ID: 1166593916

View in Genome Browser
Species Human (GRCh38)
Location 19:44027602-44027624
Sequence CAGGGGCATCAGCAGGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 714
Summary {0: 1, 1: 0, 2: 7, 3: 66, 4: 640}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166593916_1166593928 13 Left 1166593916 19:44027602-44027624 CCTTCTCCCTGCTGATGCCCCTG 0: 1
1: 0
2: 7
3: 66
4: 640
Right 1166593928 19:44027638-44027660 CACCCTGCCATCTGTTCTTACGG 0: 1
1: 0
2: 0
3: 13
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166593916 Original CRISPR CAGGGGCATCAGCAGGGAGA AGG (reversed) Intronic
900325851 1:2108318-2108340 CACGCCCATCAGCATGGAGAAGG - Intronic
900618877 1:3577951-3577973 CCGGGGCATCGGCAGGCACAGGG - Intronic
900803970 1:4755415-4755437 CAGAGCCAGCAGGAGGGAGACGG - Intronic
900903694 1:5535493-5535515 CATGGGCATGAGCAGGGATAAGG + Intergenic
901180269 1:7336819-7336841 CGGGGCCAGCAACAGGGAGAAGG + Intronic
901481702 1:9529675-9529697 CAGGGGCATCACCATGGATGTGG - Intergenic
902410337 1:16208274-16208296 CAGGGGCAGCAGCAGGGAGGAGG - Intronic
902960912 1:19962247-19962269 CATGGGCATCAGCAGGTAGAGGG + Intergenic
903325692 1:22567426-22567448 CAGGGGCAGAGGCAGAGAGAAGG - Intronic
904354576 1:29930760-29930782 CAGGGACAGCTGTAGGGAGAGGG - Intergenic
904832878 1:33316593-33316615 CAGGGGCAACACCAGGGAGTTGG + Intronic
904849055 1:33443486-33443508 CAGGGAGAACAGCAGGTAGAGGG + Intergenic
904858019 1:33514613-33514635 GAGGGGCATAAGAAGGGGGAAGG + Exonic
904914394 1:33959608-33959630 CAAGGGCAGCAGGAGGGAGAGGG - Intronic
905274383 1:36807544-36807566 CTGGGGCATGGGCAGGGGGATGG + Intronic
905851768 1:41280036-41280058 CAGGGGCATCTGCAGGAGAAGGG - Intergenic
906209283 1:44003153-44003175 CAGGGGCTGCAGCAGGTGGAGGG - Intronic
906476626 1:46173637-46173659 CAGAGGCAGCAGCAGCCAGAGGG - Intronic
906726726 1:48049737-48049759 CTGGGGCTTCAGCAGTCAGAAGG - Intergenic
906738296 1:48154139-48154161 CAGGGGAATCAGGCAGGAGAAGG + Intergenic
907256565 1:53183472-53183494 CAGGGGCAACATCAGAGACAGGG + Intergenic
907313807 1:53554831-53554853 AAGTGGCCTCAGCAGGGACAGGG - Intronic
907524501 1:55046380-55046402 CCGGGGCACTAGCAGGGACAAGG + Intronic
907646089 1:56244994-56245016 CAGGGCAATCAGGCGGGAGAGGG - Intergenic
907894366 1:58671414-58671436 ATGGGGCATCTGCAGGAAGAGGG + Intronic
908925433 1:69249067-69249089 CAGGGGCATTGGCATGGAAAAGG - Intergenic
910728237 1:90360883-90360905 CTGGGGCTTCAGCCGGGAGCAGG - Intergenic
911201755 1:95051450-95051472 GAAGGGCAAAAGCAGGGAGAGGG - Intronic
912190976 1:107339989-107340011 CTGTGGCAACAGCAGGGAGGAGG + Intronic
912274400 1:108241034-108241056 CAGGGTCATCAGGAGTGAGGAGG + Exonic
