ID: 1166592445

View in Genome Browser
Species Human (GRCh38)
Location 19:44012191-44012213
Sequence AGTTGAGGACTTGAGGCCTG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 244}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166592445_1166592448 -2 Left 1166592445 19:44012191-44012213 CCTCAGGCCTCAAGTCCTCAACT 0: 1
1: 0
2: 3
3: 19
4: 244
Right 1166592448 19:44012212-44012234 CTGCACCAGAGTGTCCACGTTGG 0: 1
1: 0
2: 1
3: 8
4: 108
1166592445_1166592451 19 Left 1166592445 19:44012191-44012213 CCTCAGGCCTCAAGTCCTCAACT 0: 1
1: 0
2: 3
3: 19
4: 244
Right 1166592451 19:44012233-44012255 GGACAGAATCCTTAGTAATGAGG 0: 1
1: 0
2: 0
3: 12
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166592445 Original CRISPR AGTTGAGGACTTGAGGCCTG AGG (reversed) Exonic
900087134 1:904105-904127 AGTGGAGGATGGGAGGCCTGGGG + Intergenic
900163287 1:1234661-1234683 AGTTGTGGACTCGAGCCCAGGGG + Exonic
902228002 1:15008850-15008872 AGGAGAGGCCTTGAGGACTGTGG - Intronic
903044284 1:20553860-20553882 AGCTGAGGACGTGCAGCCTGCGG + Exonic
903453520 1:23470972-23470994 AATTCAGGGCTTGAGGCCAGGGG - Intronic
903789515 1:25882964-25882986 GGTGGAGGACTTGAGGCGGGAGG + Intergenic
905629510 1:39510903-39510925 AGTTCAGGATTTGGAGCCTGGGG + Intronic
907557267 1:55355186-55355208 GGTTGAGTACTTGATGCCTTAGG - Intergenic
908711421 1:67019787-67019809 AGTTGGTGGCTTGAAGCCTGAGG - Intronic
909734322 1:78937217-78937239 AGTGGATGGCTTGAGGCCAGGGG + Intronic
910834738 1:91497309-91497331 ACTGGAGACCTTGAGGCCTGTGG - Intergenic
914442344 1:147718552-147718574 AGATGAGGCCATGGGGCCTGAGG + Intergenic
914806308 1:150994729-150994751 AGGTGAGGAGTGAAGGCCTGAGG - Intronic
915062251 1:153195853-153195875 AGTTGGGGTCTTGTGGGCTGTGG - Intergenic
915138669 1:153752381-153752403 AACTGAGGACTCAAGGCCTGAGG - Exonic
915318082 1:155041005-155041027 AGTTGGGGACATGGGGGCTGAGG + Intronic
915557828 1:156670062-156670084 ATTTGAGGACCTGGGGACTGAGG - Exonic
917739130 1:177946199-177946221 AGAGGAGGACCTGTGGCCTGAGG + Intronic
919413103 1:197271416-197271438 AGTTGAGGACATGTGACATGAGG + Intronic
921888716 1:220332320-220332342 ATATGGGGACATGAGGCCTGGGG - Intergenic
923884004 1:238135265-238135287 AGTTGAAGAAATGAGGCTTGGGG - Intergenic
924771619 1:247085292-247085314 AGGTGAGGGACTGAGGCCTGGGG - Intergenic
924775977 1:247114668-247114690 AGGTGAGGGACTGAGGCCTGGGG + Intergenic
1062861387 10:813034-813056 AGGTGTGGACTTGAGGGCTGGGG + Exonic
1065029983 10:21576150-21576172 ACTTGATCACTTGAGGCCAGGGG - Intronic
1066316597 10:34253582-34253604 AGCTGAGGCCTTAAGACCTGCGG - Intronic
1067438801 10:46296758-46296780 AGTTCAGGACTCCAGGCCAGTGG - Intronic
1067720339 10:48723301-48723323 ACTTGAGGACTGGAGCCCAGAGG + Intronic
1068612001 10:59070352-59070374 GGTTGAAGACTTGAGAACTGGGG + Intergenic
