ID: 1166590742

View in Genome Browser
Species Human (GRCh38)
Location 19:43996174-43996196
Sequence AAATTGCAAAAGACTTAACC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1607
Summary {0: 1, 1: 1, 2: 3, 3: 68, 4: 1534}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166590736_1166590742 26 Left 1166590736 19:43996125-43996147 CCAGAAGCAGGAGCACATGAAGA 0: 1
1: 2
2: 5
3: 29
4: 291
Right 1166590742 19:43996174-43996196 AAATTGCAAAAGACTTAACCAGG 0: 1
1: 1
2: 3
3: 68
4: 1534
1166590741_1166590742 -6 Left 1166590741 19:43996157-43996179 CCAGCAAATCTGGGAACAAATTG 0: 1
1: 3
2: 2
3: 11
4: 175
Right 1166590742 19:43996174-43996196 AAATTGCAAAAGACTTAACCAGG 0: 1
1: 1
2: 3
3: 68
4: 1534
1166590740_1166590742 -2 Left 1166590740 19:43996153-43996175 CCTGCCAGCAAATCTGGGAACAA 0: 1
1: 0
2: 4
3: 9
4: 161
Right 1166590742 19:43996174-43996196 AAATTGCAAAAGACTTAACCAGG 0: 1
1: 1
2: 3
3: 68
4: 1534

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166590742 Original CRISPR AAATTGCAAAAGACTTAACC AGG Exonic
900217240 1:1488113-1488135 AAAATACAAAAAACTTAACTAGG - Intronic
900845715 1:5098604-5098626 AAAATACAAAAAAATTAACCAGG + Intergenic
901075425 1:6551872-6551894 AAAATACAAAAAACTTAGCCAGG + Intronic
901111403 1:6799226-6799248 AAATTAAAAAAGAATTAGCCGGG - Intronic
901276405 1:7994680-7994702 AAAATACAAAAGAATTAGCCAGG - Intergenic
901566495 1:10120360-10120382 AAAATACAAAAGACTTAGCTGGG + Intronic
901597447 1:10396762-10396784 AAAATACAAAAAAATTAACCGGG + Intergenic
901651931 1:10747975-10747997 AAAATACAAAAAACTTAGCCGGG - Intronic
901854542 1:12036245-12036267 AAAATACAAAAGAATTAGCCGGG + Intergenic
901885110 1:12217270-12217292 AAAATACAAAAAAGTTAACCGGG - Intergenic
902100013 1:13979768-13979790 AAATACCAAAAAAATTAACCAGG + Intergenic
902109190 1:14064074-14064096 AAAATACAAAAGAATTAGCCAGG - Intergenic
902488688 1:16764913-16764935 AAAATGGAAAACACTCAACCTGG - Intronic
902537312 1:17127213-17127235 AAAATGCAAAAAAATTAACCAGG + Intergenic
902595035 1:17503667-17503689 AAAATGCAAAAAAATTAGCCAGG - Intergenic
902920178 1:19661356-19661378 AAAATGCAAAAAAATTAGCCGGG - Intergenic
902942730 1:19812313-19812335 AAAATACAAAAAAATTAACCAGG - Intergenic
903112311 1:21146594-21146616 AAAATACAAAAAAATTAACCGGG + Intronic
903213364 1:21830527-21830549 AAAATGCAAAAAATTTAGCCAGG + Intronic
903350989 1:22716490-22716512 AAAATGCAAAAAAATTAGCCGGG - Intronic
903513632 1:23895059-23895081 AAAATACAAAAAAATTAACCAGG + Intronic
903518372 1:23928163-23928185 AAAATACAAAAAACTTAGCCGGG - Intergenic
903556127 1:24194742-24194764 AAAATACAAAAAAATTAACCAGG - Intergenic
904084824 1:27898704-27898726 AAAATACAAAAAAATTAACCAGG - Intronic
904156144 1:28484805-28484827 AAATTACAAAAAATTTAGCCGGG + Intronic
904166409 1:28558723-28558745 AAAATGCAAAAAAATTAGCCAGG - Intronic
904601819 1:31677244-31677266 AAATACAAAAAGAATTAACCGGG - Intronic
905714623 1:40137872-40137894 AAAATGCAAAAAAATTAACCAGG + Intergenic
905903708 1:41600710-41600732 AAATAGCAAAAGATTTTAACAGG + Intronic
905916218 1:41686230-41686252 AAAATACAAAAGAATTAGCCTGG - Intronic
906022458 1:42642063-42642085 AAAATACAAAAAACTTAGCCGGG + Intronic
906354677 1:45094355-45094377 AAAATGCAAAAAAATTAGCCAGG - Intronic
906449687 1:45934323-45934345 AAATTACAAAAAAATTAGCCGGG + Intronic
907077763 1:51593790-51593812 AAATGGGAAAAGGCTTATCCAGG + Intronic
907187817 1:52624345-52624367 AAAATACAAAAAAATTAACCAGG + Intergenic
907196776 1:52693414-52693436 AAAATGCAAAAAAATTAGCCAGG + Intronic
907358381 1:53894843-53894865 AGATTGAACAAGAGTTAACCAGG - Intronic
907633555 1:56108934-56108956 AAATACAAAAAGACTTAGCCGGG + Intergenic
907864637 1:58387885-58387907 AAAATACAAAAAAATTAACCAGG - Intronic
908246377 1:62230539-62230561 AAAATACAAAAAAATTAACCAGG - Intergenic
908270222 1:62414848-62414870 AAAATACAAAAAACTTAGCCGGG + Intergenic
908341945 1:63190439-63190461 AGATTGCAAAAGACCCATCCAGG - Intergenic
908344099 1:63213772-63213794 AAAATGCAAAAAAATTAGCCAGG + Intergenic
908504838 1:64786630-64786652 AAAATGCAAAAAACTTAGCCAGG + Intronic
908533145 1:65052651-65052673 AAAATACAAAAAACTTAGCCGGG + Intergenic
908644633 1:66264262-66264284 AAATTCCAAAATCCTTAGCCTGG - Intronic
908705945 1:66954865-66954887 AAATTACAAAACAATTAGCCAGG - Intronic
909006004 1:70277295-70277317 AAAATGCAAAAGAATTATCCGGG + Intronic
909010071 1:70324239-70324261 AAATTGTACAAAACTTAATCTGG - Intronic
909012647 1:70352177-70352199 AAATTACAAAAAAATTAGCCTGG + Intronic
909462579 1:75935026-75935048 AAAATACAAAAGAATTAGCCAGG + Intergenic
909854049 1:80505855-80505877 AAAATGCAAAAAAATTAACCAGG - Intergenic
909888228 1:80969702-80969724 AAAATACAAAAAAATTAACCAGG - Intergenic
910053276 1:83001688-83001710 AAAATACAAAAGAATTAGCCGGG + Intergenic
910136798 1:83981669-83981691 AAATAGCAAAAAAATTAGCCAGG + Intronic
910691070 1:89966254-89966276 AAAATGCAAAAAAGTTAGCCGGG + Intergenic
910823392 1:91376603-91376625 AAAAGGCAAATGACATAACCTGG + Intronic
910828310 1:91432786-91432808 AAAATACAAAATAATTAACCAGG - Intergenic
910892020 1:92028478-92028500 AAAATACAAAAAACTTAGCCGGG + Intergenic
910998772 1:93139548-93139570 AAAATGCAAAAAAATTAGCCTGG + Intergenic
911017466 1:93348424-93348446 AAATTGCAAAAGATTTCAGCAGG + Intronic
911330380 1:96519677-96519699 AAATTACAAAAAAATTAGCCGGG - Intergenic
911624194 1:100102516-100102538 AAATTGCAAAAAAATTAGCTGGG + Intronic
911652908 1:100410049-100410071 AAAATAAAAAAGAATTAACCAGG + Intronic
911656837 1:100453798-100453820 AAAATACAAAAAAATTAACCAGG - Intronic
911708954 1:101046742-101046764 AAAATACAAAAAACTTAGCCGGG - Intergenic
911777557 1:101833608-101833630 AAATTCCAAAAGAATTATCCAGG - Intronic
912010016 1:104947762-104947784 AAATTACAAAAGTCTTAATTTGG - Intergenic
912436659 1:109666884-109666906 AAAATGCAAAAAAATTAGCCAGG - Intronic
912610503 1:111037839-111037861 AAATTACAAAAAAATTAGCCGGG + Intergenic
912783311 1:112574073-112574095 AAAATACAAAAAAATTAACCGGG - Intronic
912814590 1:112818825-112818847 AAAGTACAAAAAAATTAACCAGG + Intergenic
912819925 1:112858891-112858913 AAATTACAAAAAAATTAGCCGGG + Intergenic
912848703 1:113102428-113102450 AAAATACAAAAAAATTAACCGGG - Intronic
913122053 1:115751509-115751531 AAAATACAAAAGAATTAGCCGGG + Intronic
913427964 1:118755812-118755834 AAAATACAAAAAAATTAACCAGG + Intergenic
914004394 1:143719959-143719981 AAAATACAAAAGAATTAGCCGGG - Intergenic
914045687 1:144089991-144090013 AAAATGCAAAAAAATTAGCCGGG + Intergenic
914132423 1:144870695-144870717 AAAATGCAAAAAAATTAGCCGGG - Intergenic
914391184 1:147224668-147224690 AAAATGCAAAAAAATTAGCCGGG - Intronic
914516849 1:148381574-148381596 AAAATACAAAAAACTTAGCCGGG + Intergenic
914782690 1:150800034-150800056 AAAATGCAAAAAAATTAGCCAGG + Intronic
914864535 1:151415508-151415530 AAAATGCAAAAAAATTAGCCGGG + Intronic
914903421 1:151724958-151724980 AAAATGCAAAATAATTAGCCGGG - Intronic
915247012 1:154563294-154563316 AAAATGCAAAAAAATTAGCCGGG + Intergenic
915372703 1:155364779-155364801 AAAATACAAAAAAATTAACCAGG + Intronic
915397329 1:155595336-155595358 AAAATACAAAAAAATTAACCAGG - Intergenic
915531858 1:156507264-156507286 AAAATACAAAAAAATTAACCAGG + Intergenic
915863990 1:159478381-159478403 AAAATGCAAAAAAATTAGCCAGG - Intergenic
916043503 1:160981415-160981437 AAAATACAAAAAAATTAACCGGG - Intergenic
916486582 1:165265041-165265063 AAAATGCAAAAAAATTAGCCGGG + Intronic
917361045 1:174176549-174176571 AAAATACAAAAAACTTAGCCAGG + Intronic
917847986 1:179038248-179038270 AAAATGCAAAAGCCTTAGCTGGG + Intronic
917885707 1:179382237-179382259 AAAATACAAAAGAATTAGCCGGG - Intronic
917892710 1:179454933-179454955 AAAATACAAAAAACTTAGCCGGG + Intronic
917992592 1:180397427-180397449 ACATTTCAAAAGAGTTAATCTGG + Intronic
918063471 1:181082833-181082855 AAAATACAAAAAAATTAACCAGG + Intergenic
918770124 1:188546200-188546222 AAAATACAAAAAACTTAGCCGGG - Intergenic
918942212 1:191015149-191015171 AAAATACAAAAAACTTAGCCAGG + Intergenic
919183017 1:194109818-194109840 AAAATACAAAAAACTTAGCCGGG - Intergenic
919216753 1:194566740-194566762 AAAATACAAAAAACTTAGCCGGG - Intergenic
919375486 1:196788540-196788562 AACATGCAAAAGACTTAATTTGG - Intronic
919385163 1:196913064-196913086 AACATGCAAAAGACTTAATTTGG - Intronic
919404723 1:197165447-197165469 AAAATGCAAAAAAATTAGCCGGG + Intronic
919542426 1:198866534-198866556 AAAAAACAAAAGACTTAATCTGG + Intergenic
919686691 1:200489470-200489492 AAAATACAAAAAACTTAAGCAGG - Intergenic
919831895 1:201547145-201547167 AAATTACAAAAAAATTAGCCGGG - Intergenic
919903604 1:202061889-202061911 AAAATGCAAAAAAATTAGCCAGG + Intergenic
920662858 1:207932602-207932624 ACATTAAAAAAGACTTAAACAGG - Intergenic
920989393 1:210922219-210922241 AAAATACAAAAAACTTAGCCAGG + Intronic
921050399 1:211506984-211507006 AAAATGCAAAAAAATTAGCCAGG + Intergenic
921056214 1:211544567-211544589 AAAATGAATGAGACTTAACCAGG + Intergenic
921718049 1:218438946-218438968 AAAATACAAAAAAATTAACCAGG + Intronic
921723772 1:218502237-218502259 AAAATGCAAAAAAATTAGCCAGG + Intergenic
921856053 1:219985561-219985583 AAAATACAAAAAAATTAACCAGG - Intronic
922231198 1:223688240-223688262 AAATTAAAAAAAAATTAACCTGG - Intergenic
922410414 1:225368617-225368639 CAATTGCAAGAAAATTAACCCGG - Intronic
922491937 1:226024833-226024855 AAAATGCAAAAAAATTAGCCAGG + Intergenic
922983535 1:229848807-229848829 AAAGTGGAAAAGACTTACCAAGG + Intergenic
923164248 1:231344344-231344366 AAATTGAAAAAAAATTAGCCAGG + Intronic
923177462 1:231480863-231480885 AAAATACAAAAAAATTAACCGGG - Intergenic
923531752 1:234817606-234817628 AAAATGGAAAACACTCAACCTGG + Intergenic
923583308 1:235239756-235239778 AAAATGCAAAATATTCAACCTGG + Intronic
923815467 1:237373045-237373067 AAATTACAAAAGACTTTAATAGG + Intronic
923838907 1:237646035-237646057 AAAATACAAAAGAATTAGCCGGG - Intronic
923988478 1:239408361-239408383 AAAATACAAAAGAATTAGCCGGG + Intronic
923991924 1:239447613-239447635 AAAATACAAAAAACTTAGCCGGG + Intronic
924012807 1:239684534-239684556 AAAATGCAAAAAAATTAGCCGGG + Intronic
924036007 1:239938694-239938716 AAATTTCAAAAGACTTAAATTGG + Intergenic
924279259 1:242419554-242419576 AAAATGCAAAAAATTTAGCCGGG - Intronic
924533353 1:244912464-244912486 AAAATACAAAAAAATTAACCAGG - Intergenic
924757637 1:246956146-246956168 AAAATGCAAAAAAATTAGCCGGG - Intronic
1063343444 10:5290249-5290271 AAAATGCAAAAAATTTAGCCGGG - Intergenic
1063465470 10:6241063-6241085 AAAATACAAAAAAATTAACCAGG - Intergenic
1063483066 10:6393730-6393752 AAAATACAAAAAAATTAACCAGG - Intergenic
1063679448 10:8173035-8173057 AAACTGCAAAAAAATTAGCCAGG - Intergenic
1063842049 10:10083159-10083181 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1063846683 10:10136403-10136425 AAAATACAAAAAAATTAACCAGG - Intergenic
1064068741 10:12206796-12206818 AAAATGCAAAAAAATTAGCCGGG + Intronic
1064090607 10:12380052-12380074 AAAATGCAAAAAAATTAGCCGGG + Intronic
1064258413 10:13765273-13765295 AAAATGCAAAAAAATTAGCCAGG - Intronic
1064393502 10:14960866-14960888 AAAATACAAAAAAATTAACCAGG + Intronic
1064421600 10:15195518-15195540 AAAATACAAAAGAATTAGCCGGG + Intergenic
1064443427 10:15372535-15372557 AAAATACAAAAAAATTAACCAGG + Intergenic
1065032302 10:21599722-21599744 AAAATACAAAAAACTTAGCCGGG - Intronic
1065079749 10:22116347-22116369 AAAATTCAAAAAAATTAACCAGG - Intergenic
1065318803 10:24489701-24489723 AAAATACAAAAGAATTAGCCAGG + Intronic
1065446666 10:25809412-25809434 AAAATACAAAAAAATTAACCAGG + Intergenic
1065567482 10:27028434-27028456 AAAATACAAAAAAATTAACCGGG + Intronic
1065608923 10:27451303-27451325 AAATTAAAAAAGAATTAGCCTGG - Intergenic
1066024385 10:31339607-31339629 AAAATACAAAAAACTTAGCCAGG + Intronic
1066419288 10:35249091-35249113 AAATTTCAAAAAAATTAGCCAGG - Intronic
1066536049 10:36393312-36393334 AAAATACAAAAAAATTAACCAGG + Intergenic
1066559716 10:36656831-36656853 AAAATACAAAAGAATTACCCAGG + Intergenic
1066636335 10:37505409-37505431 AAATTACATAAAAATTAACCTGG - Intergenic
1066701687 10:38136302-38136324 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1067033435 10:42896290-42896312 AAAGTGCAAAAGACTTCAGAAGG + Intergenic
1067102835 10:43345239-43345261 AAATTACAAAAAAATTAGCCAGG + Intergenic
1067308170 10:45086090-45086112 AAATTACAAAAAAATTAGCCAGG + Intergenic
1067369509 10:45670385-45670407 AAAATGCAAAAAAATTAGCCGGG - Intronic
1067480359 10:46592727-46592749 AAAATACAAAAGAATTAGCCAGG - Intronic
1067614378 10:47749072-47749094 AAAATACAAAAGAATTAGCCAGG + Intergenic
1068297249 10:55088427-55088449 AAAATACAAAAAAATTAACCTGG - Intronic
1068411769 10:56664577-56664599 AAACAGCAAACGACTCAACCTGG + Intergenic
1068668813 10:59703877-59703899 AAATACCAAAAGAATTAGCCAGG - Intronic
1068936649 10:62641812-62641834 AAATTGCAGAAGACTAAATAAGG + Intronic
1069011498 10:63378429-63378451 AAAATACAAAAAAATTAACCGGG + Intronic
1069531007 10:69219496-69219518 AAAATACAAAAAACTTAGCCAGG - Intergenic
1069697876 10:70400567-70400589 AAAATACAAAAAAATTAACCGGG + Intergenic
1069706934 10:70464784-70464806 AAATTACAAAAAAATTAGCCGGG - Intergenic
1070052535 10:72903384-72903406 AAAATACAAAAGAATTAGCCAGG - Intronic
1070123775 10:73603585-73603607 AAAATGCAAAAAAGTTAATCAGG + Intronic
1070294443 10:75147484-75147506 AAAATGCAAAAAAATTAGCCAGG - Intronic
1070308449 10:75255201-75255223 AAAATACAAAAAAATTAACCAGG - Intergenic
1070315632 10:75309000-75309022 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1070363191 10:75710809-75710831 AAACTGCAAATGACTAAGCCAGG - Intronic
1070380030 10:75872462-75872484 AAAATACAAAAAAATTAACCAGG - Intronic
1070502286 10:77083219-77083241 AAATTGCAGAAGAGTTAAGAGGG - Intronic
1071277589 10:84069713-84069735 AAATTACAAAAAAATTAGCCGGG + Intergenic
1071546270 10:86532148-86532170 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1071629784 10:87209048-87209070 AAAATACAAAAGAATTAGCCAGG + Intergenic
1071734987 10:88288602-88288624 ACATTGCACAAGTATTAACCAGG + Intronic
1071826540 10:89331330-89331352 AAAATACAAAAAAATTAACCAGG - Intronic
1072203993 10:93186609-93186631 AAAGTGAAAAAGAGTTAAACCGG + Intergenic
1072238647 10:93474905-93474927 AAAATACAAAAAACTTAGCCAGG - Intronic
1072302214 10:94072435-94072457 AAAATACAAAAAACTTAGCCAGG - Intronic
1072353125 10:94577900-94577922 AAATTACAAAAAAATTAGCCGGG + Intronic
1072585420 10:96777519-96777541 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1072604166 10:96965167-96965189 AAAATGCAAAAAAATTAGCCAGG - Intronic
1072645025 10:97247148-97247170 AAATTACAAAAAAATTAGCCGGG + Intronic
1073005538 10:100321297-100321319 AAAATACAAAAAAATTAACCAGG + Intronic