912286867 1:108378828-108378850 CAGGGTCATCAGGAGTGAGGAGG - Intronic
912293819 1:108453289-108453311 CAGGGTCATCAGGAGTGAGGAGG - Exonic
912499769 1:110114140-110114162 CAGGGGCTTCAGCAGTGAATGGG - Intergenic
912540647 1:110412469-110412491 CTGGGCCAGCAGCAGTGAGATGG - Intergenic
912549939 1:110479055-110479077 CAGGGCCATCAGCATGGGGCAGG + Intergenic
913673319 1:121118200-121118222 CAGCCGCATCCGCGGGGAGAGGG - Intergenic
915051933 1:153084330-153084352 AATGGCCATCACCAGGGAGAAGG - Intergenic
915166713 1:153952045-153952067 CCTGGGCATCAGCAGGGGCATGG - Exonic
916885345 1:169061896-169061918 GAGGGGCAGGAGGAGGGAGAGGG + Intergenic
917504574 1:175616230-175616252 CAGGGCCATGAGCAGGGTGAAGG - Intronic
920199711 1:204252082-204252104 GAGGGGCAGGGGCAGGGAGAGGG - Intronic
920960949 1:210663657-210663679 TAGGGGAATCTGCAGGGGGAAGG - Intronic
921189845 1:212699665-212699687 CAGCCGCAGCAGCAGGTAGAGGG - Exonic
921924908 1:220703388-220703410 CAGGAGCAGCAGGAGAGAGAGGG + Intergenic
922237245 1:223731412-223731434 CAGGGGCACTTTCAGGGAGAGGG - Intronic
923080197 1:230646043-230646065 CAGGGTCCTGAGAAGGGAGAGGG - Intronic
923336000 1:232970875-232970897 CATGGGCATCACCTGGGAGTGGG + Intronic
924384641 1:243489838-243489860 CGGGGCCACCAGCAGGGAAAAGG + Intronic
924465360 1:244294510-244294532 CAGGGGCCTGAGCACAGAGAAGG - Intergenic
924473916 1:244367159-244367181 CAGGGGCTGGAGCTGGGAGAAGG + Intronic
924643756 1:245857971-245857993 CAGGGAGGACAGCAGGGAGACGG - Intronic
924816987 1:247451338-247451360 CAGGGGCACCAACACGAAGAAGG + Exonic
1064326507 10:14356177-14356199 CAGTAGCATCAGGAGAGAGAAGG + Intronic
1065203461 10:23336093-23336115 CAGGGGCAGCAGCACAGAGGTGG + Intronic
1066620639 10:37345510-37345532 CTGGGGCATGAGCAGGGAGTGGG - Intronic
1066623900 10:37386041-37386063 CTGGGGCATGAGCAGGGAGAGGG - Intergenic
1067682050 10:48447613-48447635 CAGGGGCAGCAGTGGGGAGGTGG - Intronic
1068832081 10:61507215-61507237 CATGGGGCTAAGCAGGGAGATGG + Intergenic
1068946859 10:62738436-62738458 AAGGGGCAGCTGCATGGAGAAGG + Intergenic
1069110270 10:64438355-64438377 CAGGGCAATCAGCCAGGAGAAGG - Intergenic
1069524320 10:69154197-69154219 CAGGGGATTCAGCAGGTAAATGG + Intronic
1069537354 10:69264716-69264738 CAGGGGATTCAGCAGGTAAATGG - Intronic
1069611534 10:69775839-69775861 CTGGGGGATCAGCTGGGAGTAGG + Intergenic
1069774603 10:70919181-70919203 GAGGAGGATCAGCAGAGAGAGGG - Intergenic
1069926182 10:71852316-71852338 CAGGGGCAGCCACAGGCAGAGGG - Intergenic
1070161307 10:73868258-73868280 CAGAGGAAGCAGCAGGAAGAAGG + Intronic
1070688967 10:78510754-78510776 CAGGGGCAGCTGCAGGCAGGAGG - Intergenic