1068655833 10:59575607-59575629 AGTGGAGGACTTGGGGACTCTGG + Intergenic
1069719995 10:70543864-70543886 AGATGAGAAAATGAGGCCTGGGG + Intronic
1070364356 10:75721940-75721962 AGTTGAGGAATTAAGGCTGGTGG + Intronic
1070393805 10:75994021-75994043 AGGTGAGGGATTGGGGCCTGTGG - Intronic
1070662393 10:78316631-78316653 AGCTGAGCACATGAGGCCTGGGG - Intergenic
1070785784 10:79161423-79161445 AGTGGAGGACTTGGGGTCTGTGG - Intronic
1072085860 10:92078449-92078471 AGATGAGGACCTGAGGCTTCTGG + Intronic
1073489251 10:103841746-103841768 AGGTGAGGAAGTGAGCCCTGTGG - Intronic
1074318365 10:112379025-112379047 AGTTGAGGATTTGAGGTCTGGGG + Intronic
1076531930 10:131150575-131150597 AGTTGAGGGCCAGAGGACTGGGG + Intronic
1078154248 11:8785221-8785243 AATTCAGGATTTGGGGCCTGGGG - Intronic
1081011440 11:37817800-37817822 AGTTGGGGACTACAGGCATGTGG + Intergenic
1081336375 11:41872182-41872204 TGTTGAGGACTTTAGGCCTTAGG + Intergenic
1081580084 11:44346119-44346141 AGGTGGGGAGATGAGGCCTGGGG - Intergenic
1082305597 11:50569909-50569931 CATTGAGGCCTTGAGGCCTATGG - Intergenic
1083436816 11:62648521-62648543 AGCTGTGGACCTGAGGCCTTGGG - Exonic
1083880127 11:65544261-65544283 AGGTGAGGACTTGAGAACAGTGG - Intronic
1085291090 11:75399971-75399993 AGTTGAGGTCCTGGGGCCAGCGG - Intronic
1085666774 11:78420872-78420894 AGTTGAGGGTTTGTGGCCAGCGG + Intergenic
1086759214 11:90606098-90606120 AGGTGAGGAGTTGAGGCAGGAGG + Intergenic
1087094279 11:94305206-94305228 GGTTGGGTGCTTGAGGCCTGGGG + Intergenic
1088557878 11:111081021-111081043 AGGAGAGGACATAAGGCCTGGGG + Intergenic
1088921218 11:114260923-114260945 GGTTGAGGAAGTGAGGCCTTCGG - Intronic
1089402556 11:118172731-118172753 AGTGGATGACACGAGGCCTGAGG - Intronic
1089505415 11:118958817-118958839 TGTGGAGGCCTGGAGGCCTGGGG + Intergenic
1089584756 11:119503121-119503143 CTTTGAGGAGCTGAGGCCTGTGG - Intergenic
1089868711 11:121654082-121654104 ATTTGAGAACGTGAGTCCTGTGG + Intergenic
1090474745 11:127009694-127009716 AGTTGAGGACTTGCTTCTTGTGG - Intergenic
1090828772 11:130406365-130406387 GGTTGAGGAGTTGAGGTATGTGG + Intronic
1091027442 11:132154647-132154669 TGCTGAGGACCTGAGGGCTGGGG - Intronic
1091341214 11:134815501-134815523 AATTGAGGACTTGAGGGGAGTGG + Intergenic
1091434852 12:464334-464356 AGTTCTGGACTAGAGGCCGGGGG + Intronic
1093872769 12:24312036-24312058 AGTTGAGAAATTAAGGCCTTTGG + Intergenic
1096473133 12:51891128-51891150 TCTTGGGGACTTGGGGCCTGGGG - Exonic
1098544371 12:71695009-71695031 ATTTGAAGACTTGAGGACTATGG - Intronic
1098908907 12:76189399-76189421 AGTTGAGAAGCTGAGGCATGAGG - Intergenic
1104464821 12:128981840-128981862 AGTTGAGGAGCTGAGGCTTGGGG + Intronic
1104717438 12:131025505-131025527 GGCTGAGGTCTTGAGGCCCGAGG + Intronic
1107340763 13:39402944-39402966 AAGTGAGGACTTGAGTACTGTGG - Intronic