1073010907 10:100358765-100358787 AAAGTACAAAAAACTTAGCCAGG + Intronic
1073751315 10:106530435-106530457 AAATTGAAAAAGAATTAGCTAGG - Intergenic
1074124995 10:110521678-110521700 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1074368248 10:112877549-112877571 AAATTACAAAAAAATTAGCCGGG - Intergenic
1074505583 10:114067588-114067610 AAATTACAAAAAAATTAGCCAGG - Intergenic
1074954937 10:118379671-118379693 AAATTACAAAAAAATTAGCCAGG - Intergenic
1074973046 10:118557376-118557398 AAAATACAAAAAACTTAGCCAGG + Intergenic
1075208418 10:120467237-120467259 AAATTACAAAAAAATTAGCCAGG - Intronic
1075317898 10:121466914-121466936 AAATTACAAAACAATTAGCCAGG - Intergenic
1075339717 10:121636817-121636839 GAAATGCAACACACTTAACCAGG - Intergenic
1075373890 10:121962256-121962278 AAAGTACAAAAGAATTAGCCAGG + Intronic
1075828947 10:125387465-125387487 AAATTGGCAAAGACTTAAAAGGG - Intergenic
1076409772 10:130238237-130238259 AAATTTTAAAAGACTTAAATGGG - Intergenic
1076863325 10:133153393-133153415 AAAATACAAAAAAATTAACCAGG + Intergenic
1077290516 11:1788288-1788310 AAAATACAAAAAACTTAGCCGGG + Intergenic
1077381835 11:2247084-2247106 AAAATACAAAAAACTTAGCCGGG + Intergenic
1077831023 11:5870401-5870423 AAAATACAAAAAAATTAACCGGG + Intronic
1078113036 11:8415270-8415292 CAGTTTCCAAAGACTTAACCTGG - Intronic
1078139818 11:8683836-8683858 AAATAGAAAAAGAATTAGCCGGG - Intronic
1078201124 11:9184190-9184212 AAAATGCAAAAAAATTAGCCGGG + Intronic
1078287539 11:9972639-9972661 AAAATACAAAAGAATTAGCCAGG - Intronic
1078420000 11:11202817-11202839 AAAATACAAAAAACTTAGCCAGG + Intergenic
1078577716 11:12515995-12516017 AAAATACAAAAAAATTAACCGGG - Intronic
1078587685 11:12607883-12607905 AAATTACAAAAAAATTAGCCGGG + Intergenic
1078637716 11:13067313-13067335 AAATGGCAAAAGACTTGAATAGG + Intergenic
1078999703 11:16740933-16740955 AAAATACAAAAAAATTAACCGGG + Intronic
1079060671 11:17246130-17246152 AAAATACAAAAAAATTAACCAGG + Intronic
1079120177 11:17677374-17677396 AAATGGCAAAAGACTTGAACAGG + Intergenic
1079707519 11:23638876-23638898 AAAATACAAAAAACTTAGCCGGG - Intergenic
1079738142 11:24023584-24023606 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1079862552 11:25692385-25692407 AAAATGCAAAAAAATTAGCCTGG + Intergenic
1079893760 11:26092783-26092805 AAAATACAAAAAAATTAACCGGG - Intergenic
1080301593 11:30790969-30790991 AAAATACAAAAAACTTAGCCGGG - Intergenic
1080561032 11:33462985-33463007 AAATAGAAAAAGAATTAGCCAGG - Intergenic
1080841043 11:35983781-35983803 AAAATACAAAAGAATTAGCCTGG - Intronic
1080962073 11:37172365-37172387 AAATTAAAAAAAAATTAACCAGG + Intergenic
1080975663 11:37337224-37337246 ACATAGCAAGAGACTTAACGAGG + Intergenic
1081038358 11:38178329-38178351 AAAATACAAAAAACTTAGCCGGG - Intergenic
1081178483 11:39958486-39958508 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1081341346 11:41931810-41931832 AAATTGCAAAAGATTCACTCAGG + Intergenic
1081457711 11:43241641-43241663 AAAATACAAAAAAATTAACCAGG + Intergenic
1082117539 11:48343649-48343671 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1082697432 11:56386824-56386846 AAAATACAAAAAAATTAACCGGG + Intergenic
1083346616 11:61997821-61997843 AAAATACAAAAAAATTAACCGGG + Intergenic
1083574634 11:63781232-63781254 AAAATACAAAAGAATTAGCCAGG + Intergenic
1084018587 11:66402931-66402953 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1084034577 11:66501198-66501220 AAAGTGCAAAAAAGTTAGCCAGG + Intronic
1084830325 11:71763750-71763772 AAAATGCAAAAAAATTAGCCCGG + Intergenic
1084910899 11:72388409-72388431 AAAATGCAAAAAAATTAGCCGGG - Intronic
1085065564 11:73492479-73492501 AAATTTCAAAAAAATTAGCCGGG + Intronic
1085169139 11:74433478-74433500 AATTTTCAAAAGACTTAAACAGG + Intergenic
1085503712 11:77043544-77043566 AAAATACAAAAAAATTAACCGGG + Intergenic
1085580151 11:77643294-77643316 AAAATACAAAAAACTTAGCCAGG - Intergenic
1086050285 11:82581255-82581277 AAAATACAAAAGAATTAACTGGG + Intergenic
1086056967 11:82658242-82658264 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1086076181 11:82855456-82855478 AAAATGCAAAAAACTTAGCCGGG + Intronic
1086238516 11:84661109-84661131 AAATTGCAGGTGACTTTACCTGG - Intronic
1086348426 11:85921339-85921361 AAATTACAAAAAAATTAGCCAGG + Intergenic
1086431937 11:86744514-86744536 AAAATACAAAAAAATTAACCGGG + Intergenic
1086662461 11:89437205-89437227 AAAATACAAAAAACTTAGCCGGG + Intronic
1086664116 11:89458210-89458232 CATTTGCAAAAGATTTAATCTGG + Intronic
1086689152 11:89769019-89769041 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1087785788 11:102352569-102352591 AAAATACAAAAAAATTAACCAGG - Intronic
1088070466 11:105778097-105778119 AAAATGGAAAGGACTTTACCTGG - Intronic
1088454220 11:110016644-110016666 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1088507401 11:110539915-110539937 AAATAGCAAAAGAATATACCTGG + Intergenic
1088555731 11:111058842-111058864 AAATTGCAACTGACTTGACAGGG + Intergenic
1088685478 11:112281301-112281323 AAAATGCAAAACAATTACCCAGG - Intergenic
1089549825 11:119265035-119265057 AAAATGCAAAAAAATTAGCCAGG - Intronic
1089567561 11:119380073-119380095 AAATTACAAAAAAATTAGCCGGG - Intronic
1089767773 11:120780900-120780922 AAAATGCAAAAAAATTAGCCAGG - Intronic
1089968642 11:122674539-122674561 AAAATGCAAAAAAATTAGCCGGG - Intronic
1090053719 11:123403264-123403286 AAATTACAAAAAAATTAGCCAGG + Intergenic
1090182359 11:124711494-124711516 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1090774807 11:129954421-129954443 AAAATACAAAAAACTTAGCCAGG - Intronic
1090968028 11:131615524-131615546 AAATTACAAAAAAATTAGCCAGG - Intronic
1091523341 12:1270366-1270388 AAAATGCAAAAAAATTAGCCAGG - Intronic
1091599515 12:1909350-1909372 AAAATGCAAAAAATTTAGCCGGG - Intronic
1091819746 12:3467077-3467099 AAAATACAAAAAAATTAACCGGG + Intronic
1092136976 12:6156249-6156271 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1092188544 12:6499960-6499982 AAATTACAAAAAAGTTAGCCAGG + Intronic
1092343699 12:7697976-7697998 AAAATACAAAAGAATTAGCCGGG + Intergenic
1092600427 12:10055896-10055918 AAAATGCAAAAAAATTAGCCGGG + Intronic
1092650774 12:10632379-10632401 AAATTGCAAAAGCATTAAGCAGG + Intronic
1092878595 12:12870154-12870176 AAAATACAAAAAACTTAGCCAGG + Intergenic
1093001318 12:13999897-13999919 AAAATACAAAAAAATTAACCGGG - Intergenic
1093127534 12:15348624-15348646 AAAATACAAAAAAATTAACCGGG + Intronic
1093461152 12:19407888-19407910 AAAATACAAAAAACTTATCCCGG + Intronic
1093837452 12:23852148-23852170 AAATTCTAAAATACTTAAACAGG + Intronic
1094391156 12:29951758-29951780 AAGTTTCAAAATACTTAAACTGG - Intergenic
1094431797 12:30378193-30378215 AAAATACAAAAAAATTAACCAGG - Intergenic
1094628019 12:32143939-32143961 AAATGGCTGAAGACTTAAACAGG - Intronic
1095267876 12:40181172-40181194 AAAATACAAAAAAATTAACCAGG + Intergenic
1095391584 12:41713329-41713351 AAAAAGCAAAAGAATAAACCAGG - Intergenic
1095755952 12:45767530-45767552 AAATAGCAACAAACTTAAGCTGG + Intronic
1095764254 12:45876929-45876951 AAAATACAAAAAAATTAACCAGG + Intronic
1095791688 12:46174796-46174818 AAAAGGCAAAAAACATAACCAGG + Intergenic
1095868897 12:47003799-47003821 AAAATACAAAAAAATTAACCGGG - Intergenic
1095886619 12:47195002-47195024 GAATTCCAAAAGACTAAAACAGG - Intronic
1095897247 12:47292259-47292281 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1095912172 12:47439313-47439335 AAATACCAAAAAAATTAACCAGG + Intergenic
1096275949 12:50208323-50208345 AAAATGCAAAAAAATTAGCCAGG + Intronic
1097012042 12:55960029-55960051 AAAATACAAAAGAATTAGCCGGG + Intronic
1097097721 12:56562960-56562982 AAAATACAAAAGAATTAGCCGGG + Intronic
1097163611 12:57068724-57068746 AAAATGCAAAAAAATTAGCCAGG - Intronic
1097210412 12:57364306-57364328 AAAATGCAAAAAAATTAGCCAGG - Intronic
1098203008 12:68077105-68077127 AAAATACAAAAAAGTTAACCAGG + Intergenic
1098244974 12:68507495-68507517 AAAATGCAAAACAATTAGCCAGG + Intergenic
1098376168 12:69817910-69817932 AACAGGCAAAAGACTGAACCAGG + Exonic
1098415738 12:70232976-70232998 AAAATACAAAAAACTTAGCCCGG - Intergenic
1098471054 12:70844728-70844750 AAATTCCAATAGACTTCAGCTGG + Intronic
1098862383 12:75724540-75724562 AAAATACAAAAAAATTAACCGGG - Intergenic
1098914143 12:76239900-76239922 AAAATACAAAAAAATTAACCAGG + Intergenic
1099057807 12:77867578-77867600 AAAATGCAAAAAAATTAGCCGGG - Intronic
1099325151 12:81205579-81205601 ACATTGTAAAACACTTAACTAGG + Intronic
1099470380 12:83040843-83040865 AAATTACAAAAAAATTAGCCGGG - Intronic
1099657634 12:85514674-85514696 AGATAGCAAAATTCTTAACCAGG + Intergenic
1099769793 12:87036523-87036545 AAATTGCACAACACTTGATCAGG + Intergenic
1099778049 12:87159572-87159594 AAATTGCCAAACACTCACCCAGG - Intergenic
1099972139 12:89511262-89511284 AAAATGCAAAAAAGTTAGCCAGG + Intronic
1100510956 12:95272906-95272928 AAAATGCAAAAAAATTAGCCAGG - Intronic
1100696400 12:97098704-97098726 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1100698024 12:97116866-97116888 AAAATACAAAAAATTTAACCGGG - Intergenic
1101090407 12:101279600-101279622 AAAATACAAAAGAATTAGCCGGG + Intergenic
1101105170 12:101433500-101433522 AAATTGAAAATGACTCAGCCTGG - Intergenic
1101333799 12:103778643-103778665 AAAATGCAAAAAATTTGACCAGG + Intronic
1101918437 12:108913807-108913829 AAAATACAAAAGAATTAGCCAGG - Intronic
1102106205 12:110325825-110325847 AAATACCAAAAAAATTAACCCGG + Intronic
1102154436 12:110713291-110713313 AAAATGCAAAATAATTAGCCGGG - Intergenic
1102242733 12:111335230-111335252 AAAATACAAAAAAATTAACCAGG + Intronic
1102378340 12:112441935-112441957 AAAATGCAAAAAAATTAGCCAGG - Intronic
1102397265 12:112597422-112597444 AAAATGCAAAAAAATTAGCCAGG + Intronic
1102557071 12:113733945-113733967 AAAATACAAAAGAATTAGCCAGG - Intergenic
1102713335 12:114948040-114948062 AAAATACAAAAAAATTAACCAGG - Intergenic
1102809027 12:115807963-115807985 AAAATGCAAGAGACTTGAACAGG - Intergenic
1102971698 12:117173187-117173209 AAAATGCAAAAAAATTAGCCAGG - Intronic
1103292144 12:119855260-119855282 AAATTACAAAAAAATTAGCCGGG + Intronic
1103335007 12:120182777-120182799 AAAATACAAAAGAATTAGCCAGG + Intronic
1103507353 12:121450697-121450719 AAAATGCAAAAAAATTAGCCAGG + Intronic
1103515754 12:121507203-121507225 AAATTACAAAAAAATTAGCCAGG + Intronic
1103521730 12:121540590-121540612 AAAATGCAAAAAAATTAGCCGGG + Intronic
1103569470 12:121835215-121835237 AAAATACAAAAAACTTAGCCGGG - Intergenic
1104233402 12:126907518-126907540 AAAATACAAAAGAATTAGCCGGG + Intergenic
1104631249 12:130404456-130404478 AAAATACAAAAGAATTAGCCGGG - Intronic
1104861910 12:131928493-131928515 AAAATACAAAAAAATTAACCGGG + Intergenic
1105515061 13:21082044-21082066 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1105738869 13:23300953-23300975 AAAATACAAAAGAATTAGCCGGG + Intronic
1106081327 13:26502471-26502493 AAAATGCAAAAAACTTAGCCGGG + Intergenic
1106088998 13:26570125-26570147 AAATTACAAAAAAATTAGCCGGG + Intronic
1106154025 13:27135552-27135574 AAAATCCAAAAAACTTAGCCGGG + Intronic
1106234057 13:27846509-27846531 AAAATGCAAAAGAGTTAGCCAGG + Intergenic
1106375756 13:29186051-29186073 AAGTTAAAAAAAACTTAACCAGG + Intronic
1106438235 13:29742556-29742578 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1106471143 13:30055460-30055482 AAAATACAAAAAAATTAACCGGG + Intergenic
1106488015 13:30189811-30189833 AAAATACAAAAAACTTAGCCAGG - Intergenic
1106689911 13:32103804-32103826 AAAATACAAAAGAATTAGCCAGG + Intronic
1106992239 13:35435169-35435191 AAAATTCAAAAGAGTTAGCCGGG - Intronic
1107088390 13:36449800-36449822 AAATGTCAAAAAAATTAACCAGG - Intergenic
1107285947 13:38792186-38792208 AAAATACAAAAAACTTAGCCGGG + Intronic
1107521953 13:41192437-41192459 AAACTGCAAAAGGCCTAACATGG + Exonic
1107522759 13:41199846-41199868 AAATTGCAGAATTCTTTACCAGG + Intergenic
1107598827 13:41991788-41991810 AAAATACAAAAAACTTAGCCAGG + Intergenic
1108060043 13:46523819-46523841 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1108332986 13:49409088-49409110 AAATTGCTAAAGACATAGGCTGG + Intronic
1108516356 13:51206485-51206507 AAAATACAAAAGAATTAGCCAGG + Intergenic
1108548191 13:51517580-51517602 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1108611785 13:52090863-52090885 AAAATACAAAAAAATTAACCAGG + Intronic
1109125019 13:58506075-58506097 AAATTACAAAAAAATTAGCCTGG + Intergenic
1109166186 13:59038486-59038508 AAAATACAAAAAAATTAACCGGG + Intergenic
1109224015 13:59670741-59670763 AAAATGCAAAAAAATTAGCCGGG - Intronic
1109432000 13:62248536-62248558 AAAATACAAAAAAATTAACCAGG - Intergenic
1109577988 13:64287372-64287394 AAATTGCAAAAGTCTTAAAATGG - Intergenic
1109597237 13:64571656-64571678 AAAATACAAAAAAATTAACCAGG - Intergenic
1109997843 13:70153412-70153434 AAAATACAAAAAACTTAGCCGGG + Intergenic
1110800396 13:79687323-79687345 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1110938095 13:81317944-81317966 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1111154727 13:84307872-84307894 AAAATGCAAAAAATTTAGCCGGG + Intergenic
1111660128 13:91199441-91199463 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1111784672 13:92771501-92771523 AAAATGCAAAAAAATTAGCCGGG - Intronic
1112122504 13:96428747-96428769 AACAGGCAAAAGATTTAACCAGG + Intronic
1112471328 13:99692450-99692472 AAAGTTCAAAAAAATTAACCGGG - Intronic
1112938292 13:104827831-104827853 AAAATACAAAAAACTTAGCCGGG + Intergenic
1113333428 13:109354714-109354736 AAAATACAAAAGAATTAGCCGGG - Intergenic
1113347451 13:109494197-109494219 AAATTACAAAAAAATTAGCCGGG + Intergenic
1113669666 13:112167044-112167066 AAATTTCAGAAGAATTATCCAGG + Intergenic
1113991576 14:16031431-16031453 AAAATACAAAAAAATTAACCAGG + Intergenic
1114294909 14:21320449-21320471 AAAATACAAAAAAATTAACCGGG - Intronic
1114767387 14:25389310-25389332 AAATTTTAAAAAACTTAACAGGG + Intergenic
1114837716 14:26223272-26223294 AAAATACAAAAAACTTAGCCGGG - Intergenic
1115327378 14:32155411-32155433 AAATTATAAAATACTTAACTGGG - Exonic
1115612819 14:35064998-35065020 GAATTGCAAATGACTTCATCTGG + Intronic
1115891414 14:38033627-38033649 AAAATACAAAAAAATTAACCGGG + Intronic
1116144840 14:41051996-41052018 AAAATACAAAAAACTTAGCCAGG - Intergenic
1116261480 14:42633957-42633979 AAATTGCAACAAATTTAACCAGG + Intergenic
1116697653 14:48198560-48198582 AAAATACAAAAAACTTAGCCGGG + Intergenic
1116830192 14:49712076-49712098 AAAATACAAAAAAATTAACCAGG - Intronic
1117122293 14:52581033-52581055 AAAGTACAAAAGAATTAGCCGGG + Intronic
1117364416 14:55011369-55011391 AAATTACAAAAAAATTAGCCAGG + Intronic