1070825147 10:79386450-79386472 CAGGGGTCTCTGCAGAGAGAAGG + Exonic
1071074966 10:81739049-81739071 CAGGGCAATCAGGCGGGAGAAGG + Intergenic
1071339911 10:84636112-84636134 CAGAGTCATCAGCAGCAAGAAGG + Intergenic
1071495031 10:86162322-86162344 CCTGGGCCTCAGCAGGGACACGG - Intronic
1072434785 10:95405115-95405137 CATTGGCATCACCAGGGAGCTGG + Intronic
1072817873 10:98527459-98527481 CAGGGGCCTTAGAAGGGAGAGGG - Intronic
1073091132 10:100940773-100940795 CAGGGGCAGGAGCAGGGGCAGGG - Intronic
1073096311 10:100982210-100982232 CAGAGGGAGCAGCAGGCAGAGGG + Intronic
1073143170 10:101262231-101262253 CTGAAGCATCAGGAGGGAGAGGG - Intergenic
1074241230 10:111641226-111641248 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1074859506 10:117499648-117499670 CAGGGGCCTGGGCTGGGAGATGG + Intergenic
1075093709 10:119457608-119457630 CTGGGGACTCAGTAGGGAGAAGG - Intronic
1076564094 10:131386487-131386509 CAGAGGGAGGAGCAGGGAGAGGG + Intergenic
1076608867 10:131707915-131707937 CAGGGGGATCAGTGGGCAGAGGG + Intergenic
1076666970 10:132098751-132098773 CAGGGGCATTTGCAGTGAGGAGG + Intergenic
1076802198 10:132835916-132835938 CAGGGGCAGGAGCAGGGGGAGGG - Intronic
1077235844 11:1481703-1481725 CAGGGGCAGGAGCAGGGGCAGGG + Intronic
1077278306 11:1728368-1728390 GAAGGGCATCTGCGGGGAGATGG - Intergenic
1077349629 11:2086450-2086472 CAGGGGACTCAGCAGGTGGACGG + Intergenic
1077413496 11:2414145-2414167 CCGGCGCACCAGCAGGGCGAAGG + Exonic
1077556453 11:3228332-3228354 CAGGTGCAGCAGCAGGCAGAGGG + Exonic
1078487233 11:11734966-11734988 CAGGGTATTCAACAGGGAGAAGG + Intergenic
1078652411 11:13207900-13207922 AAGGGCAATCAGCAGGCAGAAGG - Intergenic
1078920049 11:15821867-15821889 GCGGGGCAGCAGCAGGGAAAAGG - Intergenic
1079030634 11:16983722-16983744 CTTGGGAATGAGCAGGGAGAAGG - Intronic
1079094700 11:17502798-17502820 CAGGGGCATCCCCAGGCTGAGGG + Intronic
1079107018 11:17578291-17578313 CAGGGGCAGCAGCTGGAGGATGG - Intronic
1080394208 11:31875063-31875085 CAGGAGCAGCAGGAGGGGGAAGG - Intronic
1080533420 11:33198680-33198702 CCGGGGCTTCATGAGGGAGAGGG - Intergenic
1080931624 11:36817411-36817433 CAAGGGAATCAGTGGGGAGATGG - Intergenic
1081993654 11:47350565-47350587 CAGTGGCCTCAGCAGGGGCAGGG + Exonic
1082273336 11:50195735-50195757 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1082599942 11:55136839-55136861 CAGGGCCATCAGGCAGGAGAAGG + Intergenic
1082809045 11:57467621-57467643 CAGGAGCATCAGCAGGAGGCAGG - Exonic
1083427790 11:62597726-62597748 CAATGGCATCAACAGGGAGAGGG + Intronic
1083803170 11:65058275-65058297 CAGGGCCAGCATCAGGGAGGGGG + Intronic