1109044653 13:57393856-57393878 AATTGAGAAGATGAGGCCTGGGG - Intergenic
1110801890 13:79707895-79707917 GGTTCAGGAATTGAGGTCTGTGG - Intergenic
1118537187 14:66780665-66780687 ACTTGAGAGTTTGAGGCCTGAGG + Intronic
1121175974 14:91890854-91890876 AGTTCAGTTCCTGAGGCCTGAGG - Intronic
1121216015 14:92248430-92248452 AGTGGATCACTTGAGGCCAGGGG + Intergenic
1122294940 14:100700118-100700140 AGCTGTGGACTTGTGGCCTCCGG + Intergenic
1123386496 15:19814490-19814512 ATTGGAGCACTTGAGGCCTATGG - Intergenic
1124034191 15:26038981-26039003 ATTTGCGGACAGGAGGCCTGTGG + Intergenic
1127719005 15:61681429-61681451 AGTTGAGTACTTGAGGACCAGGG - Intergenic
1127851361 15:62914734-62914756 AGTTCAGGCCTTGAGGCAAGTGG - Intergenic
1129811483 15:78514279-78514301 AGATGAGGACTGGCGGCCTTAGG - Intronic
1131426433 15:92348899-92348921 AGTTGAGGGCATGTAGCCTGGGG - Intergenic
1132335961 15:101048899-101048921 AGCTGAGGACTTGAGGGACGTGG + Intronic
1132405866 15:101541595-101541617 TGATGAGGGGTTGAGGCCTGAGG + Intergenic
1132405969 15:101542075-101542097 AGATGAGGACTTGTGGGCCGGGG + Intergenic
1135546476 16:23370444-23370466 AGTTGAGCACTTGCTACCTGCGG - Intronic
1136048736 16:27635741-27635763 AGTTAACCACTTGAAGCCTGTGG + Intronic
1137321867 16:47392310-47392332 AGATGAGGAAGTGAGCCCTGTGG + Intronic
1138232897 16:55352272-55352294 ATGTGAGGTCATGAGGCCTGGGG + Intergenic
1139703968 16:68727548-68727570 AGTGGATCACTTGAGGCCAGGGG + Intergenic
1141027757 16:80563997-80564019 ATTTTATGATTTGAGGCCTGTGG - Intergenic
1143198976 17:5098872-5098894 AGTTGATCATTTGAGGCCTTTGG + Intergenic
1144204160 17:12967448-12967470 TGTTGAGGAATTGAGGCAGGAGG - Intronic
1144473251 17:15563117-15563139 AGTTGAGGAGGAGCGGCCTGCGG - Intronic
1144784210 17:17822962-17822984 ACTTGATGACTTGTGACCTGGGG - Intronic
1144923231 17:18781603-18781625 AGTTGAGGAGGAGCGGCCTGCGG + Intronic
1146173430 17:30649965-30649987 AGTGCAGGCCTGGAGGCCTGGGG - Intergenic
1146289561 17:31597954-31597976 ACATGAGGACTGAAGGCCTGGGG - Intergenic
1146346887 17:32065995-32066017 AGTGCAGGCCTGGAGGCCTGGGG - Intergenic
1146467851 17:33100776-33100798 AATTGGGGACATGAGGTCTGAGG + Intronic
1146876512 17:36417009-36417031 ACTTGATCACTTGAGGCCAGGGG - Intronic
1147062872 17:37895852-37895874 ACTTGATCACTTGAGGCCAGGGG + Intergenic
1147670249 17:42172897-42172919 AGGCAAGGACTTGAGGGCTGGGG + Intronic
1147913035 17:43868963-43868985 AGTGGATCACTTGAGGCCAGGGG + Intergenic
1149460666 17:56827706-56827728 ACTTGAGGACTTGGGTCATGGGG - Intronic
1149910170 17:60559549-60559571 AGATGAGGCCATGAGGCCTGAGG - Intergenic
1151620294 17:75240904-75240926 CGTGGAGGTCCTGAGGCCTGGGG + Exonic
1151778527 17:76226288-76226310 AGTGGAGGACTGGACCCCTGGGG + Intronic
1152356239 17:79809063-79809085 CGGTGAGGCCTTGGGGCCTGTGG + Intergenic
1152976721 18:228217-228239 AGTTGAAGACTTCAGATCTGGGG - Intronic