1117385020 14:55202846-55202868 AAAGTGCAAAAAACTTAGTCAGG + Intergenic
1117451606 14:55856192-55856214 AATTGGCAAAAGACTTACACAGG + Intergenic
1117704549 14:58451147-58451169 AAAATACAAAAAATTTAACCAGG - Intronic
1117786961 14:59296018-59296040 CAATTGCAGAAGACTAAACCAGG - Intronic
1118164859 14:63326263-63326285 AAAATACAAAAGAATTAGCCGGG - Intergenic
1118205320 14:63717480-63717502 AAAATGCAAAAAAATTAGCCGGG - Intronic
1118205387 14:63718085-63718107 AAATTACAAAAAAATTAGCCAGG + Intronic
1118539662 14:66808193-66808215 AAAGTAGAAAAGACTTAAACAGG - Intronic
1118691964 14:68348736-68348758 AAAATACAAAAAAATTAACCAGG + Intronic
1118695547 14:68381513-68381535 AAAATACAAAAAAATTAACCAGG + Intronic
1118792388 14:69106879-69106901 AAAATACAAAAAAATTAACCGGG + Intronic
1118810852 14:69272200-69272222 AAAATACAAAAAAATTAACCGGG + Intronic
1118969263 14:70619295-70619317 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1118977665 14:70691650-70691672 AAAATACAAAAGAATTAGCCGGG - Intergenic
1119009006 14:70964225-70964247 AAAATGCAAAAAAATTAGCCAGG - Intronic
1119012721 14:71012670-71012692 AAATAGAAAAAGAATTAGCCGGG + Intronic
1119271346 14:73307891-73307913 AAAATGCAAAAAAATTAGCCGGG - Intronic
1119469898 14:74889527-74889549 AAAATACAAAAAACTTAGCCAGG - Intronic
1119569776 14:75660413-75660435 AAAGTGTAAATGACTTACCCAGG - Intronic
1119762829 14:77164584-77164606 AAAATGCAAAAAAATTAGCCGGG - Intronic
1119811952 14:77528994-77529016 AAAATACAAAAAAATTAACCAGG - Intronic
1119852501 14:77875969-77875991 ATATTGCAAAAGACTAAAAATGG + Intronic
1120009179 14:79393652-79393674 AAAATACAAAAAAATTAACCGGG + Intronic
1120107762 14:80516024-80516046 AAAATACAAAAAAGTTAACCAGG - Intronic
1120138347 14:80897936-80897958 AAAATACAAAACAATTAACCTGG - Intronic
1120205409 14:81581980-81582002 AAATTACAAAAAAATTAGCCGGG + Intergenic
1120318305 14:82926049-82926071 AAAATACAAAAAACTTAGCCAGG - Intergenic
1120338895 14:83193391-83193413 AAAATACAAAAGAATTAGCCAGG + Intergenic
1120360606 14:83496776-83496798 AAATTGCAAATCATTTAAACTGG + Intergenic
1120365478 14:83562835-83562857 AAATTACAAAAAAATTAGCCGGG - Intergenic
1120386939 14:83858210-83858232 AAATTACAAAAAAATTAGCCGGG + Intergenic
1121350078 14:93166488-93166510 AAAATACAAAAAAATTAACCGGG + Intergenic
1121669044 14:95694025-95694047 AAATTACAAAAAAATTAGCCGGG - Intergenic
1121727628 14:96164807-96164829 AAATTACAAAAAAATTAGCCAGG + Intergenic
1121765964 14:96485954-96485976 AAAATACAAAAAAATTAACCGGG - Intronic
1123720716 15:23059446-23059468 AAAATGCAAAAAAATTATCCAGG + Intergenic
1123950311 15:25265803-25265825 AAATTACAAAAAAATTAGCCAGG - Intergenic
1124022245 15:25935388-25935410 AAAATACAAAAAAATTAACCAGG + Intergenic
1124111363 15:26792036-26792058 AAAATACAAAAAAATTAACCGGG + Intronic
1124337284 15:28866858-28866880 AAATTTCAGAAAACTTAGCCCGG + Intergenic
1124341464 15:28892233-28892255 AAAATCCAAAAAAATTAACCAGG - Intronic
1124382790 15:29181108-29181130 AAATTAAAAAAGACATAACTAGG + Intronic
1124425798 15:29561525-29561547 AAAATACAAAAGAATTAGCCAGG + Intronic
1124463831 15:29918575-29918597 AAATTACAAAAAAATTAGCCAGG + Intronic
1124517354 15:30377733-30377755 AAAATACAAAAAAATTAACCAGG - Intronic
1124725590 15:32153259-32153281 AAAATACAAAAAAATTAACCAGG + Intronic
1124937149 15:34184143-34184165 AAAATACAAAAGAATTAGCCAGG + Intronic
1125643043 15:41247509-41247531 AAAATACAAAAAAATTAACCAGG + Intronic
1125668205 15:41449389-41449411 AAAATGCAAAAAAATTAGCCGGG - Intronic
1125952717 15:43767189-43767211 AAAATGCAAAAAAATTAGCCAGG + Intronic
1125954326 15:43778739-43778761 AAACTACAAAAAAATTAACCAGG + Intronic
1126059154 15:44762124-44762146 AAAATGCAAAAAAATTAGCCGGG - Intronic
1126458646 15:48892013-48892035 AAAATACAAAAAAATTAACCGGG - Intronic
1126565640 15:50096114-50096136 AAAGTGCAGAAGACTGAGCCAGG + Intronic
1126605534 15:50472434-50472456 AAATTACAAAAAAATTAGCCGGG + Intronic
1126611120 15:50530421-50530443 AAAATGCAAAAAAATTAGCCGGG + Intronic
1126622930 15:50658163-50658185 AAAATGCAAAAAAATTAGCCGGG - Intronic
1127019597 15:54731509-54731531 AAATTGCAAAATAATTAGCTGGG - Intergenic
1127428156 15:58876139-58876161 AAATTACAAAAAAATTAGCCGGG - Intronic
1127433745 15:58936372-58936394 AAAATGCAAAAAAATTAGCCAGG - Intronic
1127753893 15:62071400-62071422 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1127948390 15:63779380-63779402 AAAAAGCAAAAGAATTAGCCAGG + Intronic
1128193468 15:65727290-65727312 AAAATACAAAAAAATTAACCAGG + Intronic
1128462106 15:67878177-67878199 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1128858311 15:71040657-71040679 AAAATGCAAAAAAATTAGCCGGG + Intronic
1129203105 15:74017486-74017508 AAAATACAAAAGAATTAGCCAGG + Intronic
1129353542 15:74972024-74972046 AAAATACAAAAAAATTAACCAGG - Intronic
1129423245 15:75446932-75446954 AAAATACAAAAGAGTTAGCCGGG - Intronic
1129435589 15:75537592-75537614 AAAATGCAAAAAACTTAGCTGGG + Intronic
1129776586 15:78241021-78241043 AAATTTCAAAATACTGCACCTGG + Intronic
1130071517 15:80650415-80650437 AAAATACAAAAGAATTAGCCAGG + Intergenic
1130156817 15:81357600-81357622 AAAATGCAAAAGACGCAATCTGG - Intronic
1130233008 15:82110898-82110920 AAATTACAAAAAAATTAGCCGGG + Intergenic
1130313403 15:82773825-82773847 ATATTGCAAAAGAATTTATCAGG + Intronic
1130533635 15:84767153-84767175 AAAATACAAAAAAATTAACCGGG - Intronic
1130731296 15:86495036-86495058 AAATTGCAACATCCTGAACCTGG + Intronic
1131128724 15:89879764-89879786 AAAATGCAAAAAAATTAGCCAGG - Intronic
1131722345 15:95183992-95184014 AAAATACAAAAGAATTAGCCGGG - Intergenic
1131763623 15:95651510-95651532 AAAATACAAAAAAATTAACCAGG + Intergenic
1132020451 15:98357052-98357074 AATAGGCAAAAGACTTAAACAGG + Intergenic
1132037164 15:98494045-98494067 CAATGGCAACTGACTTAACCAGG + Intronic
1132089493 15:98936289-98936311 AAATTGCATAGGACTTTAGCAGG - Intronic
1132423086 15:101691097-101691119 AAAATGCAAAAAAATTAGCCAGG - Intronic
1132477223 16:146306-146328 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1132652984 16:1029889-1029911 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1132673365 16:1111557-1111579 AAAATACAAAAGAATTAGCCAGG - Intergenic
1132750807 16:1456678-1456700 AAAATACAAAAAACTTAGCCAGG + Intronic
1132818143 16:1845357-1845379 AAAATACAAAAAAATTAACCAGG + Intronic
1132894340 16:2221002-2221024 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1132895519 16:2227530-2227552 AAAATGCAAAAAACTTAGCCAGG - Intronic
1133713852 16:8428110-8428132 AAATTACAAAAAAATTAGCCAGG + Intergenic
1133972081 16:10575412-10575434 AAATTACAAAAAAATTAGCCCGG - Intronic
1134085229 16:11352377-11352399 AAAATACAAAAAAATTAACCAGG - Intergenic
1134088666 16:11376890-11376912 AAATAGGAATAAACTTAACCAGG - Intronic
1134107030 16:11492622-11492644 AAATTACAAAAAAATTAGCCGGG + Intronic
1134198987 16:12182042-12182064 AAAATACAAAAAAATTAACCAGG - Intronic
1134300035 16:12982670-12982692 ATCTTGCAAAAAACTAAACCTGG - Intronic
1134354888 16:13472550-13472572 AAAATACAAAAAAATTAACCGGG - Intergenic
1134479077 16:14602089-14602111 AAAGTGCAAAAAAATTAGCCGGG - Intronic
1134514861 16:14878831-14878853 AAATTGCAGAACACGTTACCAGG - Exonic
1134558285 16:15185160-15185182 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1134702538 16:16277480-16277502 AAATTGCAGAACACGTTACCAGG - Exonic
1134918817 16:18096763-18096785 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1134924946 16:18151184-18151206 AAATTACAAAAAAATTAGCCCGG - Intergenic
1134965005 16:18434635-18434657 AAATTGCAGAACACGTTACCAGG + Exonic
1134969292 16:18517170-18517192 AAATTGCAGAACACGTTACCAGG + Intronic
1135072520 16:19364519-19364541 AAATTGTAAAACACTTGACTGGG + Intergenic
1135568673 16:23531419-23531441 AAAATACAAAAAACTTAGCCGGG - Intronic
1135787961 16:25367332-25367354 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1135850128 16:25955973-25955995 AAAATACAAAACACTTAGCCAGG - Intronic
1136488572 16:30589507-30589529 AAAATACAAAAAACTTAGCCAGG - Intergenic
1136543678 16:30943348-30943370 AAATTACAAAAAAATTAGCCAGG - Intronic
1136593329 16:31231182-31231204 AAAATACAAAAAAATTAACCAGG - Intergenic
1136858454 16:33680110-33680132 AAACTACAAAAAAATTAACCGGG + Intergenic
1136868764 16:33781688-33781710 AGACTGCAAAACATTTAACCTGG - Intergenic
1137782336 16:51108287-51108309 AAATTTCAAAAAAATTAGCCGGG - Intergenic
1138062135 16:53902947-53902969 AAAATGCAAAAGACTTAGCCAGG + Intronic
1138213410 16:55181775-55181797 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1138430892 16:56968344-56968366 AAAATACAAAAAAATTAACCGGG - Intronic
1138435472 16:56997028-56997050 AAAATGCAAAAAAATTAGCCTGG - Intronic
1138620795 16:58209659-58209681 AAAATACAAAAAAATTAACCAGG - Intergenic
1138742447 16:59326534-59326556 AAAATACAAAAGAATTAGCCCGG - Intergenic
1138815082 16:60194482-60194504 AAAATACAAAAAAATTAACCAGG + Intergenic
1138862696 16:60777184-60777206 AAAATACAAAAGAATTAGCCGGG + Intergenic
1138903269 16:61300173-61300195 AAAATACAAAAAAATTAACCAGG - Intergenic
1138977147 16:62221280-62221302 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1139010300 16:62623482-62623504 AAAAAGCAAAAAACTTAGCCAGG + Intergenic
1139055792 16:63181687-63181709 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1139310828 16:66026641-66026663 AAAATACAAAAGAATTAGCCAGG + Intergenic
1139555506 16:67706896-67706918 AAAATGCAAAAAAATTAGCCAGG + Intronic
1139679697 16:68551917-68551939 AAATTTAAAAAAAATTAACCGGG - Intronic
1139773462 16:69297751-69297773 AAAATGCAAAAAAATTAGCCGGG + Intronic
1139852279 16:69958583-69958605 AAAATACAAAAAAATTAACCGGG + Intronic
1139881250 16:70181487-70181509 AAAATACAAAAAAATTAACCGGG + Intronic
1140107815 16:71976901-71976923 AAAATGCAAAAAAATTAGCCAGG - Intronic
1140152350 16:72381707-72381729 AAAATACAAAAGAATTAGCCGGG - Intergenic
1140371257 16:74414031-74414053 AAAATACAAAAAAATTAACCGGG - Intronic
1140716044 16:77726634-77726656 AAAATACAAAAGAATTAGCCAGG + Intronic
1140929437 16:79613540-79613562 AAAATACAAAAAAATTAACCGGG + Intergenic
1141492362 16:84382733-84382755 AAAATGCAAAACATTTAGCCAGG + Intronic
1141578116 16:84978189-84978211 AAAATGCAAAACAGTTAGCCGGG - Intronic
1141796009 16:86274750-86274772 AAATTGAAAAAGAAATAACTTGG - Intergenic
1142075018 16:88112936-88112958 AAAATGCAAAAAAATTAGCCAGG - Intronic
1142300542 16:89255385-89255407 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1142321739 16:89387510-89387532 AAAATACAAAAAAATTAACCAGG + Intronic
1142357181 16:89606854-89606876 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1203103412 16_KI270728v1_random:1334380-1334402 AGACTGCAAAACATTTAACCTGG + Intergenic
1203120019 16_KI270728v1_random:1528580-1528602 AAACTACAAAAAAATTAACCGGG + Intergenic
1142661233 17:1430905-1430927 AAAATACAAAAAAATTAACCGGG + Intronic
1142754468 17:2007783-2007805 AAAATACAAAAGAATTAGCCAGG + Intronic
1142886258 17:2914029-2914051 AAAATACAAAAAACTTAGCCGGG - Intronic
1142913578 17:3115456-3115478 AAAATACAAAAAACTTAGCCGGG - Intergenic
1143063751 17:4225919-4225941 AAAATGCAAAAAAATTAGCCAGG - Intronic
1143122674 17:4618611-4618633 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1143193264 17:5056065-5056087 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1143359746 17:6359242-6359264 AAAATACAAAAGAATTAGCCAGG + Intergenic
1143493720 17:7298614-7298636 AAAATACAAAAGAATTAGCCAGG - Intergenic
1144045331 17:11450043-11450065 AAAATACAAAAAAATTAACCAGG - Intronic
1144085245 17:11802469-11802491 AAATACCAAAAAACTTAGCCAGG + Intronic
1144138423 17:12321618-12321640 AAAATACAAAAGAATTAGCCGGG - Intergenic
1144522684 17:15964446-15964468 AAAATACAAAAAAATTAACCAGG + Intronic
1144579773 17:16451903-16451925 AAAATGCAAAAAAATTAGCCGGG - Intronic
1144601544 17:16619513-16619535 AAATGGCAAAAGTCTTGAACAGG + Intergenic
1144716025 17:17436518-17436540 AAAATACAAAAAACTTAACTGGG - Intergenic
1144805397 17:17962798-17962820 AAATTGCAAAAAATTTAGCTGGG + Intronic
1145084621 17:19926960-19926982 AAAATGCAAAAAAATTAGCCAGG + Intronic
1146060765 17:29605625-29605647 AAAATACAAAAGAATTAGCCGGG - Intronic
1146189604 17:30753251-30753273 AAAATGCAAAAGAATTAGCTAGG - Intergenic
1146327858 17:31902257-31902279 AAAATGCAAAAAAATTAACTGGG + Intergenic
1146771572 17:35573026-35573048 AAATTTAAAAAGAATTAGCCAGG + Intergenic
1146995683 17:37318651-37318673 AACATGCAAAAGACTTAAAGAGG + Intronic
1147110958 17:38261117-38261139 AAAATACAAAAAAATTAACCGGG - Intergenic
1147204723 17:38828673-38828695 AAAATACAAAAAAATTAACCGGG - Intergenic
1147307321 17:39573192-39573214 AAAGTCCAAAAAAATTAACCGGG + Intergenic
1147679806 17:42234699-42234721 AAATTACAAAACAATTAGCCAGG + Intronic
1147731099 17:42602781-42602803 AAAATACAAAACAATTAACCAGG + Intronic
1147779740 17:42932617-42932639 AAAATACAAAAAAATTAACCAGG + Intergenic
1147866072 17:43553318-43553340 AAAATACAAAAAACTTAGCCGGG - Intronic
1148066126 17:44871497-44871519 AAAATGCAAAAAAATTAGCCAGG - Intronic
1148082125 17:44972800-44972822 AAAATACAAAAAACTTAGCCAGG - Intergenic
1148650131 17:49244519-49244541 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1148937403 17:51174607-51174629 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1149314782 17:55428718-55428740 AAAATACAAAAAAATTAACCAGG + Intergenic
1149760791 17:59228009-59228031 AAAATACAAAAGAATTAGCCTGG + Intronic
1150048629 17:61937339-61937361 AAATTACAAAAAAATTAGCCAGG - Intergenic
1150351441 17:64448040-64448062 AAAATACAAAAAACTTAACTGGG - Intergenic
1150504222 17:65681832-65681854 AAATTGCAAAAATATTAGCCAGG - Intronic
1150558154 17:66272257-66272279 AAAATACAAAAAAATTAACCAGG + Intergenic
1150689369 17:67351229-67351251 AAAATACAAAAAAATTAACCAGG + Intronic
1150839053 17:68591257-68591279 AAAATACAAAAAAATTAACCGGG - Intronic
1150889440 17:69130154-69130176 AAAATGCAAAAAAATTAGCCAGG + Intronic
1150910993 17:69387299-69387321 AAAATACAAAAAAATTAACCAGG + Intergenic
1151093252 17:71466572-71466594 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1151140076 17:71983141-71983163 AAAATCCAAAAAAATTAACCAGG - Intergenic
1151181232 17:72330189-72330211 AAATTACAAAAAAATTAGCCTGG + Intergenic
1151470701 17:74315949-74315971 AAAATACAAAAAACTTAGCCAGG + Intergenic
1152033197 17:77856290-77856312 AAAATACAAAAAACTTAGCCAGG + Intergenic
1152160110 17:78663304-78663326 AAAATGAAAAAGACTTAAAATGG + Intergenic
1152890318 17:82877498-82877520 AAAATACAAAAAACTTAATCGGG - Intronic
1152981890 18:285882-285904 AAATGACAAAAGACATAAACAGG + Intergenic