1083870070 11:65481769-65481791 CAGCAGCATCAGCAGAGAGTGGG + Intergenic
1084088376 11:66865158-66865180 CTGTGGCTTCAGCAGGGAGCTGG - Intronic
1084166008 11:67375035-67375057 CAGGGGCACCAGGAAGGAGTGGG - Intronic
1084413660 11:69018084-69018106 GAGGGGTCTCAGCAGGGAGGTGG - Intergenic
1084943908 11:72628833-72628855 CAGGGGCAGCTGGAGGGAAAAGG - Intronic
1085258920 11:75193254-75193276 CAGGACCACCAGCAGGAAGATGG - Exonic
1085643918 11:78210338-78210360 CAGGCGGAGCAGCAGGGGGATGG - Exonic
1087542157 11:99533552-99533574 TGGGGGCTTCAGTAGGGAGAAGG + Intronic
1087949636 11:104204871-104204893 AAGGAGGATCAGAAGGGAGAAGG - Intergenic
1088501395 11:110486851-110486873 CAGGGCCAGCTGGAGGGAGAGGG + Intergenic
1089165670 11:116474281-116474303 AGGGGGGATCAGGAGGGAGAAGG - Intergenic
1089283124 11:117388233-117388255 CAGGGGCCTCGGGAGAGAGATGG - Intronic
1089292157 11:117443910-117443932 CCGGGGCAACAGCAGCGAGAAGG - Exonic
1089339562 11:117748404-117748426 AAGTGCCATCAGAAGGGAGAGGG - Intronic
1089590825 11:119539675-119539697 AGGTGACATCAGCAGGGAGATGG - Intergenic
1090402571 11:126458493-126458515 CTTGGGCACCAGCAGGAAGAGGG - Intronic
1090606123 11:128424552-128424574 GAGGGGCAGCACCAGGGGGAAGG + Intergenic
1091483906 12:865144-865166 CAGAGGCAACAGCAGAAAGATGG - Intronic
1091784797 12:3236770-3236792 CAGGTTCAGCAGGAGGGAGAGGG + Intronic
1093243134 12:16702094-16702116 CTGGGACAGCAGGAGGGAGAGGG + Intergenic
1094555751 12:31497918-31497940 CAGGGGCAAGGGCAGGGGGAGGG + Intronic
1095047249 12:37521171-37521193 CAGGGGCTTGAGCAGAGGGAAGG + Intergenic
1095116112 12:38354175-38354197 CAGGGGAATCAGGTAGGAGAAGG - Intergenic
1095946779 12:47758333-47758355 CAGGGGCATGGGCAGTGAGATGG - Intronic
1096785100 12:54012818-54012840 CAGGGGGATAAGGAGAGAGAAGG - Intronic
1098064133 12:66594170-66594192 GAGGGGCCTCTGCATGGAGAAGG + Intronic
1099549266 12:84022797-84022819 CAGGGCCATCAGGCAGGAGAAGG + Intergenic
1100194307 12:92226949-92226971 CAGGGACAACACCAGGGAGATGG - Intergenic
1100449926 12:94696063-94696085 GAGGAGCAGCAGCAGGGGGAAGG + Intergenic
1100482786 12:94995340-94995362 CAGGGGAATGTGCAGGCAGATGG + Intronic
1101272446 12:103162036-103162058 CTGGGGCATTAGGAGGGAAAAGG - Intronic
1101520936 12:105481778-105481800 CAGTAGCATCAGCTGGGAGCTGG - Intergenic
1101850497 12:108398125-108398147 CTGGAGCATCATGAGGGAGAGGG + Intergenic
1101997584 12:109535949-109535971 CAGGAGCATGAGGTGGGAGAGGG - Exonic
1102438918 12:112946703-112946725 CAGGGGACTCAGAAGGAAGAAGG - Intronic
1102517044 12:113456689-113456711 CAGTGGCATCACCTGGGAGCTGG - Intergenic
1103329496 12:120144344-120144366 CTGGGGCAGCAGCAGGGCGATGG + Exonic