1155166261 18:23234796-23234818 GGTGGAGGACTCGAGGTCTGGGG + Intronic
1157599957 18:48887786-48887808 ACCTGAGGTCATGAGGCCTGGGG + Intergenic
1159471361 18:68860645-68860667 AGATGAGCAATTGAGGTCTGTGG - Intronic
1160707381 19:535937-535959 GGATGAGGACTTGAGGCCCGTGG - Intronic
1161446148 19:4320390-4320412 CGAGGAGGACTTGAGGCCTGTGG + Intronic
1162291952 19:9786602-9786624 ACTAGAGGAATTGAGGCCGGAGG - Intronic
1162988992 19:14290095-14290117 AGTGCAGGCCTGGAGGCCTGGGG + Intergenic
1163640851 19:18461228-18461250 ATTTGTGGACTCAAGGCCTGGGG - Intronic
1163924064 19:20321947-20321969 AGGTGAGGACGTGAGGACTTCGG + Intergenic
1166592445 19:44012191-44012213 AGTTGAGGACTTGAGGCCTGAGG - Exonic
1167281495 19:48571876-48571898 AGGTGAGGACAAGAGGCATGAGG + Intronic
1168527008 19:57096837-57096859 CGTTGCGGACTTGAGAGCTGAGG - Intergenic
925125927 2:1455819-1455841 AGATGAGGAAGTGAGGGCTGAGG + Intronic
925550848 2:5072781-5072803 AGATCAGGACTTAAAGCCTGAGG - Intergenic
927654601 2:24934865-24934887 AGTTGAGGAGTTGAGATCAGAGG + Intergenic
927768828 2:25839954-25839976 AGAGGATTACTTGAGGCCTGGGG - Intronic
928366720 2:30708599-30708621 AGATGAGGACTTGAGAGCCGGGG + Intergenic
928854665 2:35789679-35789701 AGATAAGGCCATGAGGCCTGAGG + Intergenic
929480978 2:42307878-42307900 AGGTGATCACTTGAGGCCAGGGG - Intronic
929574237 2:43042079-43042101 AGCTGTGGGGTTGAGGCCTGAGG - Intergenic
929887562 2:45892483-45892505 AGCTGAGGACTTGAGGACTCAGG + Intronic
930240607 2:48932117-48932139 AGTTGTTTACCTGAGGCCTGTGG + Intergenic
930748471 2:54908735-54908757 AGATGTGGACTTTGGGCCTGTGG - Intronic
930884645 2:56311307-56311329 GGTTGAGGCATTGAGACCTGAGG - Intronic
931293379 2:60897625-60897647 AGCTGATGACTTCAGGGCTGGGG - Intronic
931752988 2:65347189-65347211 AGTTGAGGACATGGGGTTTGGGG - Intronic
935371252 2:102349348-102349370 AGTTCTGGTCTTAAGGCCTGTGG - Intronic
937496561 2:122426375-122426397 GCTTGAGGACATGGGGCCTGAGG + Intergenic
938118814 2:128619870-128619892 AGTGGGGGAACTGAGGCCTGGGG + Intergenic
939671237 2:145015286-145015308 AGTTGAGGAATTGAGACATAGGG - Intergenic
943878242 2:193102173-193102195 AGGGGATGACTTGATGCCTGGGG + Intergenic
944312749 2:198252612-198252634 AGTTGAGGACAGGCTGCCTGTGG + Intronic
1169023695 20:2349503-2349525 GCTTGAAGACTTGAGGGCTGAGG - Intergenic
1172058097 20:32168140-32168162 AGATGAGGAACTGAGGCTTGGGG - Intergenic
1172647459 20:36479866-36479888 AGCTGAGGATTTCTGGCCTGGGG - Intronic
1172723853 20:37020899-37020921 AGTTCAGGCTTTGTGGCCTGTGG + Intronic
1173012675 20:39196372-39196394 CCTTGAGGACTTGAAGCCTAGGG + Intergenic
1173075551 20:39815503-39815525 ATTTAAGGACTTGAGGGCTGGGG + Intergenic
1174533996 20:51236961-51236983 AGGTGAGGACAGGAGGACTGGGG + Intergenic
1174725793 20:52860467-52860489 TGGTAAGGTCTTGAGGCCTGAGG + Intergenic