1153160280 18:2197216-2197238 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1153238325 18:3009597-3009619 AAAATACAAAAGAATTAGCCAGG - Intronic
1153579323 18:6556189-6556211 AAAATACAAAAAACTTAGCCGGG + Intronic
1155136808 18:23003894-23003916 AAAATACAAAAAAATTAACCGGG + Intronic
1155158106 18:23174630-23174652 AAAATGCAAAAAAATTAGCCGGG - Intronic
1155192588 18:23443818-23443840 AAATTACAAAAAAATTAGCCGGG - Intergenic
1155280403 18:24233808-24233830 AAAATACAAAAGACTTTATCCGG - Intronic
1155714974 18:28930736-28930758 AAATTGCAAATGAGTTTATCAGG + Intergenic
1155781279 18:29839079-29839101 AAAATACAAAAAAATTAACCGGG + Intergenic
1155861641 18:30909048-30909070 CATATGCAAAAGACTAAACCTGG + Intergenic
1155991344 18:32282263-32282285 AAATTTAAAAAAACTTAGCCAGG + Intronic
1156021578 18:32605908-32605930 AAACTGAAAAAAACTTAACAAGG + Intergenic
1156236699 18:35212324-35212346 AAAATACAAAAAAATTAACCGGG - Intergenic
1156329855 18:36110697-36110719 AAACTACAAAAAAATTAACCAGG - Intronic
1156570001 18:38242411-38242433 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1157055690 18:44225910-44225932 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1157558724 18:48631303-48631325 AAAATACAAAAAAATTAACCGGG + Intronic
1157627623 18:49063785-49063807 AAAATACAAAAAAGTTAACCAGG - Intronic
1157656028 18:49389655-49389677 AAAATTGAAAAAACTTAACCAGG - Intronic
1157700450 18:49758791-49758813 AAAATACAAAAAACTTAGCCGGG - Intergenic
1157848244 18:51024137-51024159 AAATTACAAAAAAATTAGCCGGG - Intronic
1158173515 18:54626628-54626650 AAATTACAAAAAAATTAGCCAGG - Intergenic
1158244244 18:55412734-55412756 AAATTCCAAAATATTTAGCCAGG - Intronic
1158323092 18:56284827-56284849 AAATTCCAAAAGCCATATCCTGG + Intergenic
1158501528 18:58006610-58006632 AAAATACAAAAAAATTAACCAGG + Intergenic
1158749684 18:60244586-60244608 AAAATACAAAAAACTTAGCCGGG + Intergenic
1158978512 18:62735792-62735814 ATATTGGAATAGACTAAACCAGG + Intronic
1159461482 18:68726600-68726622 ATATTGCAAAAAAATTAGCCAGG - Intronic
1159663718 18:71131177-71131199 AAATTACAAAAAAATTAGCCGGG - Intergenic
1159999449 18:75002642-75002664 AAAATACAAAAAAATTAACCGGG + Intronic
1160769631 19:824667-824689 AAAATACAAAAGAATTACCCGGG - Intergenic
1161119777 19:2518954-2518976 AAATTACAAAAAAATTAGCCAGG - Intronic
1161161916 19:2766591-2766613 AAAATGCAAAAAAATTAGCCAGG - Intronic
1161199586 19:3006941-3006963 AAAATACAAAAAACTTAGCCAGG - Intronic
1161311881 19:3599488-3599510 AAAATGCAAAAAAATTAGCCAGG - Intronic
1161358453 19:3832794-3832816 AAAATGCAAAAAAATTAGCCAGG - Intronic
1161381780 19:3969297-3969319 AAAATGAAAAAAAATTAACCAGG - Intronic
1161430142 19:4226876-4226898 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1161617461 19:5279841-5279863 AAAATGCAAAAAAATTAGCCAGG - Intronic
1161704615 19:5813511-5813533 AAAATACAAAAAAATTAACCAGG + Intergenic
1161706803 19:5825972-5825994 AAATTACAAAAAAATTAGCCGGG + Intronic
1161824404 19:6552463-6552485 AAATTTTAAAAAATTTAACCTGG + Intergenic
1162048014 19:8014224-8014246 AAAATACAAAACAATTAACCAGG - Intronic
1162153367 19:8660796-8660818 AAAATACAAAAAAATTAACCAGG - Intergenic
1162200107 19:9013711-9013733 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1162276259 19:9657705-9657727 AAAATGCAAAAAAATTAGCCAGG - Intronic
1162368527 19:10264509-10264531 AAAATACAAAAGAATTAGCCGGG + Intergenic
1162401096 19:10447057-10447079 AAAATGCAAAAAAATTAGCCAGG - Intronic
1162436530 19:10663364-10663386 AAAATGCAAAAAAATTAGCCAGG - Intronic
1162556903 19:11392682-11392704 AAAATGCAAAAAAATTAGCCGGG - Intronic
1162662313 19:12180024-12180046 AAATTACAAAAAAATTAGCCGGG - Intronic
1162665742 19:12210275-12210297 AAACTGCAAAAAAATTAGCCGGG - Intergenic
1162772828 19:12960081-12960103 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1162890227 19:13727372-13727394 AAATTACAAAAAAATTAGCCGGG + Intergenic
1162920509 19:13899307-13899329 AAAATACAAAAAAATTAACCAGG - Intronic
1163079222 19:14924909-14924931 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1163258092 19:16169958-16169980 AAAATACAAAAGAATTAGCCGGG - Intronic
1163359821 19:16838830-16838852 AAAATGCAAAAAAATTAGCCAGG - Intronic
1163474433 19:17516743-17516765 AAAATACAAAAAAATTAACCAGG - Intronic
1163550366 19:17963171-17963193 AAAATACAAAAAACTTAGCCGGG - Intronic
1163575371 19:18108130-18108152 AAAATACAAAAAAATTAACCAGG + Intronic
1163877506 19:19885549-19885571 AAAATACAAAAAACTTAGCCGGG - Intronic
1163983208 19:20921253-20921275 AAAATACAAAAAAATTAACCGGG + Intergenic
1164073929 19:21795609-21795631 AAAATACAAAAGAATTAGCCAGG + Intergenic
1164077589 19:21834596-21834618 AAAATACAAAAAAATTAACCAGG + Intronic
1164269453 19:23658198-23658220 AAAATGCAAAAAAATTAGCCAGG + Intronic
1164950640 19:32333941-32333963 AAAATACAAAAAAATTAACCGGG + Intergenic
1164993376 19:32700729-32700751 AAATTTTAAAAGACTGAAACTGG - Intronic
1165011835 19:32854171-32854193 AAAGTACAATAGACTTAGCCAGG - Intronic
1165016334 19:32883017-32883039 AAAATACAAAAAAATTAACCAGG - Intronic
1165292367 19:34897455-34897477 AAATTACAAAAAAATTAGCCAGG + Intergenic
1165312430 19:35036913-35036935 AAAATACAAAAGAATTAGCCGGG - Intronic
1165684882 19:37811397-37811419 AAAATACAAAAAAATTAACCGGG - Intronic
1165799711 19:38541553-38541575 AAAATGCAAAAAAATTAGCCGGG + Intronic
1165929968 19:39351140-39351162 AAATTACAAAAAAATTAGCCAGG - Intronic
1166150558 19:40871211-40871233 AAAATACAAAAGAATTAGCCAGG - Intronic
1166327190 19:42058339-42058361 AAAATACAAAAGAATTAGCCGGG - Intronic
1166379546 19:42348758-42348780 AAAATGCAAAAAAATTAGCCAGG - Intronic
1166513634 19:43428979-43429001 AAATTACAAAAAAATTAGCCAGG + Intergenic
1166587741 19:43965885-43965907 AAATTGCAAGTGACCTAACCAGG + Exonic
1166590742 19:43996174-43996196 AAATTGCAAAAGACTTAACCAGG + Exonic
1166594329 19:44031898-44031920 AAATTGCAAGTGACTTAACCAGG + Exonic
1166597841 19:44066145-44066167 AAATTGCAAGTGATTTAACCAGG + Exonic
1166602188 19:44106477-44106499 AAATTGCAAGTGATTTAACCAGG + Exonic
1166604755 19:44130931-44130953 AAATTTCAAGTGACTTAACCAGG + Exonic
1166609298 19:44175579-44175601 AAATTGCAAATGACTTAACCAGG + Exonic
1166692799 19:44833835-44833857 AAAATCCAAAAGAATTAGCCAGG + Intergenic
1166757883 19:45204890-45204912 AAAATACAAAAAAATTAACCAGG - Intronic
1166801388 19:45459725-45459747 AAAATACAAAAAAATTAACCGGG + Intronic
1166839758 19:45689874-45689896 AAAATGCAAACAAATTAACCAGG + Intronic
1167000001 19:46740126-46740148 AAAATACAAAAAACTTAGCCAGG + Intronic
1167121060 19:47517002-47517024 AAAATACAAAAAACTTAGCCCGG + Intergenic
1167121420 19:47519562-47519584 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1167123749 19:47535111-47535133 AAAATACAAAAGAATTAGCCGGG - Intronic
1167450821 19:49567830-49567852 AAAATGCAAAAAAATTAGCCGGG - Intronic
1167664120 19:50813370-50813392 AAATTACAAAAAAATTAGCCAGG - Intergenic
1167835871 19:52069231-52069253 AAACTACAAAAAAATTAACCGGG - Intronic
1167886409 19:52503504-52503526 AAAATACAAAAAACTTAGCCAGG - Intronic
1167918184 19:52759507-52759529 AAAATACAAAAAAATTAACCGGG + Intergenic
1167926547 19:52825825-52825847 AAAATACAAAAAACTTATCCAGG + Intronic
1168130471 19:54315097-54315119 AAAATACAAAAGAATTAGCCAGG + Intergenic
1168173347 19:54605970-54605992 AAAATGCAAAAAAATTAGCCAGG + Intronic
1168237582 19:55073187-55073209 AAAATACAAAACAATTAACCAGG - Intronic
1168251390 19:55144226-55144248 AAAATACAAAAGAATTAGCCAGG - Intronic
1168452810 19:56479017-56479039 AAAATACAAAAAACTTAGCCGGG - Intergenic
1168501466 19:56896835-56896857 AAAATACAAAAGAATTAACTGGG + Intergenic
1168512160 19:56981465-56981487 AAAATGCAAAAAAGTTAACTGGG - Intergenic
1168528622 19:57107506-57107528 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1168601047 19:57718880-57718902 AAAATACAAAAGAATTAGCCGGG + Intronic
1168631025 19:57956190-57956212 AAAATACAAAAGAATTAGCCAGG + Intergenic
1168653942 19:58113153-58113175 AAAATGCAAAAAAATTAGCCAGG + Intronic
1168708258 19:58481952-58481974 AAAATGCAAAAAAATTAGCCGGG - Intronic
1202685245 1_KI270712v1_random:43401-43423 AAAATGCAAAAAAATTAGCCGGG + Intergenic
925193479 2:1904527-1904549 AAAATGCAAAAAAATTAGCCAGG - Intronic
925234360 2:2265174-2265196 AAATTACAAAAAAATTAGCCAGG - Intronic
925255735 2:2485553-2485575 AAATTACAAAAAAATTAGCCGGG - Intergenic
925268871 2:2588016-2588038 AAAATGCAAAATAATTAGCCAGG + Intergenic
925543443 2:4991280-4991302 AAAATACAAAAAAATTAACCAGG - Intergenic
925748495 2:7065706-7065728 AAATAACAAAAGACTTAAAATGG - Intronic
925808599 2:7676245-7676267 AAAATACAAAAAACTTAGCCAGG + Intergenic
926088628 2:10035947-10035969 AACTGGCAAAGCACTTAACCAGG - Intergenic
926277154 2:11412989-11413011 AAAATACAAAAAAATTAACCAGG + Intergenic
926281759 2:11454503-11454525 AAAATGCAAAACAATTAGCCAGG - Intronic
926397502 2:12458999-12459021 AAAATACAAAAGAATTAGCCAGG + Intergenic
926769171 2:16352692-16352714 AAATGGCAAATGAGTTAAACTGG - Intergenic
927230376 2:20818224-20818246 AAGTTGCAAAAAACTTTACAGGG - Intronic
927352277 2:22130499-22130521 AAATAGCAAAAGACCTAAAAGGG + Intergenic
927378461 2:22447956-22447978 AAATGTTAAAAGACATAACCAGG + Intergenic
927525281 2:23734315-23734337 AAAATGCAAAAAAATTAGCCAGG - Intergenic
927631658 2:24779603-24779625 AAAATACAAAAAAATTAACCGGG + Intergenic
927750103 2:25661107-25661129 TAATTGCAAAAGACATAAACAGG - Intronic
927830307 2:26344670-26344692 AAAATGCAAAAAATTTAGCCGGG + Intronic
927968425 2:27287361-27287383 AAATTACAAAAAAATTAGCCAGG - Intronic
927970385 2:27302288-27302310 AAAATACAAAAAACTTAGCCGGG + Intronic
928009698 2:27595483-27595505 AAAATACAAAAGAATTAGCCAGG - Intronic
928056232 2:28057981-28058003 AAAATGCAAAAAAATTAACCGGG + Intronic
928670263 2:33596729-33596751 AAAATACAAAAAAATTAACCAGG + Intronic
928960735 2:36923288-36923310 AAAATGCAAAAAAATTAGCCAGG + Intronic
929104552 2:38351652-38351674 AAAATACAAAAGAATTAGCCAGG - Intronic
929189347 2:39124700-39124722 AAATTCCAAAGTCCTTAACCTGG + Intergenic
929219336 2:39447392-39447414 AAATTTAAAAAAAATTAACCAGG + Intergenic
929258726 2:39841266-39841288 AAAATGCAAAAAAATTAGCCGGG - Intergenic
929570104 2:43017446-43017468 AAAATGCAAAAAAGTTATCCGGG - Intergenic
930004958 2:46889317-46889339 AAAATGCAAAAAAATTAGCCGGG + Intergenic
930101343 2:47605827-47605849 AAAATACAAAAAAATTAACCAGG + Intergenic
930445652 2:51468317-51468339 AAAATGCAAAAAAATTAGCCGGG - Intergenic
930449290 2:51514292-51514314 AAAATGCAAAAAAATTAGCCAGG - Intergenic
930483989 2:51988880-51988902 AAATTACAAAAAAATTAGCCAGG - Intergenic
930538983 2:52680841-52680863 AAAATGCAAAAAAATTAGCCAGG - Intergenic
930578182 2:53177894-53177916 AAAATACAAAAGAATTAGCCAGG + Intergenic
930827801 2:55711874-55711896 AAAATGCAAAAAATTTAGCCAGG - Intergenic
930842079 2:55858457-55858479 AATTTAAAAAAAACTTAACCAGG - Intergenic
930888976 2:56361091-56361113 AAAATGCAAAAACCTTAGCCGGG + Intronic
931266970 2:60669243-60669265 AAAATGCAAAAAAATTAGCCAGG + Intergenic
931267220 2:60671227-60671249 AAATTACAAAAAAATTAGCCGGG - Intergenic
931269061 2:60685955-60685977 AAAATACAAAAGAATTAGCCGGG - Intergenic
931271562 2:60708250-60708272 AAACTACAAAAAAATTAACCAGG + Intergenic
931291292 2:60876243-60876265 AATGTGCAAAAGACTCAAACAGG + Intergenic
931347641 2:61461230-61461252 AAAATGCAAAAGAATTAGCCAGG + Intronic
931417801 2:62097976-62097998 AGAATGCAAAAAACTTAAACGGG - Intronic
931509777 2:62978359-62978381 AAAATGCAAAAGAATTAGCTGGG - Intronic
931727748 2:65127892-65127914 AAAATGCAAAAAAATTAGCCGGG - Intronic
932038178 2:68269846-68269868 AAAATACAAAAAAATTAACCAGG - Intergenic
932044740 2:68336586-68336608 AATTTGCAAAAGACACAAACAGG - Intergenic
932343455 2:70980783-70980805 AAAATACAAAAAAGTTAACCGGG + Intronic
932546825 2:72720590-72720612 AAATTACAAAAAAATTAGCCAGG + Intronic
932739492 2:74280843-74280865 AAAATACAAAAAAATTAACCAGG - Intronic
933191043 2:79334407-79334429 AAGTTGTAAAGGACATAACCTGG + Intronic
933232916 2:79829878-79829900 AAATAGAAAAAAACTTAGCCGGG - Intronic
933493030 2:83012517-83012539 AAAATACAAAAAAATTAACCAGG + Intergenic
933664916 2:84957188-84957210 AAAATACAAAAAAATTAACCTGG - Intergenic
933666053 2:84966019-84966041 AAAATGCAAAAAACTTAGCCAGG + Intergenic
933680531 2:85095845-85095867 AAAATGCAAAAAAATTAGCCAGG - Intergenic
934067912 2:88356332-88356354 AAAATACAAAAAAATTAACCGGG + Intergenic
934638639 2:96012592-96012614 AAAATGCAAAAAAATTAGCCAGG - Intergenic
934795011 2:97092810-97092832 AAAATGCAAAAAAATTAGCCAGG + Intronic
935083045 2:99817272-99817294 AAATTGCTAAAGGCTGAACATGG - Intronic
935246333 2:101221655-101221677 AAATTACAAAAAAATTAGCCGGG - Intronic
935468296 2:103425856-103425878 AAATTACAAAAAAATTAGCCGGG + Intergenic
935548360 2:104424814-104424836 AAAATACAAAAAACTTAGCCAGG - Intergenic
935643474 2:105312391-105312413 AAATTTCAAAATACATACCCAGG + Intronic
935686485 2:105688302-105688324 AAAATGCAAAAAAATTAACCGGG - Intergenic
935703314 2:105833253-105833275 AAAGTACAAAAGAATTAGCCAGG - Intronic
935932424 2:108142281-108142303 AAAATTCAAAAAACTTAGCCAGG + Intergenic
935961334 2:108428560-108428582 AAATTGTACAAGATTTGACCAGG - Intergenic
936395929 2:112129911-112129933 AAATTACAAAAAAATTAGCCGGG + Intergenic
936753236 2:115672905-115672927 AAAATACAAAAAACTTAGCCAGG - Intronic
937215183 2:120308213-120308235 AAAATGCAAAAAAATTAGCCAGG + Intergenic
937306719 2:120876179-120876201 AAAATACAAAAAACTTAGCCGGG + Intronic
937396545 2:121541414-121541436 AAAGACCAAAAGACTTATCCAGG + Intronic
937397463 2:121549843-121549865 AAAATGCAAAAAAATTAGCCAGG + Intronic
938012104 2:127837120-127837142 AAAATGCAAAAAAATTAGCCAGG + Intergenic
938174373 2:129110877-129110899 AAAATGCAAAAAAATTAGCCGGG + Intergenic
938284215 2:130095186-130095208 AAAATACAAAAAAATTAACCGGG - Intronic
938334857 2:130483753-130483775 AAAATACAAAAAAATTAACCGGG - Intronic
938354964 2:130636916-130636938 AAAATACAAAAAAATTAACCGGG + Intronic
938394179 2:130930051-130930073 AAAATACAAAAAACTTAGCCAGG - Intronic
938431392 2:131243705-131243727 AAAATACAAAAAAATTAACCGGG + Intronic
938922907 2:136011606-136011628 AAATTGATAAAGACTTAAAATGG + Intergenic
939468988 2:142595462-142595484 AAAATACAAAAGAATTAGCCGGG + Intergenic
939798851 2:146681704-146681726 AATTTGAAAAACACTAAACCAGG + Intergenic
939843748 2:147219760-147219782 AAATTACAAAAAAATTAGCCAGG + Intergenic
939952745 2:148494800-148494822 AAAATACAAAAGAATTAGCCGGG + Intronic
940707333 2:157122073-157122095 AAATTTCAAAATAATTATCCTGG + Intergenic
941555537 2:166975763-166975785 AAAATGCAAAAAAATTAGCCGGG + Intronic