1103568295 12:121828094-121828116 CAGGGGCAGGAGCAGGGGCAGGG - Intronic
1103685671 12:122730280-122730302 CGGCGGCATCACCTGGGAGATGG + Exonic
1103725988 12:122997612-122997634 GAGGGGCCTCAGCAAGGAGCTGG - Intronic
1103883509 12:124184361-124184383 CAGGGTCACCAGAAAGGAGAGGG - Intronic
1105387384 13:19943955-19943977 GAGGGGAATGAGAAGGGAGATGG + Intergenic
1105465000 13:20631719-20631741 AAGGGGCATTTGTAGGGAGAAGG + Intronic
1105771606 13:23617357-23617379 CAGGGGGAGCACCAGGGAGGAGG + Intronic
1106304416 13:28496613-28496635 CTGGGGGACCAGCAAGGAGAAGG - Intergenic
1107564728 13:41590174-41590196 CATGGGCAACAGCAGAGAGGGGG - Intronic
1107985171 13:45769607-45769629 CAGTGGCAGCAGCACAGAGAGGG - Intergenic
1108322622 13:49302864-49302886 CAGGGGCATCAGCAGAGCTGGGG + Intergenic
1108921122 13:55675575-55675597 GAGGGGCAGCAGCAGGCAGTTGG + Intergenic
1110949033 13:81461571-81461593 CAGGGCAATCAGCCAGGAGAAGG - Intergenic
1111337404 13:86840910-86840932 CAGGGCCATCAGCTGGGAGAGGG - Intergenic
1112776232 13:102846431-102846453 CAGTGGCATCTGCAGGATGATGG + Intronic
1113046403 13:106159827-106159849 CAGGCGCAACAGCAGGCAGTTGG + Intergenic
1113811393 13:113144504-113144526 CAGGGGCATCAGCGGGCAGGAGG + Intronic
1113834483 13:113319663-113319685 CTGGGGCCTCACCTGGGAGAGGG + Intronic
1113890373 13:113732254-113732276 CAGGGAAGTCAGAAGGGAGAGGG - Intronic
1114544188 14:23486491-23486513 CAGGAGCTCCAGCGGGGAGATGG - Intronic
1115514875 14:34175097-34175119 CAGGTGCAGCAGCAGGTAAAGGG + Intronic
1117340948 14:54790609-54790631 CAGAGGCAAGATCAGGGAGATGG + Exonic
1117454522 14:55884070-55884092 CAGGGGTATCAGGAGGGAGGAGG + Intergenic
1117718118 14:58601442-58601464 CAGTGGCATCAACTGGCAGATGG - Intergenic
1117964423 14:61191953-61191975 CAGGGTCATTGGCAGGGAGATGG + Intronic
1118633161 14:67724548-67724570 CACGGGCATTGGCAAGGAGACGG + Exonic
1118723237 14:68608898-68608920 GAGGGGCCACAGCATGGAGAAGG - Intronic
1118755714 14:68842376-68842398 CAGTGGGAGCAGCAGAGAGAAGG - Intergenic
1118952013 14:70443494-70443516 CAAGGTCATCAGCAGGCTGAGGG + Intergenic
1119217385 14:72879546-72879568 CAAGGGCTCCACCAGGGAGAGGG + Intronic
1119662082 14:76459367-76459389 ATGGGTTATCAGCAGGGAGAAGG + Intronic
1119744448 14:77033992-77034014 CCTGGGCCTCAGCAGGGAGTAGG + Intergenic
1119881916 14:78106405-78106427 AACTGGCATCAGGAGGGAGAGGG + Intergenic
1119902527 14:78273573-78273595 CAGGAGCATCCACAGGCAGAGGG - Intronic
1120567337 14:86076486-86076508 CAGGGCAATCAGCCAGGAGAAGG - Intergenic
1120570161 14:86107457-86107479 CAGGGCAATCAGCCAGGAGAAGG - Intergenic
1120932574 14:89864362-89864384 CATGGGCATCAGCAAACAGATGG - Intronic