1175409384 20:58756100-58756122 AGATGAGGTCATGAGGCCTATGG - Intergenic
1178010807 21:28284204-28284226 AGTAAAGGAATTGAGGCCTGAGG + Intergenic
1178626719 21:34224620-34224642 ACTTGGGAACTTGAGGCATGAGG + Intergenic
1179183221 21:39062475-39062497 AGCTGAGGCCATGAGGCCTCAGG + Intergenic
1181463700 22:23099602-23099624 CCTTGTGGACTTGAGGGCTGGGG - Intronic
1181469909 22:23131887-23131909 AGTTGAGCACACTAGGCCTGTGG - Intronic
1181544081 22:23591173-23591195 AGTTCTGGCCTTCAGGCCTGCGG + Intergenic
1183461110 22:37951234-37951256 AGATGAGGTCTTGTGGCTTGTGG + Intronic
1183675145 22:39294977-39294999 GGTAGAGGAACTGAGGCCTGAGG + Intergenic
1184328646 22:43811715-43811737 AGACGAGGACTTGAAACCTGTGG - Intronic
1185256601 22:49836819-49836841 TGTTGTGGAGTTGAGGACTGTGG - Intergenic
950441564 3:13013900-13013922 AGGTGAGGACATGAGGCCTCAGG + Intronic
951641445 3:24840475-24840497 AGTTTTGGACTTGATGCCTAAGG + Intergenic
952255554 3:31692242-31692264 AGCTGAGGAATTGAGTCCTGGGG - Intronic
954093119 3:48301198-48301220 AGTTGAGGCCGTGAGCCCGGGGG - Intronic
955360967 3:58274652-58274674 AGTTGAGTACTGCAGGCCTGTGG - Exonic
955949469 3:64227645-64227667 GGTCTATGACTTGAGGCCTGAGG + Intronic
956129050 3:66037865-66037887 AGTTGAGGCCGTGCGCCCTGTGG - Intronic
956281638 3:67563366-67563388 AGTTGAGGACTTGAAACTTAGGG - Intronic
962234865 3:133699282-133699304 AGATAAGGACTAGAGGCCTCAGG - Intergenic
965507950 3:169536716-169536738 AGCTGAGGTCTTGAAGCATGAGG - Intronic
967033597 3:185631311-185631333 GGTTTAGGACATGGGGCCTGTGG + Exonic
970892206 4:21059550-21059572 AGTTGGGGACCTAAGTCCTGGGG + Intronic
971312098 4:25534174-25534196 AGTGGATCACTTGAGGCCAGGGG + Intergenic
972202844 4:36736249-36736271 AGTGGATCACTTGAGGCCAGGGG - Intergenic
972226504 4:37018977-37018999 ATCTGAGAACTTGAGGCCAGGGG + Intergenic
973945296 4:55948994-55949016 AGTGGGGGACTCGAGGCCTGAGG + Exonic
975404097 4:73969228-73969250 AGTTGGGGACTTGGGGGTTGAGG - Intergenic
975900153 4:79141582-79141604 TGTTGAGGCAGTGAGGCCTGCGG + Intergenic
977459961 4:97312632-97312654 AGATGCGGACTTGTGGCCAGGGG - Intronic
981185738 4:141800534-141800556 ATTTGAGGTCTGGAAGCCTGGGG - Intergenic
985129627 4:186726659-186726681 AGTTGAGGAGTTGCGGCCGCCGG + Intronic
988478358 5:31608188-31608210 AGTTAAGGGCTTCAGGCCTTGGG + Intergenic
990809747 5:59709633-59709655 CCTTGAGCACTTGAGCCCTGAGG - Intronic
991116159 5:62957924-62957946 AGTGGTGGCCTTGAGGTCTGTGG + Intergenic
992007115 5:72488873-72488895 AGCTGAGGAATTGAGGCTTAGGG - Intronic
993135502 5:83956385-83956407 AGTTGTGAAGTGGAGGCCTGGGG - Intronic
993557285 5:89356231-89356253 AGTTCAAGTCTTGATGCCTGAGG - Intergenic
995061352 5:107814506-107814528 AGATCAGGGCTTGAGTCCTGAGG + Intergenic
996091103 5:119352833-119352855 AGTTGAGTTCTTTAGGTCTGTGG + Intronic