941595066 2:167466457-167466479 AAAATACAAAAAACTTAGCCAGG + Intergenic
941773333 2:169365145-169365167 AAATTGCAACTGAATTAACCTGG - Intergenic
941785654 2:169495814-169495836 AAATTACAAAAAAATTAGCCAGG - Intronic
941818870 2:169825498-169825520 AAATTACAAAAAAATTAGCCGGG + Intergenic
941946801 2:171107897-171107919 AAAATACAAAAAACTTAGCCAGG + Intronic
942027906 2:171928667-171928689 AAAATACAAAAGAATTAGCCAGG - Intronic
942337185 2:174901173-174901195 AAAGAGCAAAATTCTTAACCGGG + Intronic
942560978 2:177218220-177218242 AAAATGCAAAAAAATTAACCGGG - Intronic
942762505 2:179416162-179416184 AAAATACAAAAGAATTAGCCAGG + Intergenic
942907392 2:181200274-181200296 AAAATGCAAAAAAATTAGCCAGG + Intergenic
942980715 2:182078018-182078040 AAAATGCAAAAAAATTAGCCGGG + Intronic
942993966 2:182238106-182238128 AAAATGCAAAAAAATTAGCCAGG + Intronic
943280412 2:185924979-185925001 AGATTACAAAAGACTTAAAATGG + Intergenic
943893503 2:193322179-193322201 AAAGTACAAAAAAATTAACCAGG - Intergenic
944234689 2:197431276-197431298 AAAGTACAAAAAAATTAACCGGG - Intronic
944288291 2:197976355-197976377 AAACTGCTAAACACTTTACCTGG + Intronic
944314511 2:198270448-198270470 AAAATACAAAAAAATTAACCAGG - Intronic
944601355 2:201306863-201306885 AAATGGGAAAAGACTTGAACAGG + Intronic
944766877 2:202872685-202872707 AAAATACAAAAAACTTAGCCAGG - Intergenic
945086065 2:206133817-206133839 AAAATACAAAAAAATTAACCAGG + Intronic
945215173 2:207425731-207425753 AATGGGCAAAAGACTTAAGCAGG - Intergenic
945237229 2:207642505-207642527 AAAATACAAAAAAATTAACCAGG + Intergenic
945398208 2:209347680-209347702 AAAATACAAAAAAATTAACCGGG - Intergenic
945905992 2:215593972-215593994 AAAATACAAAAAAATTAACCAGG + Intergenic
946283711 2:218686097-218686119 AAAATACAAAAAAATTAACCGGG - Intronic
946380109 2:219342022-219342044 AAAATGCAAAAAAATTAGCCGGG + Intergenic
946745117 2:222837745-222837767 AAATTGCAGAAGACTAAGACTGG - Intergenic
946766544 2:223045999-223046021 AAAATGCAAAAAAATTAGCCAGG - Intergenic
946965216 2:225029983-225030005 AAAATACAAAAAAATTAACCAGG + Intronic
947454327 2:230239605-230239627 AAAATACAAAAGAATTAACCGGG - Intronic
947644938 2:231731685-231731707 AAATTACAAAAAAATTAGCCAGG + Intergenic
947675485 2:231975542-231975564 AAAATGCAAAAAAGTTAGCCAGG + Intronic
947686252 2:232088238-232088260 AAAATGCAAAAAAATTAGCCAGG + Intronic
947963447 2:234259260-234259282 AAAATACAAAAAAATTAACCAGG + Intergenic
948142292 2:235682501-235682523 AAATTAAAAAAAAATTAACCAGG - Intronic
948448089 2:238049271-238049293 AAAATACAAAAAAATTAACCGGG + Intronic
948503672 2:238412959-238412981 AAAATACAAAAAAATTAACCAGG - Intergenic
948538788 2:238669946-238669968 AATTTGAAAAAGACTTATTCAGG + Intergenic
1168973365 20:1946092-1946114 AAATTTAAAAAAAATTAACCAGG - Intergenic
1169030938 20:2406330-2406352 AAAATACAAAAGAATTAGCCAGG + Intronic
1169228210 20:3869331-3869353 AAAGTGCAAAAAAATTAGCCAGG - Exonic
1169449445 20:5699084-5699106 AAAATACAAAAAAATTAACCAGG + Intergenic
1169733019 20:8806951-8806973 AAATTATGAAAGACTTAAGCAGG + Intronic
1170169107 20:13391805-13391827 AAAATGCAAAAAAATTAGCCAGG + Intronic
1170576028 20:17662100-17662122 AAAATACAAAAAACTTAGCCAGG + Intronic
1171195923 20:23199324-23199346 AATCTGTAAAAGACTTACCCAGG + Intergenic
1171479788 20:25445505-25445527 AAAATGCAAAAAAATTAGCCAGG - Intronic
1171979735 20:31619152-31619174 AAAATACAAAAAACTTAGCCGGG + Intergenic
1171980318 20:31623516-31623538 AAAATACAAAAAAATTAACCGGG - Intergenic
1172014926 20:31867803-31867825 AAAATGCAAAAAAATTAGCCGGG - Intronic
1172351285 20:34243902-34243924 AAAATACAAAAAAATTAACCGGG + Intronic
1172981557 20:38946047-38946069 AAAATACAAAACAATTAACCAGG + Intronic
1173208142 20:41010934-41010956 AAAATACAAAAGAGTTAGCCAGG - Intergenic
1173621753 20:44442165-44442187 AAATATAAAAAAACTTAACCAGG + Intergenic
1174003048 20:47388745-47388767 AAAATACAAAAAAATTAACCGGG + Intergenic
1174043997 20:47720414-47720436 AAAATACAAAAGAATTAGCCGGG - Intronic
1174260787 20:49293426-49293448 AAATTACAAAAGTATTAACTTGG - Intergenic
1174319748 20:49731992-49732014 AAAATGCAAAAAAATTACCCGGG + Intergenic
1174384178 20:50176928-50176950 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1174791575 20:53483255-53483277 AAAATACAAAAGAATAAACCAGG + Intronic
1174828394 20:53790408-53790430 AAAATACAAAAAAATTAACCAGG - Intergenic
1174923074 20:54725879-54725901 AAATTCTAAAAGAGTTAAACAGG + Intergenic
1175347559 20:58291992-58292014 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1176134629 20:63516752-63516774 AAATTACAAAAAAATTAGCCGGG - Intergenic
1176518258 21:7803258-7803280 AAAATACAAAAAAATTAACCAGG + Intergenic
1176701958 21:10064338-10064360 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1177329767 21:19642880-19642902 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1177350832 21:19939134-19939156 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1177513458 21:22119889-22119911 AAATTTCCAAAAACTTCACCTGG + Intergenic
1177559062 21:22727434-22727456 AAAATACAAAAAACTTAGCCGGG + Intergenic
1177612444 21:23469179-23469201 AAAATACAAAAAACTTAGCCAGG + Intergenic
1177628192 21:23691884-23691906 AAAATACAAAAGAATTAGCCAGG + Intergenic
1177788808 21:25699560-25699582 AAAATACAAAAGACTTAGCCGGG + Intronic
1177864200 21:26493389-26493411 AGATGGTAAAAGACTTAACTTGG + Intronic
1178084999 21:29103572-29103594 AAAGTACAAAAGAATTAGCCAGG + Intronic
1178278359 21:31259294-31259316 AAATTTCAAAAAAATTAGCCAGG - Intronic
1178328253 21:31662852-31662874 AAAATGCAAAAAAATTAGCCGGG + Intronic
1178382971 21:32126790-32126812 AAAATACAAAAGAATTAGCCAGG + Intergenic
1178563970 21:33666087-33666109 AAAATGCAAAAGAATTAGCTGGG - Intronic
1178620469 21:34169670-34169692 AAAATACAAAAAAATTAACCAGG - Intergenic
1178652286 21:34433271-34433293 AAAATACAAAAAAATTAACCAGG + Intergenic
1178964791 21:37106224-37106246 AAATAGCAAAAGACTTCAACAGG - Intronic
1179556966 21:42185245-42185267 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1180250937 21:46587675-46587697 AAAATACAAAAAAATTAACCAGG + Intergenic
1180315694 22:11276092-11276114 AAAATACAAAAAAATTAACCAGG - Intergenic
1180903312 22:19390432-19390454 AAATTACAAAAAAATTAACCGGG + Intronic
1181077472 22:20391076-20391098 AAATTACAAAAAAATTAGCCGGG + Intergenic
1181258508 22:21580608-21580630 AAAATACAAAAAACTTAGCCAGG - Intronic
1181602333 22:23960022-23960044 AAATGGAAAAAAAATTAACCGGG - Intronic
1181825106 22:25508700-25508722 AAAATACAAAAAAATTAACCTGG - Intergenic
1181850545 22:25746959-25746981 AAAATGCAAAAAAATTAGCCAGG + Intronic
1182055090 22:27346479-27346501 AAAATACAAAAAAATTAACCGGG - Intergenic
1182168616 22:28203515-28203537 AAATTCACAAAGACTTGACCTGG - Intronic
1182314775 22:29438341-29438363 AAAATACAAAAGAATTAGCCAGG - Intergenic
1182485869 22:30638339-30638361 AAAATACAAAAAAATTAACCGGG + Intronic
1182695177 22:32193700-32193722 AAAATACAAAAGAATTAGCCAGG + Intronic
1182716177 22:32357625-32357647 AAAATACAAAAGAATTAGCCAGG - Intronic
1182745833 22:32604843-32604865 AAAATGCAAAAAAATTAGCCGGG + Intronic
1182939840 22:34265042-34265064 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1183630774 22:39031407-39031429 AAATTACAAAAAAATTAGCCGGG + Intronic
1183652137 22:39162914-39162936 AAAATACAAAAAAATTAACCAGG - Intergenic
1183657388 22:39195591-39195613 AAATTACAAAAGAATTAGTCAGG + Intergenic
1183724262 22:39579805-39579827 AAAATACAAAAAACTTAGCCAGG - Intronic
1183765226 22:39867061-39867083 AAAATGCAAAAAAATTAGCCGGG - Intronic
1183848881 22:40566378-40566400 AAAATGCAAAAAAATTAGCCAGG - Intronic
1183939268 22:41283940-41283962 AAATTGCATAAAAATTAACCAGG + Intronic
1183999113 22:41659368-41659390 AAAATACAAAAAAATTAACCGGG - Intronic
1184146080 22:42611714-42611736 AAAATACAAAAAAATTAACCAGG + Intronic
1184179394 22:42809841-42809863 AAAATACAAAAGAATTAGCCAGG + Intronic
1184360291 22:44013055-44013077 AAACTACAAAAAAATTAACCGGG - Intronic
1184612932 22:45617000-45617022 AATGGGCAAAAGACTTAAACAGG - Intergenic
1184761344 22:46546532-46546554 AAAATGCAAAAAAATTAGCCGGG - Intergenic
949113219 3:287924-287946 AAAATACAAAAAACTTAGCCTGG - Intronic
949134876 3:552507-552529 AAATTTCCAAATACTTAATCTGG + Intergenic
949281176 3:2349056-2349078 AAATTTTAAAAGACTTCAGCTGG - Intronic
949508827 3:4751040-4751062 AACTAGCAACAGACTTCACCTGG - Intronic
949625117 3:5857032-5857054 AAATTAAAAAAGACTAAAGCTGG - Intergenic
949725899 3:7043972-7043994 AAAATGCAAAAGCTTGAACCAGG - Intronic
949964713 3:9345623-9345645 AAAATGCAAAAAAATTAGCCGGG + Intronic
950292122 3:11793343-11793365 AAAATGAAAAAGACCTAAACAGG + Intronic
950325060 3:12099802-12099824 AAAATACAAAAAACTTAGCCGGG + Intronic
950705563 3:14777833-14777855 AAAATACAAAAAACTTAGCCAGG + Intergenic
950783410 3:15411921-15411943 AAAATACAAAAAAATTAACCAGG - Intronic
950833732 3:15900093-15900115 AAAATACAAAAGAATTAGCCAGG - Intergenic
950992489 3:17454618-17454640 AAAATACAAAAAAATTAACCAGG - Intronic
950992555 3:17455677-17455699 AAATTACAAAAAAATTAACCAGG + Intronic
951051209 3:18096339-18096361 AAAATACAAAAAAATTAACCGGG - Intronic
951114743 3:18846400-18846422 AAAATACAAAAAAATTAACCAGG + Intergenic
951140569 3:19153790-19153812 AAAATGCAAAAAAATTAGCCAGG - Intronic
951436537 3:22671315-22671337 AAATTGCTCAAGCCTTAACTTGG + Intergenic
951689697 3:25382695-25382717 AAAATACAAAAGAATTAGCCGGG + Intronic
951726822 3:25769198-25769220 AAAATACAAAAGAATTAGCCGGG + Intronic
951806771 3:26653183-26653205 AAAATTCAAAAGACTTAAGTGGG + Intronic
952034017 3:29178010-29178032 AAAATGCAAAAAAATTAGCCAGG - Intergenic
952373671 3:32747255-32747277 AAAATGCAAAAAAATTAAGCGGG + Intronic
952450927 3:33432161-33432183 AAATAGCAAAAAAATTAGCCAGG + Intronic
952452548 3:33445749-33445771 AAAATACAAAAAAATTAACCAGG - Intergenic
953761782 3:45693932-45693954 AAATTGCAAAATAATTAGACTGG + Intronic
954052319 3:47990450-47990472 AAAATGCAAAAAACTTAGCCAGG + Intronic
954203373 3:49039054-49039076 AAATATTAAAAGACATAACCGGG + Intronic
954735096 3:52700902-52700924 AAACTGCAAAAAAATTAGCCAGG + Intronic
954741532 3:52754911-52754933 AAAATGCAAAAAAATTAGCCGGG + Intronic
954964286 3:54596824-54596846 AAAATGGGAAAGAGTTAACCAGG - Intronic
955052001 3:55421623-55421645 AAATAGCAAAAGGCTTTATCAGG + Intergenic
955289326 3:57676217-57676239 AAAATACAAAAAACTTAGCCAGG + Intronic
955327120 3:58017409-58017431 AAAATGCAAAAAAATTATCCAGG - Intronic
956120008 3:65956839-65956861 AAAATGCAAAAAAATTAGCCTGG + Intronic
956150110 3:66232329-66232351 AAATAGCAAAAGACAGGACCAGG - Intronic
956187370 3:66575440-66575462 AAATTACAAAAAAATTAGCCGGG + Intergenic
956760188 3:72435509-72435531 AAATTGAAAATGACTTAAATAGG - Intronic
957241573 3:77667170-77667192 AAATTGCAAAAGATCAAACAAGG - Intergenic
957246352 3:77721679-77721701 AAAATGCAAAAAAATTAGCCAGG - Intergenic
957462424 3:80538630-80538652 AAAATACAAAAAAATTAACCAGG + Intergenic
957514237 3:81230576-81230598 AAATTACAAAAAAATTAGCCGGG - Intergenic
957798647 3:85045263-85045285 AAATTGTGATAGACCTAACCTGG + Intronic
957846106 3:85737716-85737738 AAAATACAAAAAACTTAGCCAGG - Intronic
958139351 3:89541141-89541163 AAAATGCAAAAAAATTAGCCGGG - Intergenic
958147972 3:89651634-89651656 AAAATGCCAAAGACTAAAACTGG - Intergenic
958554139 3:95652129-95652151 AAAATGTAAAAGTCTAAACCTGG - Intergenic
958568962 3:95855200-95855222 AAAATACAAAAAAATTAACCAGG + Intergenic
958647622 3:96892379-96892401 AAAGTACAAAAAAATTAACCAGG - Intronic
958689853 3:97450212-97450234 AAAGTGAAAAAGACATAACAGGG - Intronic
958801976 3:98766579-98766601 AAAATGCAAAAAAATTAGCCGGG - Intronic
959404208 3:105940632-105940654 AAATTACAAAAGAATTAGCCGGG - Intergenic
959573915 3:107913395-107913417 AAAATACAAAAAAATTAACCGGG - Intergenic
959676480 3:109041550-109041572 AAAATGCAAAAAAATTAGCCCGG + Intronic
959702254 3:109309527-109309549 AAAATACAAAAAACTTAGCCGGG + Intronic
959737985 3:109682971-109682993 AAATTGCATCTGACTTAAGCTGG + Intergenic
960028670 3:113036092-113036114 AAAATGCAAAAAAATTAGCCAGG + Intergenic
960093483 3:113665665-113665687 AAATTACAAAAAAATTAGCCAGG + Intronic
960095110 3:113681877-113681899 AAAATGCAAAAAAATTAGCCAGG - Intronic
960164858 3:114389726-114389748 AAAATGCAAAAAAATTAGCCAGG + Intronic
960176778 3:114526694-114526716 AATTTACAAATGACTTAAGCAGG - Intronic
960867536 3:122217257-122217279 AAACTACAAAAAAATTAACCGGG - Intronic
960871223 3:122251932-122251954 AAATTGCAAAAGAGCAAAACTGG + Intronic
961246637 3:125459595-125459617 AAATTACAAAAAAGTTAGCCAGG - Intronic
961263934 3:125625073-125625095 AAAATACAAAAAAATTAACCAGG + Intergenic
961268155 3:125664660-125664682 AAATTTCAAAAAAATTAGCCAGG - Intergenic
961668054 3:128506226-128506248 TAACTGCAAAAGACATAATCAGG + Intergenic
961687147 3:128641767-128641789 AAAATGCAAAAAAGTTAGCCAGG - Intronic
961692110 3:128677236-128677258 AAATTTCAAAAGCCTTAAGAAGG - Intronic
962516097 3:136153627-136153649 AAAATACAAAAAAATTAACCGGG + Intronic
962726257 3:138230490-138230512 AAAATACAAAAGAATTAGCCAGG + Intronic
963012791 3:140789225-140789247 AAATTACAAAAAAATTAGCCAGG + Intergenic
963616567 3:147546753-147546775 AAAATACAAAAAAATTAACCAGG + Intergenic
963801536 3:149680679-149680701 AAATGAAAAAAGAATTAACCAGG + Intronic
964798278 3:160523688-160523710 AAAATGCAAAAAAATTAGCCAGG + Intronic
965470124 3:169080294-169080316 AAAATGCAAAAAAATTAGCCGGG - Intergenic
965577430 3:170232037-170232059 AAAGTGCAAAATACTTATCATGG - Intronic
965593233 3:170381919-170381941 AAAATGCAAAAAAATTAGCCGGG + Intronic
965705322 3:171500667-171500689 AAAATGCAAAAAAATTAGCCGGG - Intergenic
965980722 3:174686736-174686758 CATTTGCAAAAGACTGAAACTGG + Intronic
966035771 3:175413047-175413069 AAAATACAAAAAAATTAACCGGG - Intronic
966046555 3:175558032-175558054 AAAATACAAAAAACTTAGCCGGG + Intronic
966181123 3:177189492-177189514 AAATTACAAAAAAATTAGCCAGG + Intronic
966202132 3:177368383-177368405 AAATTACAAAAAAATTAACCGGG - Intergenic
966274011 3:178142594-178142616 AAACTACAAAAAAATTAACCAGG + Intergenic
966386668 3:179406771-179406793 AAAATGCAAAAAAATTAGCCAGG - Intronic
966425808 3:179778603-179778625 AAAATGCAAAAAAATTAGCCGGG + Intronic
966513698 3:180793493-180793515 AAAATACAAAAGAATTAGCCAGG + Intronic
966795072 3:183705877-183705899 AAAATGCAAAAAAATTAGCCAGG + Intronic
966809637 3:183832377-183832399 AAAATACAAAAAACTTAGCCGGG - Intronic
966824046 3:183948860-183948882 AAATTACAAAAAAATTAACCAGG - Intronic
966984102 3:185164174-185164196 AAATTACAAAAGAATTAGCCAGG - Intergenic
967165216 3:186773993-186774015 AAATAGCAAAAAAATTAGCCGGG - Intergenic
967230118 3:187329936-187329958 AAAATACAAAAAACTTAGCCAGG - Intergenic