1120971713 14:90213473-90213495 AAGGAGCCCCAGCAGGGAGAGGG - Intergenic
1121079361 14:91095308-91095330 TAGGGGCACCAGGAGGGAGGAGG + Intronic
1121417864 14:93791335-93791357 CAGGGGCGTCAGCAGGATGTGGG - Intergenic
1122117512 14:99535244-99535266 CAGTGGGAAAAGCAGGGAGAGGG + Intronic
1122268666 14:100558521-100558543 TGGGGGCCTCAGCAGAGAGATGG - Intronic
1122283274 14:100636741-100636763 CAGGGGAAGGAGCAGGGAGTGGG - Intergenic
1122537059 14:102472842-102472864 CAGGGGCAGCACCTGGGAGCTGG - Intronic
1122652398 14:103232709-103232731 CAGTGGGAGCAGCAGGGGGATGG + Intergenic
1122695251 14:103549273-103549295 CAGAGACAGCAGAAGGGAGAGGG + Intergenic
1123126757 14:105952445-105952467 CAGGGGCATATGCAGAGAGAGGG - Intergenic
1123164773 14:106315675-106315697 CCTGGGAAGCAGCAGGGAGAGGG - Intergenic
1202915737 14_GL000194v1_random:170433-170455 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1202877011 14_KI270722v1_random:12611-12633 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1123443689 15:20306795-20306817 CAGGGGCAGGGCCAGGGAGAAGG - Intergenic
1124241142 15:28028534-28028556 CAGAAGCATGAGCAGGAAGAGGG + Intronic
1124516661 15:30372181-30372203 CAGGAACACCAGCAGGGCGAGGG + Exonic
1124726258 15:32158550-32158572 CAGGAACACCAGCAGGGCGAGGG - Exonic
1124904636 15:33857299-33857321 CAGGGGAAGCGGCAGCGAGAGGG - Intronic
1125751722 15:42033751-42033773 GCGGGGCGGCAGCAGGGAGAGGG - Intronic
1125791956 15:42373779-42373801 CAGGGACATCAGGAGTGTGAAGG + Intronic
1127904747 15:63368351-63368373 CAGGGGCAACTGCTGGGCGAAGG - Intronic
1127959269 15:63878964-63878986 AAAGGACAGCAGCAGGGAGAAGG + Intergenic
1128210604 15:65898346-65898368 CAGGGACATAAACTGGGAGAAGG + Intronic
1129697804 15:77750498-77750520 AAGAGGCAACAGCAGGGAGAAGG - Intronic
1129718945 15:77867174-77867196 GAGGGGCAGCAGGAGGGTGAAGG - Intergenic
1130014208 15:80174780-80174802 AAGGGGCATCAGCAGGTCAAAGG - Intronic
1130459986 15:84153679-84153701 GAGGGGCAGCAGGAGGGTGAAGG + Intergenic
1130887326 15:88104777-88104799 CATTGGCATCAGCAGGGAGATGG + Intronic
1130937837 15:88485267-88485289 GGGGGGCATCGGCAGGGAGCGGG - Intergenic
1131034303 15:89211038-89211060 AATTTGCATCAGCAGGGAGAGGG - Intronic
1131177898 15:90221299-90221321 CTGGGCCCTGAGCAGGGAGAAGG + Intronic
1131382218 15:91973468-91973490 CAGATGCAACAGCAGGAAGAAGG + Intronic
1132643771 16:989588-989610 CAGGGGCATCAGGCAGGTGATGG + Intergenic
1132661496 16:1063379-1063401 GAGGGGGATCAGCAGGGGAAGGG + Intergenic
1134081025 16:11325083-11325105 CAGGGGGAAGAGCAGGCAGAAGG + Intronic
1134195188 16:12154370-12154392 CAGGGGTGTCAGAGGGGAGAGGG - Intronic