997383156 5:133451722-133451744 AGATGAGAAACTGAGGCCTGGGG + Intronic
997722509 5:136090597-136090619 AGTTGAGGATTTAAGACCTGTGG + Intergenic
1001527045 5:172436505-172436527 AGTTAGGGACATGAGGCCAGAGG + Intronic
1002057483 5:176606915-176606937 AGTTGGGGACGGGAAGCCTGGGG - Intronic
1002400625 5:178989896-178989918 AGTTGGTGACTTTAGGCATGGGG - Intronic
1003399089 6:5776772-5776794 AATTGAGAACATGAGGCCCGAGG + Intergenic
1005419937 6:25638707-25638729 AATAGAGGACTTGAGGTTTGCGG - Intergenic
1005597732 6:27395152-27395174 ATGTGAGGACTTGAGACTTGGGG + Intronic
1006435470 6:34023803-34023825 AGATGAGGAACTGAGGCCAGAGG + Intronic
1006844802 6:37054801-37054823 AGTTGAGGAGAGGAGCCCTGTGG - Intergenic
1006944922 6:37778676-37778698 AGATGAGGTCTGTAGGCCTGTGG - Intergenic
1007701432 6:43768692-43768714 AGTTGGGGCTCTGAGGCCTGTGG - Intergenic
1008035453 6:46740586-46740608 ACTTAAGGACTTGAGAACTGTGG + Intergenic
1012025147 6:93980092-93980114 AGTGGAGCTCTTGAGGCATGGGG + Intergenic
1014625586 6:123720893-123720915 AGTTAAGGATTAGAGGCATGGGG + Intergenic
1018868903 6:167766591-167766613 AGGTGAAGACTTGAGGTCTCGGG - Intergenic
1018920395 6:168168328-168168350 AGCTGGGACCTTGAGGCCTGGGG + Intergenic
1019225581 6:170504937-170504959 AGTTCTGGACATGTGGCCTGTGG + Intergenic
1019605610 7:1908685-1908707 TGCTGAGCACTTGAGACCTGAGG - Intronic
1019747236 7:2707769-2707791 GGGTGAGAACGTGAGGCCTGAGG - Intronic
1022048589 7:26643569-26643591 AGGTGAGAACCTGGGGCCTGGGG + Intronic
1023914202 7:44576346-44576368 TGTTGTGGACTTCTGGCCTGAGG - Intergenic
1027424795 7:78051808-78051830 GGTGGATGACTTGAGGCCAGGGG - Intronic
1027775210 7:82456400-82456422 ACTTGAGGGCCTGAGGCCGGAGG - Intergenic
1031522963 7:122788852-122788874 AGTTGAGGACTTAAGCCCTGAGG - Intronic
1031663586 7:124457358-124457380 AGTTGAAGACATGAGACCAGAGG - Intergenic
1032218709 7:129977811-129977833 GGTAGAGGCCTTGGGGCCTGGGG + Intergenic
1032690029 7:134276544-134276566 AATTGAGGACTTGAGGCTAGAGG - Intergenic
1035020428 7:155797277-155797299 AGCCGTGGACTTGGGGCCTGGGG - Intergenic
1035020462 7:155797362-155797384 AGCCGTGGACTTGGGGCCTGGGG - Intergenic
1035246875 7:157568288-157568310 AGTCTTAGACTTGAGGCCTGTGG - Intronic
1035467403 7:159088807-159088829 AGATGAGGAACCGAGGCCTGAGG - Intronic
1035467412 7:159088845-159088867 AGATGAGGAGCTGAGGCCTGAGG - Intronic
1035467422 7:159088883-159088905 AGATGAGGAGCCGAGGCCTGAGG - Intronic
1035467430 7:159088921-159088943 AGATGAGGAGCCGAGGCCTGAGG - Intronic
1035467438 7:159088959-159088981 AGATGAGGAGCCGAGGCCTGAGG - Intronic
1035467446 7:159088997-159089019 AGATGAGGAGCCGAGGCCTGAGG - Intronic
1035467454 7:159089035-159089057 AGATGAGGAGCCGAGGCCTGAGG - Intronic
1035467462 7:159089073-159089095 AGATGAGGAGCCGAGGCCTGAGG - Intronic
1035467470 7:159089111-159089133 AGATGAGGAGCCGAGGCCTGAGG - Intronic