967359312 3:188611507-188611529 CAATTGCAACAGATTTACCCAGG + Intronic
967417504 3:189235131-189235153 AAATTACAAAAACCTTACCCTGG - Intronic
967582166 3:191171957-191171979 AAAATACAAAAGAATTAGCCGGG - Intergenic
967689186 3:192454197-192454219 AAAATACAAAAAAATTAACCAGG - Intronic
967753434 3:193141199-193141221 AAAATGCAAAAAAATTAGCCGGG + Intergenic
967801521 3:193667508-193667530 AAAATACAAAAAACTTAGCCAGG + Intronic
967838667 3:193985880-193985902 AAAATGCAAAAAAATTAGCCGGG - Intergenic
967870106 3:194222766-194222788 AAAATGCAAAAAAATTAGCCGGG - Intergenic
967892754 3:194374850-194374872 AAAATACAAAAAAATTAACCAGG - Intergenic
967900662 3:194448236-194448258 AAATTACAAAAAAATTAGCCGGG - Intronic
968185238 3:196628746-196628768 AAAATGCAAAAGAATTAGCCAGG - Intergenic
968249470 3:197193978-197194000 AAAATACAAAAAAATTAACCAGG - Intronic
968326102 3:197817979-197818001 AAAATACAAAAAAATTAACCAGG - Intronic
968444428 4:642633-642655 AAAATGCAAAAAAGTTAGCCAGG + Intronic
968604714 4:1528894-1528916 AACTAGCAAAAGACTCAAACAGG - Intergenic
968780422 4:2576256-2576278 AAATTACAAAAGAATTAGCCAGG - Intronic
968801966 4:2748949-2748971 AAAATACAAAAAAGTTAACCAGG - Intronic
968836802 4:2970828-2970850 AAAATGCAAAAAAATTAGCCAGG - Intronic
969071575 4:4543685-4543707 AAAATACAAAAGAATTAGCCAGG - Intergenic
969270703 4:6098270-6098292 AAAATACAAAAGAATTAGCCAGG + Intronic
969283998 4:6191097-6191119 ATATTGCAAAAGACTTACACAGG + Intronic
969385367 4:6842744-6842766 AAAATGCAAAAAAATTAGCCAGG - Intronic
969811402 4:9651291-9651313 AAAATACAAAAAAATTAACCGGG - Intergenic
969946542 4:10789028-10789050 AAATTACAAAAAAATTAGCCAGG + Intergenic
969990537 4:11257911-11257933 AAAATACAAAAGAATTAGCCAGG + Intergenic
970276800 4:14409483-14409505 AAAATACAAAAAAATTAACCGGG + Intergenic
970462289 4:16286899-16286921 AAAATGCAAAAAAATTAGCCAGG + Intergenic
970465548 4:16319104-16319126 AAAATGCAAAAAAATTAGCCAGG - Intergenic
970497865 4:16645374-16645396 AAAATGCAAAAAAATTAGCCGGG + Intronic
970887989 4:21008682-21008704 AAAATGCAAAAAAATTAGCCGGG - Intronic
971172523 4:24248283-24248305 AAAATGCAAAACAATTAGCCGGG - Intergenic
971422337 4:26485031-26485053 AAAATGCAAAAAAATTAGCCGGG + Intronic
971842345 4:31869879-31869901 AAAAGACAAAAGCCTTAACCGGG + Intergenic
972061826 4:34883807-34883829 AAAATGCAAAAAAATTAGCCAGG - Intergenic
972096609 4:35354859-35354881 AAAATGCAAAAAATTTAGCCGGG + Intergenic
972291750 4:37696085-37696107 AGATTGCAAAAGTTTTAACCTGG + Intergenic
972344538 4:38182120-38182142 AAAATGCAAAAAAATTAGCCAGG + Intergenic
972409924 4:38783331-38783353 AAAATACAAAAAACTTAGCCAGG - Intergenic
972450897 4:39197263-39197285 AAAATACAAAAAAATTAACCAGG + Intronic
972487170 4:39553219-39553241 AAAATACAAAAAAATTAACCAGG - Intronic
972585168 4:40431104-40431126 CAATTGAAAAAGAATTATCCAGG - Intronic
972910872 4:43814859-43814881 ACATTGCAAAAAAATCAACCAGG - Intergenic
972953467 4:44358727-44358749 AAAATACAAAAAAATTAACCGGG - Intronic
973201239 4:47504721-47504743 AAAATGCAAAAAAATTAGCCAGG - Intronic
973236152 4:47908261-47908283 AAATTCTAAAAAAATTAACCAGG + Intronic
973268600 4:48236440-48236462 AAAATACAAAAAAATTAACCGGG - Intronic
974007289 4:56571471-56571493 AAAATCCAAAACAATTAACCAGG - Intronic
974427781 4:61762105-61762127 AAATGACAAAAGACTTAAAGTGG + Intronic
974885010 4:67807413-67807435 AAAATACAAAAGAATTAGCCAGG + Intergenic
975131580 4:70837794-70837816 AAAATGCAAAAAAATTAGCCGGG - Intronic
975145114 4:70958323-70958345 AAAATGCAAAAAAATTAGCCAGG - Intronic
975159318 4:71107505-71107527 AAAATGCAAAAAAATTAGCCGGG - Intergenic
975347699 4:73312457-73312479 AAATTCAAAAAAAATTAACCGGG + Intergenic
975585539 4:75944622-75944644 AAAATGCAAAAAAATTAGCCAGG - Intronic
975766594 4:77675012-77675034 AAAATACAAAAAACTTAGCCGGG + Intergenic
975901687 4:79161130-79161152 AATTTGCAAAAGAATGAAGCTGG - Intergenic
976169661 4:82290054-82290076 AAAATGCAAAAAAATTAGCCGGG + Intergenic
976409868 4:84700951-84700973 AATTTGAAAAAGAATTAGCCAGG + Intronic
976853863 4:89580237-89580259 AAAATACAAAAAACTTAGCCAGG - Intergenic
976866834 4:89738632-89738654 AAATTACAAAAAAATTAGCCAGG - Intronic
977548995 4:98420524-98420546 AAATTCCAAAACAATTAGCCAGG - Intronic
977578040 4:98695555-98695577 AAAATACAAAAAAATTAACCGGG + Intergenic
977851707 4:101838115-101838137 AAAATCCAAAAGAATTAGCCGGG - Intronic
978288755 4:107111542-107111564 AAAATACAAAAGAATTAGCCGGG - Intronic
978428200 4:108604289-108604311 AAAATACAAAAAAATTAACCAGG - Intergenic
978454334 4:108871474-108871496 AAAATGCAAAAAAATTAGCCGGG - Intronic
978481196 4:109192691-109192713 AAATTACAAAAAAATTAGCCAGG + Intronic
978741035 4:112138227-112138249 AAAATGCAAAAAAATTAGCCGGG - Intergenic
978842504 4:113231210-113231232 AAAATACAAAAAAATTAACCAGG - Intronic
978866584 4:113520245-113520267 AAAATACAAAAAAATTAACCGGG + Intronic
979165778 4:117528500-117528522 AAAATACAAAAAAATTAACCTGG - Intergenic
979484761 4:121257732-121257754 AAAATGCAAAAAAATTAGCCAGG + Intergenic
979628777 4:122877268-122877290 AAAATACAAAAAAATTAACCAGG - Intronic
979683949 4:123490352-123490374 AAAATGCAAAAAAATTAGCCAGG - Intergenic
979859115 4:125671755-125671777 AAATTACAAAAAAATTAGCCGGG - Intergenic
979901928 4:126231539-126231561 AAAATGCACAAGACTAAACTTGG - Intergenic
980033143 4:127853445-127853467 AAAATACAAAAGAATTAGCCAGG - Intergenic
980229751 4:130034032-130034054 AAATTACAAAAAAATTAGCCGGG - Intergenic
980260847 4:130445308-130445330 AAAATGCAAAAAAATTAGCCAGG - Intergenic
980402689 4:132313355-132313377 ATATTACACAAGACTTTACCTGG - Intergenic
980796353 4:137688758-137688780 AAATTGTCAAAGATTTAACAGGG + Intergenic
981116004 4:140992398-140992420 AAATTAAAAAAGAGTTAACCAGG + Intronic
982293931 4:153807362-153807384 TAAATGCAAAGGACTTAAACAGG - Intergenic
982328679 4:154157340-154157362 AAAATACAAAAAACTTAACTAGG - Intergenic
982479483 4:155891787-155891809 AAATTGCAAAAGTATTAATTTGG + Intronic
982898763 4:160970976-160970998 AAAATGCAAAAAAATTAGCCAGG + Intergenic
983213779 4:164983752-164983774 AAAATACAAAAAACTTAGCCAGG + Intergenic
983235008 4:165169605-165169627 AAAATACAAAAGAATTAGCCAGG - Intronic
983237933 4:165200801-165200823 AAAATACAAAAAACTTAGCCAGG - Intronic
983282935 4:165704287-165704309 AAAATACAAAAAAATTAACCGGG - Intergenic
983590355 4:169403407-169403429 AAATTGCAAAAAACTTAGCTAGG + Intronic
983874669 4:172862537-172862559 AAAATACAAAAAACTTAACTGGG + Intronic
984080177 4:175238239-175238261 AAAATACAAAAAACTTAGCCGGG - Intergenic
984146019 4:176062284-176062306 AAATTGTAAAATATTTAAACAGG - Intergenic
984156489 4:176201341-176201363 AAATTGAAAAAAAGTTAACCAGG + Intergenic
984236771 4:177168815-177168837 AAAATGCAAAAAAATTAGCCAGG - Intergenic
984564155 4:181307599-181307621 AAAATACAAAAAACTTAGCCAGG + Intergenic
984701838 4:182823344-182823366 AAATTTCAAAAAAATTAGCCAGG - Intergenic
984861243 4:184241707-184241729 AAAATACAAAAAACTTAGCCAGG - Intergenic
985112903 4:186564262-186564284 AAAATGCAAAAAATTTAGCCGGG - Intergenic
985233032 4:187842246-187842268 AAAATGCAAAAAATTTAGCCAGG + Intergenic
985282585 4:188301685-188301707 AAAATGCAAAAAAATTAGCCGGG - Intergenic
986133216 5:4949719-4949741 AAAATACAAAAAAATTAACCGGG - Intergenic
986187549 5:5459031-5459053 AAAATGCAAAAAAATTAGCCAGG - Intronic
986459547 5:7956470-7956492 AAAATACAAAAAAATTAACCAGG - Intergenic
986551180 5:8957690-8957712 AAAATACAAAAAACTTAGCCAGG - Intergenic
986613324 5:9591574-9591596 AAATGGCAAAAGACTGGAGCAGG + Intergenic
986679237 5:10218387-10218409 AAAATACAAAAAACTTAGCCAGG + Intergenic
986965441 5:13264848-13264870 AAATTAAAAAAAAATTAACCAGG + Intergenic
987065958 5:14289687-14289709 AAAATACAAAAGAATTAGCCTGG + Intronic
987349658 5:17010599-17010621 AAAATACAAAAAAATTAACCGGG - Intergenic
987581318 5:19796413-19796435 AACTTGCAAAATACTGCACCAGG - Intronic
987980088 5:25073076-25073098 AAAATGCAAAAAAATTAGCCGGG + Intergenic
988135683 5:27168342-27168364 ATATTGTAAAAGACCTAACTTGG - Intergenic
988532246 5:32038000-32038022 AAAATGCAAAAAAATTAGCCAGG - Intronic
988630134 5:32920601-32920623 AAAATACAAAATAATTAACCAGG - Intergenic
989023346 5:37037225-37037247 AAAATACAAAAAAATTAACCAGG + Intronic
989182864 5:38595892-38595914 AAAATGCAAAAAAATTAGCCGGG - Intronic
989311963 5:40029928-40029950 AAATTGCAACAGAGTTATTCTGG + Intergenic
989578753 5:43012556-43012578 AAAATGCAAAAAAATTAGCCGGG - Intergenic
989605361 5:43239396-43239418 AAAATACAAAAAAATTAACCCGG - Intronic
989611651 5:43299487-43299509 AAAATACAAAAGAATTAGCCGGG + Intronic
989644890 5:43620378-43620400 AAAATACAAAAAAATTAACCGGG - Intronic
990045277 5:51422595-51422617 AAAATACAAAAAACTTAGCCGGG - Intergenic
990094400 5:52094177-52094199 TAATTGAAAAAAACTTTACCTGG + Intergenic
990372995 5:55139864-55139886 AAAATACAAAAAAATTAACCAGG + Intronic
990410948 5:55540555-55540577 AAATGGCAAAAGACATGAACAGG - Intergenic
990913091 5:60873514-60873536 AAAATACAAAAAAATTAACCGGG + Intergenic
991264431 5:64700569-64700591 AAAATACAAAAAACTTAGCCAGG - Intronic
991309487 5:65220584-65220606 AAATTACAAAAAAATTAGCCGGG + Intronic
991440302 5:66640466-66640488 AAATTACAAAAAAATTAGCCAGG - Intronic
991924529 5:71691777-71691799 AAAATACAAAAAAATTAACCAGG - Intergenic
991928151 5:71725422-71725444 AAAATACAAAAAACTTAGCCGGG - Intergenic
992048568 5:72923088-72923110 AAAATACAAAAAACTTAGCCGGG - Intergenic
992409311 5:76489620-76489642 AAAATCCAAAAGAGTTAGCCTGG - Intronic
992563402 5:77974057-77974079 AAACTGCAGAAAACTTAGCCGGG - Intergenic
992661710 5:78968507-78968529 AAAATACAAAAAAATTAACCGGG - Intronic
993074832 5:83216143-83216165 AATTTGCAAAAGACTTGAATAGG + Intronic
993184084 5:84593564-84593586 AAAATGCAAAAAAATTAGCCGGG + Intergenic
993327049 5:86553446-86553468 AAATTAAAAAAGAATTAGCCAGG + Intergenic
993456794 5:88136795-88136817 AAAATACAAAAAAATTAACCAGG - Intergenic
993534309 5:89062594-89062616 AAAATGCAAAAAAATTAGCCAGG - Intergenic
994127346 5:96182976-96182998 AAATTACAAAATAATTAGCCGGG + Intergenic
994555641 5:101298267-101298289 CAAGTACAAAAGACTAAACCAGG - Intergenic
995727141 5:115193062-115193084 AAAATACAAAAAAATTAACCAGG - Intergenic
995956374 5:117781718-117781740 AAATGTCAAAATACTTCACCAGG + Intergenic
996105420 5:119496357-119496379 AAATTGCGAAAGACTGAAATAGG - Intronic
996240610 5:121196212-121196234 AAATTATAAAATACTTAACTGGG - Intergenic
996563694 5:124857599-124857621 AAAATACAAAAAACTTAGCCAGG + Intergenic
996976639 5:129441903-129441925 AAATTGCCAAAGACCAAACATGG + Intergenic
997180212 5:131820230-131820252 AAAATACAAAAAAATTAACCAGG - Intronic
997533318 5:134596280-134596302 AAAATACAAAAAAATTAACCGGG - Intergenic
997935251 5:138105003-138105025 AAAATACAAAAAAATTAACCAGG + Intergenic
997935299 5:138105307-138105329 AAAATACAAAAAAATTAACCAGG + Intergenic
997935631 5:138108365-138108387 AAAATGCAAAAAAATTAGCCGGG - Intergenic
997957307 5:138289123-138289145 AAAATACAAAAAAATTAACCAGG - Intronic
997989452 5:138531884-138531906 AAAATGCAAAAAAATTAGCCGGG + Intronic
998022454 5:138781393-138781415 AAAATGCAAAAAAATTAGCCGGG + Intronic
998272903 5:140723624-140723646 AAAATACAAAAAAATTAACCAGG - Intergenic
998320664 5:141226726-141226748 AAAATACAAAAGAATTAGCCAGG - Intergenic
998383121 5:141740064-141740086 AAAATGCAAAAAAATTAGCCGGG + Intergenic
998435542 5:142105146-142105168 AAAATACAAAAAACTTAGCCGGG - Intergenic
998459727 5:142300974-142300996 AAATGCCAAAAAAATTAACCAGG - Intergenic
998478749 5:142443712-142443734 AAAATACAAAAAAATTAACCGGG + Intergenic
998736271 5:145144779-145144801 AAAATACAAAAAAATTAACCGGG + Intergenic
998826707 5:146108977-146108999 AAAATGCAAAAAACTTAGCCAGG + Intergenic
998850768 5:146348625-146348647 AAATTACAAAAAACTTAGCTGGG + Intergenic
999192932 5:149762303-149762325 AAAATACAAAAAACTTAGCCGGG - Intronic
999288659 5:150409060-150409082 AAAATACAAAAAACTTAGCCAGG + Intronic
999397205 5:151237555-151237577 AAAATACAAAAAACTTAGCCTGG - Intronic
999776673 5:154817517-154817539 AAATTACAAAGGACTAAAGCAGG - Exonic
999864189 5:155683143-155683165 AAAATACAAAAAACTTAGCCAGG - Intergenic
1000022708 5:157332569-157332591 AAATTACAAAGGACATAACTGGG - Intronic
1000049726 5:157551988-157552010 AAAATGCAAAAAAATTAACCAGG + Intronic
1000783272 5:165511340-165511362 AAAATACAAAAAAATTAACCAGG - Intergenic
1000805349 5:165783860-165783882 AAAGTACAAAAAAATTAACCGGG + Intergenic
1000830552 5:166096165-166096187 AAAATACAAAAGAATTAGCCAGG - Intergenic
1001154060 5:169257711-169257733 AAAATGCAAAAAAATTAGCCAGG - Intronic
1001567613 5:172710179-172710201 AAAATACAAAAAAATTAACCGGG + Intergenic
1001641669 5:173248512-173248534 AAAAGGCAAAAGATTTAAACAGG - Intergenic
1001715197 5:173809890-173809912 AAAATACAAAAAAATTAACCGGG - Intergenic
1001782537 5:174382556-174382578 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1001809491 5:174617117-174617139 AAAATACAAAAAAATTAACCAGG - Intergenic
1001821095 5:174710916-174710938 AAAATACAAAAAACTTAGCCGGG - Intergenic
1001909958 5:175507810-175507832 AAAATGCAAAAAAATTAACCAGG + Intronic
1002120181 5:176997522-176997544 AAATTACAAAAAAATTAGCCGGG + Intronic
1002275635 5:178102793-178102815 AAAATGCAAAACAATTAGCCGGG + Intergenic
1002676459 5:180917866-180917888 AAAATACAAAAGAATTAGCCGGG + Intronic
1003350533 6:5313614-5313636 GATTTGCATAAGACTTAACAGGG + Intronic
1003354610 6:5355515-5355537 AAATTACAAAAAAATTAGCCGGG - Intronic
1003688279 6:8326497-8326519 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1003890550 6:10560247-10560269 AAAATACAAAAAAATTAACCGGG - Intronic
1003988510 6:11462250-11462272 AAAATACAAAAGAATTAGCCAGG + Intergenic
1004116603 6:12774550-12774572 AAAATACAAAAGAATTAGCCAGG - Intronic
1004232341 6:13844881-13844903 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1004386000 6:15173235-15173257 AAAATACAAAAAAATTAACCAGG + Intergenic
1004397085 6:15254879-15254901 AAAATGCAAAAAAGTTAGCCAGG + Intronic
1004572978 6:16865823-16865845 AAAATACAAAAAAATTAACCAGG - Intergenic
1004719425 6:18254028-18254050 ACATTGCAAAAGACTGAATGCGG + Intronic
1005026068 6:21464311-21464333 AAAATACAAAAAAATTAACCGGG - Intergenic
1005296632 6:24433651-24433673 AAAATACAAAAAAATTAACCGGG - Intronic
1005372034 6:25143597-25143619 AAAATGCAAAACAATTAGCCAGG + Intergenic
1005487776 6:26317522-26317544 AAAATACAAAAAAATTAACCCGG - Intergenic
1005580343 6:27228216-27228238 AAAATACAAAAGAATTAGCCGGG + Intergenic
1005580399 6:27228623-27228645 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1005591624 6:27334707-27334729 AAAATACAAAAAAATTAACCAGG + Intergenic
