATCCAGGACATGGCAGG - Intronic
1059359147 9:113726277-113726299 TAGAGCAAGCAAGACATGGATGG - Intergenic
1062281206 9:135752553-135752575 CACAGCGTCCAGGACATGGATGG + Intronic
1062489530 9:136798619-136798641 GGGACAATCCAGGACATGGAGGG + Intronic
1185621988 X:1455621-1455643 GAGATCATCCTGGAGAAGGACGG - Intergenic
1188228213 X:27628225-27628247 TAGATCATGTAGGAAATGAAAGG - Intronic
1188257401 X:27979902-27979924 CAGATCATCCAGTTCATGGAGGG - Exonic
1189732300 X:44034014-44034036 TGGAGCAACCAGGACCTGGATGG + Intergenic
1190842433 X:54157816-54157838 TAGAACCTCCAGGCCATGAAAGG + Intronic
1192714699 X:73627397-73627419 AAGATCACCCAGGCCTTGGATGG + Intronic
1194122652 X:89978648-89978670 TAGACCATCTACGACATGCATGG - Intergenic
1196433016 X:115647555-115647577 AAGATCTTCCAGGACATTGAGGG - Exonic
1200475511 Y:3636087-3636109 TAGACCATCTACGACATGCATGG - Intergenic