1035467478 7:159089149-159089171 AGATGAGGAGCCGAGGCCTGAGG - Intronic
1035467486 7:159089187-159089209 AGATGAGGAGCCGAGGCCTGAGG - Intronic
1035467494 7:159089225-159089247 AGATGAGGAGCCGAGGCCTGAGG - Intronic
1035467502 7:159089263-159089285 AGATGAGGAGCCGAGGCCTGAGG - Intronic
1035467510 7:159089301-159089323 AGATGAGGAGCCGAGGCCTGAGG - Intronic
1035467518 7:159089339-159089361 AGATGAGGAGCCGAGGCCTGAGG - Intronic
1035467526 7:159089377-159089399 AGATGAGGAGCCGAGGCCTGAGG - Intronic
1035467534 7:159089415-159089437 AGATGAGGAGCCGAGGCCTGAGG - Intronic
1035467542 7:159089453-159089475 AGATGAGGAGCCGAGGCCTGAGG - Intronic
1037957741 8:23071924-23071946 AGTGGAGGACATGTGCCCTGGGG - Intergenic
1038116160 8:24558076-24558098 GGTTGATCACTTGAGGCCAGGGG - Intergenic
1038338044 8:26661346-26661368 TGTTGAGGCCATGAGGCGTGGGG + Intergenic
1038779455 8:30557678-30557700 AGTGGAGAAGGTGAGGCCTGTGG - Intronic
1044541383 8:93412038-93412060 AGATGAGCAATTGAGGTCTGTGG - Intergenic
1047665489 8:127086856-127086878 GGTGGAGGACTTGAGGTCTGAGG + Intergenic
1048591197 8:135822209-135822231 AATGAATGACTTGAGGCCTGTGG + Intergenic
1049309875 8:141928142-141928164 AGTGGAGGCCTGCAGGCCTGGGG + Intergenic
1049985617 9:948164-948186 AGTGGGGAGCTTGAGGCCTGTGG + Intronic
1050694324 9:8261932-8261954 AATGGAAGGCTTGAGGCCTGGGG + Intergenic
1051514733 9:17916144-17916166 AGCAGACCACTTGAGGCCTGGGG - Intergenic
1051661635 9:19432506-19432528 AGTTGAGTAGTTGAGACCTTAGG + Intronic
1058618402 9:106860372-106860394 AGTCGGGGAATTGAGCCCTGGGG - Intergenic
1059627699 9:116085192-116085214 ATTTGTGGATTTGAGGCCAGAGG + Intergenic
1061423860 9:130487045-130487067 AAATGAGAACCTGAGGCCTGGGG - Intronic
1062283768 9:135763899-135763921 AGTGGGGGACGTGAGCCCTGGGG + Intronic
1062464695 9:136675825-136675847 AGCTAAGGCCGTGAGGCCTGGGG - Intronic
1203669452 Un_KI270754v1:37973-37995 AGCTGAGGACAGGAGCCCTGGGG - Intergenic
1186463269 X:9765325-9765347 GGCTGAGGGCTTGAGGCCCGCGG - Intronic
1186636990 X:11416998-11417020 AGTTGAGGGTTTGAGGGTTGTGG - Intronic
1189522319 X:41782917-41782939 GGTTGATCACTTGAGGCCAGGGG + Intronic
1192216003 X:69158537-69158559 AGTACAGGTCTTGGGGCCTGTGG + Intergenic
1194613722 X:96075448-96075470 TGTTGAGGGGTGGAGGCCTGGGG - Intergenic
1195220257 X:102739544-102739566 CTCTGAGGACTTGGGGCCTGGGG + Intronic
1195712765 X:107787672-107787694 TGTTGAGGACTGGAACCCTGTGG - Intronic
1198474641 X:136983627-136983649 AGTGGAGGACTTGAGGTCTGAGG + Intergenic
1199745502 X:150769773-150769795 AGTTGGGCACTCTAGGCCTGTGG + Intronic
1200255700 X:154581446-154581468 AGTGGAGGACTGGACCCCTGGGG - Intergenic
1200262069 X:154622958-154622980 AGTGGAGGACTGGACCCCTGGGG + Intergenic
1200374895 X:155769264-155769286 AGTTGAGGAGTTGAGTAGTGAGG + Intronic