1005609610 6:27511028-27511050 AAAATACAAAAAAATTAACCAGG + Intergenic
1005735392 6:28740753-28740775 AAATTACAAAAAAATTAGCCGGG + Intergenic
1005848203 6:29799305-29799327 AAATTACAAAAAAATTAGCCGGG + Intergenic
1005853312 6:29839352-29839374 AAAATTCAAAAGAATTAGCCGGG - Intergenic
1005899770 6:30207188-30207210 AAAGTCCAAAATTCTTAACCTGG - Intronic
1005962166 6:30702100-30702122 AAAATACAAAAGAATTAGCCGGG + Intronic
1006048861 6:31324453-31324475 AAAATACAAAAAAATTAACCGGG - Intronic
1006118296 6:31787482-31787504 AAAATGCAAAAGAATTAGCTGGG + Intronic
1006307221 6:33230513-33230535 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1006343116 6:33457919-33457941 AAAATACAAAAAACTTAGCCAGG - Intergenic
1006471480 6:34231806-34231828 AAATTACAAAAAACGTAGCCAGG - Intergenic
1006530669 6:34650589-34650611 AAACTGCAAAAAAATTAGCCAGG - Intronic
1006553096 6:34841225-34841247 AAAATGCAAAAAAATCAACCAGG - Intronic
1006609332 6:35284250-35284272 AAAATACAAAAAAATTAACCAGG - Intronic
1007144207 6:39611145-39611167 AAAATGCAAAAGAATTAGCCAGG + Intronic
1007879979 6:45153907-45153929 AAAATGCAAAAAAATTAGCCAGG + Intronic
1007897073 6:45373709-45373731 AAATTACAAAAAAATTAGCCGGG - Intronic
1008251941 6:49251000-49251022 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1008736688 6:54553148-54553170 GATTTGCAGAAGAATTAACCTGG + Intergenic
1009024448 6:57981964-57981986 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1009189221 6:60609489-60609511 AAAATACAAAAAAATTAACCAGG - Intergenic
1009275125 6:61667378-61667400 AAATTGCATAAAACTTTAGCTGG - Intergenic
1009771693 6:68152231-68152253 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1009861127 6:69333767-69333789 AAAATGCAAAAAAATTAGCCGGG + Intronic
1009907592 6:69888630-69888652 AAATTACAAAAAAATTAGCCGGG + Intronic
1010200650 6:73279246-73279268 AAAATACAAAAAACTTAGCCAGG + Intronic
1010256266 6:73761679-73761701 AAAATGCAAAAAAATTAGCCAGG - Intronic
1010627964 6:78161753-78161775 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1011117673 6:83911894-83911916 AAATTACAAAAATATTAACCAGG + Intronic
1011388976 6:86830047-86830069 AAACTGCAAAAGACTGGCCCTGG - Intergenic
1011596179 6:89018882-89018904 AAAATACAAAAAACTTAGCCGGG + Intergenic
1012069133 6:94589808-94589830 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1012186410 6:96222769-96222791 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1012518465 6:100091899-100091921 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1012587879 6:100945872-100945894 AAAATACAAAAAACTTAGCCGGG - Intergenic
1012850595 6:104442267-104442289 AAAATACAAAAAACTTAGCCGGG + Intergenic
1012917371 6:105185104-105185126 AATTGGCAAAGGACTTAAACAGG - Intergenic
1013090601 6:106897056-106897078 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1013133999 6:107262067-107262089 AAAATGCAAAAAAATTAGCCGGG - Intronic
1013265983 6:108499426-108499448 AAATTTTAAAAGTCTTAATCAGG - Intronic
1013553733 6:111235653-111235675 AAATTACAAAAAAATTAGCCGGG + Intergenic
1013583478 6:111558591-111558613 AAATTACAAAAAAGTTAGCCGGG - Exonic
1013779380 6:113713211-113713233 AAAATGCAAAAGAATTAGCCAGG - Intergenic
1013795673 6:113885907-113885929 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1014129365 6:117813128-117813150 AAAATGTAAAAGAGATAACCAGG - Intergenic
1014317243 6:119883252-119883274 AAATTGGCAAAGATTTGACCAGG + Intergenic
1014431994 6:121381988-121382010 AAAGTGCTAAAGACTTAAACAGG - Intergenic
1015132962 6:129835236-129835258 AAATTGAAAAAAACTTAGCCTGG + Intronic
1015329622 6:131962174-131962196 AAAGTACAAAAAACTTAGCCAGG - Intergenic
1015333517 6:132008703-132008725 AAAATACAAAAAACTTAGCCAGG - Intergenic
1015381916 6:132579474-132579496 AAAATGCAAAAAAATTAGCCTGG + Intergenic
1015408497 6:132864658-132864680 AAAATACAAAAAAATTAACCAGG + Intergenic
1015532743 6:134237213-134237235 AAAATGCAAAAAAATTAGCCGGG - Intronic
1015546492 6:134367048-134367070 AAAATACAAAAGAATTAGCCGGG - Intergenic
1015673249 6:135715866-135715888 AAGCTGCAAAAGAGTCAACCAGG + Intergenic
1016264515 6:142215278-142215300 AAATTACAAAAAAGTTAGCCAGG + Intronic
1016287875 6:142493461-142493483 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1016961234 6:149674530-149674552 AAAATACAAAAAACTTAGCCAGG - Intronic
1017731493 6:157321166-157321188 AAAATACAAAAGAATTAACTGGG - Intronic
1018535847 6:164818332-164818354 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1018634586 6:165849532-165849554 AAATTGGAAAATGCTGAACCAGG - Intronic
1018723688 6:166593742-166593764 AAATGGCAAAAGATCTAAACAGG + Intronic
1019783873 7:2961010-2961032 AAAGTGCAAAAAAATTAGCCGGG + Intronic
1019797042 7:3057972-3057994 AAAATGCAAAAAATTTAGCCAGG + Intergenic
1019880922 7:3860078-3860100 AAAATACAAAAAACTTAGCCAGG - Intronic
1020102277 7:5400880-5400902 AAAATACAAAAAAATTAACCGGG + Intronic
1020175795 7:5881156-5881178 AAAATACAAAAAAATTAACCGGG + Intronic
1020249509 7:6456064-6456086 AAAATACAAAAAACTTAGCCAGG + Intronic
1020250628 7:6465342-6465364 AAAATACAAAAAACTTAGCCAGG - Intronic
1020252259 7:6478947-6478969 AAATTACAAAAAAGTTACCCGGG - Intronic
1020906667 7:14071895-14071917 AAATTACAAAAAAATTAGCCGGG - Intergenic
1020975661 7:15003105-15003127 ACATTCAAAAAGACTTAAGCTGG + Intergenic
1021090661 7:16478892-16478914 AAAATGCAAAAAAATTAGCCAGG - Intronic
1021175253 7:17442434-17442456 AAAATACAAAAAACTTAGCCGGG - Intergenic
1021412867 7:20347853-20347875 AAATAGCCAAAGACATAACAAGG + Intronic
1021557489 7:21935846-21935868 AAAATGCAAAAAAATTAGCCAGG + Intronic
1021570310 7:22058285-22058307 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1021715962 7:23462520-23462542 AAAATACAAAAAAATTAACCGGG - Intronic
1022011948 7:26315679-26315701 AAATTGCAAAATACTTGATAGGG + Intronic
1022325985 7:29332322-29332344 TAATTGTAAAATACTTAGCCTGG + Intronic
1022556668 7:31305186-31305208 AAATTCCAAAAAAATTAGCCAGG + Intergenic
1023411935 7:39896589-39896611 AAATTGCAAAAGAGCCAGCCTGG - Intergenic
1023506248 7:40902417-40902439 AAAATACAAAAAAATTAACCGGG + Intergenic
1023517604 7:41017608-41017630 AAAATACAAAAAACTTAGCCGGG + Intergenic
1023756447 7:43422521-43422543 AAAATACAAAAAAATTAACCAGG - Intronic
1023775179 7:43598921-43598943 AAATTACAAAAAAATTAGCCAGG - Intronic
1023918797 7:44610765-44610787 AAAATACAAAAGAATTAGCCGGG - Intronic
1024193168 7:47033291-47033313 AAAATACAAAAAAATTAACCGGG - Intergenic
1024355195 7:48407313-48407335 AAAATACAAAAAAATTAACCAGG + Intronic
1024619837 7:51147909-51147931 AAAATGCAAAAAACTTAGCTGGG - Intronic
1024627254 7:51218632-51218654 AAAATGCAAAATAATTAGCCAGG - Intronic
1024686858 7:51755580-51755602 AAAATACAAAATAATTAACCAGG - Intergenic
1024814104 7:53247637-53247659 AAAATACAAAAAACTTAGCCAGG + Intergenic
1024858476 7:53810358-53810380 AAAATGCAAAAAAATTAGCCTGG - Intergenic
1024960878 7:54974347-54974369 AAAATACAAAAAAATTAACCAGG + Intergenic
1025112684 7:56232544-56232566 AAAATACAAAAAACTTAGCCAGG + Intergenic
1025254455 7:57374114-57374136 AAAGTCCAAAGGGCTTAACCTGG - Intergenic
1025638587 7:63347436-63347458 AAAATACAAAAAACTTAGCCGGG - Intergenic
1025644109 7:63400653-63400675 AAAATACAAAAAACTTAGCCGGG + Intergenic
1025857700 7:65297484-65297506 AAATTGTACAAGACTTAATATGG + Intergenic
1025906948 7:65794533-65794555 AAAATACAAAAGAATTAGCCAGG - Intergenic
1025993401 7:66512825-66512847 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1026026192 7:66745606-66745628 AAAATGCAAAAAACTTAGCCAGG + Intronic
1026039552 7:66856262-66856284 AAAATACAAAAAAATTAACCAGG - Intergenic
1026050987 7:66946417-66946439 AAAATGCAAAAAAATTAGCCAGG + Intronic
1026059696 7:67015160-67015182 AAAATGCAAAAAAATTAGCCAGG - Intronic
1026135263 7:67654755-67654777 AATTTGCAAAAGTCTTAGCAAGG - Intergenic
1026156493 7:67830620-67830642 AAATAACAAAAGACTTAACATGG + Intergenic
1026305339 7:69135381-69135403 AAATAGAAAAATAATTAACCAGG + Intergenic
1026315925 7:69227161-69227183 AAAATACAAAAGAATTAGCCAGG + Intergenic
1026334308 7:69380673-69380695 AAATTAAAAAAAAATTAACCAGG - Intergenic
1026352356 7:69528564-69528586 AAAATGCAAAAAAATTACCCGGG - Intergenic
1026601014 7:71777187-71777209 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1026685522 7:72506159-72506181 AAAATGCAAAACAATTAGCCAGG + Intergenic
1026773992 7:73219910-73219932 AAATTAAAAAAAATTTAACCGGG + Intergenic
1026886074 7:73946982-73947004 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1026886435 7:73950770-73950792 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1026983646 7:74540920-74540942 AAAATACAAAAAAATTAACCAGG - Intronic
1027014849 7:74773296-74773318 AAATTAAAAAAAATTTAACCGGG + Intergenic
1027026421 7:74855258-74855280 AAAATACAAAAAAATTAACCGGG - Intergenic
1027061334 7:75088856-75088878 AAAATACAAAAAAATTAACCGGG + Intergenic
1027073182 7:75172657-75172679 AAATTAAAAAAAATTTAACCGGG - Intergenic
1027110444 7:75434433-75434455 AAAATACAAAAAATTTAACCAGG - Intronic
1027112030 7:75447861-75447883 AAAATACAAAAAAATTAACCAGG + Intronic
1027121590 7:75526214-75526236 AAATAGCAAAAAAATTAGCCAGG + Intergenic
1027214733 7:76176502-76176524 AAAATGCAAAACAGTTAGCCAGG - Intergenic
1027910047 7:84238873-84238895 AAACTGCAAAAAAATTAGCCAGG - Intronic
1027914625 7:84299869-84299891 AAAATACAAAAAAATTAACCAGG + Intronic
1027988054 7:85320408-85320430 AAAATGCAAAAGAACTAGCCAGG - Intergenic
1028149056 7:87351146-87351168 AAAATGCAAAAAAATTAGCCAGG + Intronic
1028221953 7:88207831-88207853 AAATACAAAAAAACTTAACCAGG + Intronic
1028435586 7:90799527-90799549 AAAATACAAAAAAATTAACCAGG + Intronic
1028697232 7:93728703-93728725 AAATTTCAAAACACTTAAGTTGG + Intronic
1028805685 7:95023710-95023732 AAAATACAAAAGAATTAGCCAGG - Intronic
1029016462 7:97320000-97320022 AAAATACAAAAAAATTAACCAGG - Intergenic
1029051556 7:97694250-97694272 AAAATACAAAAGAATTAGCCAGG + Intergenic
1029106753 7:98183546-98183568 AAAATACAAAAAAATTAACCAGG - Intronic
1029126512 7:98298450-98298472 AAAATACAAAAAACTTAGCCAGG + Intronic
1029182071 7:98710005-98710027 AAAATACAAAAAAATTAACCGGG - Intergenic
1029201824 7:98844323-98844345 AAATTACAAAAAAATTAGCCAGG + Intergenic
1029247957 7:99216186-99216208 AAAATGCAAAAAACTTAGCTGGG - Intergenic
1029357233 7:100061180-100061202 AAATTGAAAAAGAATTTACCAGG - Intronic
1029446161 7:100613797-100613819 AAAAGACAAAAGACTGAACCAGG - Intronic
1029574334 7:101393160-101393182 AAATTACAAAAGAATTAGCTGGG - Intronic
1029591649 7:101511059-101511081 AAAATACAAAAAACTTAGCCAGG - Intronic
1029623436 7:101704455-101704477 AAATTACAAAAAAATTAGCCAGG + Intergenic
1029795926 7:102894565-102894587 AAATTTGAAAAGAATTAACCAGG + Intronic
1030027069 7:105334677-105334699 AAAATGCAAAAAAATTAGCCAGG + Intronic
1030165293 7:106548485-106548507 AAAATAAAAAAGAATTAACCAGG - Intergenic
1030212294 7:107008435-107008457 AAAATACAAAAAAATTAACCGGG - Intergenic
1030406310 7:109118673-109118695 AAACTACAAAAAAATTAACCAGG + Intergenic
1030455924 7:109773542-109773564 AAAATACAAAAAACTTAGCCAGG - Intergenic
1030506043 7:110423890-110423912 AAATTACAAAAGTCTCAACTTGG - Intergenic
1030787164 7:113676089-113676111 AAATTGGAAAAGACATAAGAGGG + Intergenic
1030858010 7:114585704-114585726 AAAATACAAAAGAATTAACTGGG + Intronic
1030878287 7:114843238-114843260 AAAATATAAAAGACTTACCCAGG - Intergenic
1030996441 7:116364596-116364618 AAACTGGAAAAGATATAACCAGG + Intronic
1030998823 7:116391247-116391269 AAATTTCAAAATACTGTACCTGG + Intronic
1031041645 7:116844431-116844453 AAATTACAAAAAAATTAACCGGG + Intronic
1031049384 7:116929643-116929665 AAAATACAAAAAACTTAGCCGGG + Intergenic
1031377636 7:121047863-121047885 AAAATGCAAAAAAATTAGCCGGG - Intronic
1031651129 7:124291118-124291140 AAATTACAAAAAAATTAGCCAGG - Intergenic
1031907103 7:127472556-127472578 AAAGTACAAAAAACTTAGCCAGG + Intergenic
1032607961 7:133378148-133378170 AAAATACAAAAGAATTAACTGGG + Intronic
1033329957 7:140409534-140409556 AAAATACAAAAAAATTAACCGGG + Intronic
1033385984 7:140875534-140875556 AAAGTACAAAAAACTTAGCCAGG - Intronic
1033399086 7:141004904-141004926 AAAATGCAAAAAAGTTAGCCGGG - Intergenic
1033649942 7:143333138-143333160 AAAATTCAAAAAACTTAGCCAGG + Intronic
1033677746 7:143560451-143560473 ACATTTCAAAAGACTTAATCTGG - Intergenic
1033800655 7:144898172-144898194 AAAATACAAAAAACTTAGCCGGG - Intergenic
1034173578 7:149082739-149082761 AAAATGCAAAAAAATTAGCCAGG - Intronic
1034187656 7:149191453-149191475 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1034195576 7:149244471-149244493 AAAATACAAAAGAATTAGCCGGG - Intronic
1034326562 7:150239910-150239932 AAATTCAAAAAAAATTAACCAGG - Intergenic
1034394962 7:150815370-150815392 AAATTACAAAAAAATTATCCGGG + Intergenic
1034754867 7:153606785-153606807 AAAGTACAAAAGAATTAGCCAGG + Intergenic
1035166722 7:156994833-156994855 AAAATGCAAAAAAATTAGCCGGG + Intronic
1035309784 7:157959163-157959185 AACTTGCAAAAGAATAAAGCTGG + Intronic
1035384481 7:158461333-158461355 AAAATACAAAAAAATTAACCGGG + Intronic
1035425111 7:158765573-158765595 AAATTACAAAAAATTTAGCCAGG + Intronic
1035710994 8:1714057-1714079 AAAATACAAAAAAATTAACCGGG + Intergenic
1035877691 8:3209475-3209497 AAATTACAAAAAAATTAGCCGGG - Intronic
1035879080 8:3224266-3224288 AAATAGCAAAATAATTAACATGG - Intronic
1035914939 8:3608601-3608623 AAAATGCAAAAAAATTAGCCGGG + Intronic
1036006362 8:4668608-4668630 AAAATGCAAAAAAATTAGCCAGG - Intronic
1036026456 8:4914415-4914437 AAAATACAAAAAAATTAACCGGG + Intronic
1036100309 8:5775094-5775116 AAAATACAAAAGAATTAGCCAGG - Intergenic
1036480046 8:9131534-9131556 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1036924284 8:12888979-12889001 AACGGGCAAAAGACTTAAACAGG + Intergenic
1036929798 8:12944521-12944543 AAAATACAAAAAAATTAACCAGG + Intergenic
1037129112 8:15386058-15386080 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1037278565 8:17209331-17209353 AAATTGGAAAATACTTAGCCAGG + Intronic
1037850137 8:22320749-22320771 AAAATGCAAAAAAATTAGCCAGG - Intronic
1037939422 8:22940647-22940669 AAAATACAAAAAAATTAACCAGG - Intronic
1038196334 8:25371624-25371646 GAATTGCAAAAGATATAAACTGG - Intronic
1038625349 8:29187368-29187390 AAATACCAAAAAAATTAACCAGG + Intronic
1038647069 8:29370843-29370865 AAAATACAAAAAAATTAACCAGG + Intergenic
1038677231 8:29634309-29634331 AATTTGCAGAAGAATAAACCAGG + Intergenic
1038756521 8:30346279-30346301 AAATTTCAAAAGTATTGACCAGG - Intergenic
1038817763 8:30923174-30923196 AAAATACAAAAGAATTAGCCGGG - Intergenic
1039291147 8:36095548-36095570 AAAATACAAAAAAATTAACCGGG + Intergenic
1039458497 8:37724400-37724422 AAAATACAAAAAAATTAACCAGG + Intergenic
1039491983 8:37954633-37954655 AAATTACAAAAAAATTAGCCAGG + Intergenic
1039534965 8:38301417-38301439 AAAATACAAAAGAATTAGCCAGG + Intronic
1039957192 8:42216612-42216634 AAAATACAAAAAACTTAGCCGGG + Intergenic
1040074668 8:43217320-43217342 AAAATACAAAAAAATTAACCAGG + Intergenic
1040478548 8:47802811-47802833 AAAATACAAAAAAATTAACCAGG - Intronic
1040510205 8:48086614-48086636 AAAATGCAAAACAATTAGCCAGG - Intergenic
1040776437 8:51049081-51049103 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1040886216 8:52266700-52266722 AAAATCCAAAAAAATTAACCAGG - Intronic
1040934879 8:52772139-52772161 AAAGTGCAAAAGACTTCACAAGG + Intergenic
1040973505 8:53163884-53163906 AAAATACAAAAAAATTAACCGGG - Intergenic
1041046457 8:53891458-53891480 AAAATGCAAAAAAATTAGCCAGG + Intronic
1041139301 8:54798172-54798194 AAAATACAAAAAACTTAGCCGGG - Intergenic
1041192190 8:55365544-55365566 AAATTACAAAAAAATTAGCCGGG + Intronic
1041238763 8:55830893-55830915 AAAATACAAAAGAATTAGCCAGG + Intergenic
1041273163 8:56129459-56129481 AAATTACAAAAAAATTAGCCGGG + Intergenic
1041677533 8:60550541-60550563 AAAATACAAAAAACTTAGCCAGG - Intronic
1041856933 8:62467928-62467950 AAAATGCAAAAAAATTAGCCAGG - Intronic
1042101885 8:65283092-65283114 AAGTTGAAAAAGTCTTACCCAGG + Intergenic
1042252672 8:66772719-66772741 AAAATACAAAAGAATTAGCCAGG - Intronic
1042837150 8:73089393-73089415 AAATTACAAAAAAATTAGCCGGG + Intronic
1044719037 8:95128235-95128257 AAAATTCAAAAGAATTAGCCAGG + Intergenic
1045098264 8:98820815-98820837 AAAATACAAAAAAGTTAACCTGG + Intronic
1045134274 8:99196596-99196618 AAAATACAAAAAACTTACCCAGG - Intronic
1045216800 8:100157382-100157404 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1045303885 8:100939860-100939882 AAAATACAAAAGAATTAGCCGGG + Intronic
1045451862 8:102334735-102334757 AAAATACAAAAGACTTAACCGGG + Intronic
1045621774 8:103986710-103986732 AAAATACAAAACAATTAACCAGG + Intronic
1045939796 8:107726475-107726497 AAAATACAAAAAACTTAGCCAGG + Intergenic
1045962216 8:107981358-107981380 AAAATACAAAAAACTTAGCCAGG + Intronic
1045963843 8:108000839-108000861 AAAATACAAAAAAATTAACCAGG + Intronic
1046054047 8:109058353-109058375 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1046157270 8:110308869-110308891 AAAATACAAAAAAATTAACCGGG + Intergenic
1046202224 8:110942116-110942138 AAAATACAAAAAAGTTAACCAGG + Intergenic
1046592574 8:116223993-116224015 AAAATACAAAAGAATTAGCCAGG - Intergenic
1046743896 8:117856559-117856581 AAATTGAAAAAGCCTTGGCCAGG - Intronic
1046974737 8:120261854-120261876 CAATTGCAAAAGACATTCCCAGG - Intronic
1047191495 8:122682868-122682890 AAATTACAAAAAAATTAGCCGGG + Intergenic
1047245540 8:123140199-123140221 AAAATACAAAAAAGTTAACCAGG + Intronic
1047273084 8:123381338-123381360 AAATTGCAAAAAAATTAGCCAGG + Intronic
1047461742 8:125072181-125072203 AAAATACAAAAAACTTAGCCAGG + Intronic
1047653068 8:126945664-126945686 AAGGTAGAAAAGACTTAACCAGG + Intergenic
1047674782 8:127188804-127188826 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1047708920 8:127530583-127530605 AAATTACAAAAAAATTAGCCAGG + Intergenic
1047741113 8:127807926-127807948 AAAATACAAAACAATTAACCGGG - Intergenic
1047835132 8:128681229-128681251 AAAATACAAAAAAATTAACCGGG - Intergenic
1048100082 8:131341651-131341673 AAAATACAAAAGAATTAGCCAGG + Intergenic
1048359318 8:133682651-133682673 AAAATACAAAAAACTTAGCCAGG + Intergenic
1048455747 8:134576842-134576864 AAATTTGAAAAGAATTATCCAGG - Intronic
1048930178 8:139308720-139308742 AAAGTACAAAAAACTTAGCCGGG - Intergenic
1049560794 8:143309171-143309193 AAAATACAAAAAACTTAGCCGGG - Intronic
1049628620 8:143638575-143638597 AAAATGCAAAAAAATTAGCCGGG + Intronic
1049869577 8:144963928-144963950 AAAATACAAAAAACTTAGCCAGG - Intergenic
1050344486 9:4672935-4672957 AAAATGCAAAAAACTTAGCCGGG + Intergenic
1050379981 9:5018495-5018517 AAAATACAAAAGAATTAGCCAGG - Intronic
1050474471 9:6025743-6025765 AAAATACAAAAAAATTAACCAGG + Intergenic
1050558666 9:6811312-6811334 AAAATACAAAAAACTTAGCCAGG - Intronic
1050728035 9:8674976-8674998 AAATTACAAAAGAAATAACCAGG + Intronic
1051065962 9:13103350-13103372 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1051273691 9:15379262-15379284 AAAATACAAAAAAATTAACCGGG - Intergenic
1051409800 9:16777538-16777560 AAAATACAAAAAAATTAACCAGG + Intronic
1051438664 9:17058994-17059016 AAAATACAAAAAACTTAGCCGGG - Intergenic
1051444585 9:17126888-17126910 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1051639666 9:19212916-19212938 AAAATACAAAAAAATTAACCAGG - Intergenic
1051917856 9:22229599-22229621 AAAATACAAAAGAATTAGCCAGG - Intergenic
1052342646 9:27378853-27378875 AAATTGCAAACCACTTATCCAGG + Intronic
1052421039 9:28243297-28243319 AAAATACAAAAAAATTAACCGGG + Intronic
1052601658 9:30639976-30639998 AAATTACAAAAAAATTATCCGGG + Intergenic
1052647974 9:31262134-31262156 AAAATGCAAAAAACATAGCCGGG + Intergenic
1052884080 9:33626229-33626251 AAAATACAAAAGAATTAGCCGGG + Intergenic
1052925664 9:34014164-34014186 AAAATGCAAAAAAGTTAGCCGGG + Intronic
1053211478 9:36232435-36232457 AAATTCCAAATGACTTACCCTGG + Intronic
1053594553 9:39546424-39546446 AAAATACAAAAAACTTAGCCAGG + Intergenic
1053599107 9:39592074-39592096 AAAATACAAAAGAATTAGCCAGG + Intergenic
1053856862 9:42346591-42346613 AAAATACAAAAGAATTAGCCAGG + Intergenic
1053864469 9:42422694-42422716 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1054593453 9:67037627-67037649 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1054708285 9:68484866-68484888 AAACTGGAAAAGACCTATCCAGG - Intronic
1054969539 9:71069335-71069357 AAAATGCAAAAAATTTAGCCAGG - Intronic
1055056210 9:72026684-72026706 AAAATACAAAAAACTTAGCCAGG - Intergenic
1055405632 9:75970780-75970802 AAAATACAAAAAAATTAACCAGG - Intronic
1055968488 9:81888428-81888450 AAAGTACAAAAAACTTAGCCAGG + Intergenic
1056375992 9:86011517-86011539 AAAATACAAAAAAATTAACCAGG - Intronic
1056517214 9:87365438-87365460 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1056583449 9:87912619-87912641 AAAATACAAAAAAATTAACCGGG + Intergenic
1056613481 9:88140956-88140978 AAAATACAAAAAAATTAACCGGG + Intergenic
1056977838 9:91276268-91276290 AAATTGCAAAAACATTAGCCGGG + Intronic
1057137513 9:92703642-92703664 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1057194612 9:93110152-93110174 AAAATACAAAAAACTTAGCCGGG - Intronic
1057548157 9:96033403-96033425 AAAATGCAAAAAATTTAGCCAGG - Intergenic
1057775094 9:98001350-98001372 AAAATACAAAAAACTTAGCCAGG - Intronic
1057924636 9:99133841-99133863 AAAATGCAAAAAAATTAGCCGGG + Intronic
1058395205 9:104544582-104544604 AAAATACAAAAAAATTAACCAGG + Intergenic
1058531449 9:105909401-105909423 AAATTTCCAAAGACTAAATCAGG - Intergenic
1058663581 9:107288604-107288626 AAAATACAAAAAAATTAACCAGG - Intronic
1058939465 9:109799652-109799674 AAAATACAAAAAAATTAACCAGG - Intronic
1059266479 9:113036798-113036820 AAAATACAAAAAAATTAACCAGG - Intergenic
1059697547 9:116743388-116743410 AAAATGCAAAAAAATTAGCCAGG + Intronic
1060333661 9:122700628-122700650 AAAATACAAAAGAATTAGCCAGG + Intergenic
1060382130 9:123185869-123185891 AAAATGCAAAAAAATTAGCCGGG + Intronic
1060527948 9:124331103-124331125 AAATAGCAAAAAAATTAGCCAGG + Intronic
1060698037 9:125726215-125726237 AAATAGAAAAAGACTAAACTGGG - Intergenic
1060802555 9:126553982-126554004 AAAATACAAAAGAATTAGCCAGG - Intergenic
1061103075 9:128507421-128507443 AAAATACAAAAAAATTAACCAGG + Intronic
1061136810 9:128739340-128739362 AAAATACAAAAAAATTAACCGGG + Intronic
1061345575 9:130022363-130022385 AAAATACAAAAAAATTAACCGGG - Intronic
1061346691 9:130031820-130031842 AAAATACAAAAAACTTAGCCAGG - Intronic
1061456209 9:130699844-130699866 AAATTAAAAAAGAATTAGCCGGG + Intronic
1061485027 9:130916087-130916109 AAAATACAAAAAACTTAGCCGGG - Intronic
1061984523 9:134122288-134122310 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1062088160 9:134659226-134659248 AAAATACAAAAAACTTAGCCGGG + Intronic
1062102379 9:134735050-134735072 AAACTACAAAAAAATTAACCAGG + Intronic
1062336224 9:136070345-136070367 AAAATGCAAAAAAATTAGCCGGG + Intronic
1202786974 9_KI270719v1_random:34431-34453 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1203363986 Un_KI270442v1:242033-242055 AAAATACAAAAAAATTAACCAGG - Intergenic
1185508939 X:648383-648405 AAAATGCAAAAAAATTACCCAGG - Intronic
1185624158 X:1470995-1471017 AAATTACAAAAAAATTAGCCAGG - Intronic
1185790792 X:2927418-2927440 AAATTACAAAAAAATTAGCCGGG - Intronic
1185973321 X:4688709-4688731 AAATTACAAAACACTCAGCCGGG - Intergenic
1186075205 X:5870935-5870957 AAAATACAAAAGAATTAGCCAGG - Intronic
1187342161 X:18431020-18431042 AAAATGCAAAAAAATTAGCCAGG - Intronic
1187367750 X:18678271-18678293 AAAATACAAAAAACTTAGCCAGG + Intronic
1187455984 X:19441613-19441635 AAAATACAAAAAAATTAACCAGG - Intronic
1187476092 X:19612422-19612444 AAAATACAAAAAAATTAACCAGG - Intronic
1187743690 X:22385004-22385026 AAAATACAAAAAACTTAGCCGGG + Intergenic
1187898323 X:24003390-24003412 AAAATGCAAAAAAATTAGCCGGG + Intronic
1187906200 X:24069075-24069097 AAAATGAAAAAGAGTTTACCAGG + Intronic
1187935075 X:24328122-24328144 AAAATACAAAAAAATTAACCAGG + Intergenic
1187987922 X:24834616-24834638 AAAATACAAAAGAATTAGCCAGG + Intronic
1188000022 X:24972127-24972149 AAAATACAAAAAACTTAGCCGGG - Intronic
1188479818 X:30625765-30625787 AAAATACAAAAAAATTAACCAGG + Intergenic
1188548933 X:31340159-31340181 AGAGAGAAAAAGACTTAACCAGG + Intronic
1188591214 X:31837817-31837839 AAATTGCAAGAGACTGTACTGGG - Intronic
1189327801 X:40123511-40123533 AAAATACAAAAAACTTAGCCGGG - Intronic
1189444940 X:41072153-41072175 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1189661286 X:43302687-43302709 ACATAGCCAAAGACTGAACCTGG - Intergenic
1190220700 X:48510620-48510642 AAATTTCAAAATAATAAACCTGG - Intronic
1190276052 X:48900088-48900110 AAAATACAAAAAACTTAGCCGGG + Intronic
1190497646 X:51041906-51041928 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1191593956 X:62922425-62922447 AAAATACAAAAAATTTAACCAGG + Intergenic
1191596698 X:62952101-62952123 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1191827142 X:65377936-65377958 AAAATTCAAAAAAATTAACCGGG + Intronic
1192026901 X:67462860-67462882 AATGTGCAAAAGACTTAAATAGG + Intergenic
1192139488 X:68635472-68635494 AAAATGCAAAATTCTTAGCCAGG - Intergenic
1192331957 X:70182812-70182834 AAAATACAAAAAACTTAGCCGGG - Intronic
1192374251 X:70543019-70543041 AAAATGCAAAAAAATTAGCCGGG + Intronic
1192384431 X:70651845-70651867 AAATAGCAAAAGAATTACCAAGG + Intronic
1192422599 X:71047131-71047153 AAAATACAAAAAACTTAGCCGGG + Intergenic
1192465622 X:71353616-71353638 AAAATACAAAAGAATTAGCCGGG - Intergenic
1192791525 X:74386812-74386834 AAATTACAAAAAAATTAGCCAGG + Intergenic
1192792630 X:74398190-74398212 AAAATACAAAAAACTTAGCCGGG + Intergenic
1193101661 X:77621468-77621490 AAAATGCAAAAAAATTAGCCAGG - Intronic
1193362494 X:80592276-80592298 AAATAAAAAAAGACTGAACCAGG + Intergenic
1193383423 X:80843470-80843492 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1193602562 X:83525994-83526016 AAAGTACAAAAAAATTAACCAGG + Intergenic
1193763368 X:85494039-85494061 AAAGTACAAAAGACTTAGTCTGG + Intergenic
1193866078 X:86731765-86731787 AAAATGAAAAAGGCTTAGCCAGG - Intronic
1193894723 X:87098980-87099002 AAATGGCAAAAGACTCAAACAGG - Intergenic
1194223136 X:91222233-91222255 AAATTGCAAAAAACAAAAACAGG + Intergenic
1194418966 X:93649244-93649266 AAACTGCACAAGAAGTAACCTGG + Intergenic
1194553282 X:95327524-95327546 AAAATGCAAAAAAATTAACTGGG + Intergenic
1194710251 X:97227554-97227576 TGATTGCAAAAGATTTAATCAGG + Intronic
1194826570 X:98572168-98572190 AAAAGGCAAAAGACTTAAATAGG + Intergenic
1194975858 X:100395544-100395566 AAAAGGCAAATGACTTACCCAGG - Intronic
1195154435 X:102109264-102109286 AAAATACAAAAAAATTAACCAGG + Intergenic
1195271953 X:103240942-103240964 AAAATACAAAAAAATTAACCAGG - Intergenic
1196292644 X:113961087-113961109 AAAATACAAAAGAATTAGCCGGG + Intergenic
1196343440 X:114624067-114624089 AAAATACAAAAAACTTAGCCAGG - Intronic
1196436745 X:115681527-115681549 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1196506475 X:116450323-116450345 AACTGGCAAAAGACATGACCAGG + Intronic
1196711288 X:118765930-118765952 AACTGGCAAAAGACTTGAACAGG - Intronic
1196727425 X:118908878-118908900 AAAATGCAAAAAAATTAGCCGGG - Intergenic
1196782446 X:119395660-119395682 AAAATGCAAAAAAATTAGCCAGG + Intergenic
1196835934 X:119813720-119813742 AAAATACAAAAAAATTAACCGGG - Intergenic
1196898985 X:120364875-120364897 AAATTAAAAAAAAATTAACCAGG - Intronic
1197323623 X:125064765-125064787 AAATTACAAAAAATTTAGCCAGG - Intergenic
1197334643 X:125197969-125197991 GTATTGCAAAAGACTTGACATGG + Intergenic
1197613047 X:128660175-128660197 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1197663915 X:129202683-129202705 AAAGTGCAAAAAAATTAGCCAGG - Intergenic
1198371107 X:135990144-135990166 AAATTACAAAAAATTTAGCCAGG - Intronic
1198473357 X:136971152-136971174 AAAATACAAAAAACTTAGCCAGG - Intergenic
1198746518 X:139896765-139896787 AAATTACAAAAAAATTAGCCGGG - Intronic
1198767773 X:140095854-140095876 AAATTACAAAAAAATTAGCCAGG - Intergenic
1198970732 X:142276521-142276543 AAAATACAAAAAACTTAGCCAGG - Intergenic
1199722443 X:150551582-150551604 AAAATGCAAAAAAATTAGCCGGG + Intergenic
1199820034 X:151435676-151435698 AAAATACAAAAGACTTAGCTGGG + Intergenic
1200156462 X:153978945-153978967 AAAATACAAAAAAATTAACCAGG - Intronic
1200241205 X:154495018-154495040 AAAATGCAAAAAAATTAGCCAGG - Intergenic
1200311616 X:155084521-155084543 AAAATGCAAAAAAATTAGCCGGG - Intronic
1200373735 X:155757126-155757148 AAAATGCAAAATATTTAACATGG + Intergenic
1200413484 Y:2885025-2885047 AAATTACAAAAAAATTAGCCGGG + Intronic
1200889003 Y:8302375-8302397 AAAATACAAAAGAATTAGCCGGG + Intergenic
1201267287 Y:12220093-12220115 AAAATGCAAAAAAATTAACTGGG - Intergenic
1201675931 Y:16584000-16584022 AAATTAAAAAAAACTTAGCCAGG - Intergenic
1201708892 Y:16967515-16967537 AAAATACAAAAGAATTAGCCAGG - Intergenic
1202328041 Y:23713511-23713533 ATATTGCAAAAGAATTAAATTGG + Intergenic
1202345133 Y:23914588-23914610 ATATTGCAAAAGAATTAAATTGG + Intergenic
1202525637 Y:25755501-25755523 ATATTGCAAAAGAATTAAATTGG - Intergenic
1202542729 Y:25956541-25956563 ATATTGCAAAAGAATTAAATTGG - Intergenic
1202588382 Y:26456204-26456226 AAAATGCAAAAAAATTAGCCGGG - Intergenic