1134833374 16:17341953-17341975 CAAGGGCAAGAACAGGGAGATGG - Intronic
1135899026 16:26439190-26439212 CAGGGACATCTGCAGATAGAAGG - Intergenic
1137004093 16:35256012-35256034 CAGGAACAGCAGCAAGGAGAGGG - Intergenic
1137503798 16:49032835-49032857 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1137591062 16:49694191-49694213 AAGGGGGAGCAGGAGGGAGAGGG + Intronic
1138187289 16:54986515-54986537 GAGGGGCCTCAGCTGGGAGTTGG - Intergenic
1138350609 16:56344488-56344510 CAGGGGAGGGAGCAGGGAGACGG - Exonic
1138396533 16:56708976-56708998 CACTGGCAACAGCAGGGGGATGG + Intronic
1138505586 16:57476758-57476780 CAGGGGCATCAGCAGTGGCCAGG - Intronic
1139592929 16:67943364-67943386 CTGGGGGGACAGCAGGGAGAGGG - Intronic
1139967635 16:70754552-70754574 CAGGGACAGCCGCGGGGAGAGGG + Intronic
1140183217 16:72741575-72741597 CAGTGGCATAAGCTGGGGGAGGG - Intergenic
1140608117 16:76565017-76565039 CAGGGAGATCTGCAGGGAAAAGG - Intronic
1140847558 16:78904912-78904934 CAGGGGCACCAACTGGGAAAAGG - Intronic
1141878459 16:86842253-86842275 CAGGGCCAGAAGCAGGGTGAGGG + Intergenic
1142139330 16:88465720-88465742 CAGGTGCAGCAGCAGGGCCAGGG - Intronic
1142572146 17:881969-881991 CAGGGGACTGTGCAGGGAGATGG + Intronic
1143367819 17:6420004-6420026 CAGGGCCACCTGCTGGGAGAAGG - Intronic
1143632560 17:8147376-8147398 GACGGGCTGCAGCAGGGAGAGGG + Exonic
1143843940 17:9757721-9757743 TAGGAGCTTCAGCAGAGAGAAGG + Intergenic
1143902486 17:10184583-10184605 CAGTGGCATCACCTGGGAGCTGG + Intronic
1143993351 17:10986000-10986022 CAGTGCTATCAGCAGGGATAAGG + Intergenic
1144759897 17:17701262-17701284 CAGGGCCATCCCCAGGGAGATGG - Intronic
1144849865 17:18238616-18238638 CAGGGGCAGGGGCAGGGACAGGG + Intronic
1145056650 17:19707658-19707680 CAGGGTGGTCAGCAGGCAGAGGG - Intronic
1145841176 17:27996181-27996203 CAGGGTCAGGAGCAGGTAGAAGG + Intergenic
1146554505 17:33812178-33812200 CAGAGGGATCAGCAGGGTGACGG + Intronic
1147188366 17:38725053-38725075 CAGGTACCTCAGCAGGGGGAAGG + Intronic
1147424389 17:40339100-40339122 CAAGGGCCTCAGCAGGAAGCAGG - Intronic
1147586626 17:41656877-41656899 CAGGGCCACCAGCAGGGCCAGGG - Intergenic
1147689933 17:42308792-42308814 CAGGGGTGGGAGCAGGGAGAGGG + Intronic
1148032107 17:44628535-44628557 CAGGGGCAGCGGCAGGGGCAGGG + Intergenic
1148231142 17:45935721-45935743 CAGGGCCATCATCAGGCAAAGGG - Intronic
1148343486 17:46888131-46888153 TGGGAACATCAGCAGGGAGAAGG + Intergenic
1148598770 17:48878262-48878284 CAGAGCCCTCAGCAGGAAGAGGG + Intergenic
1148647947 17:49230089-49230111 CAGGGGCAGGGGCAGGGAGGTGG + Intronic
1148835061 17:50461570-50461592 GAGGGGCAGCAGGAGGGACAGGG + Intronic
1148850761 17:50553990-50554012 CAGAGGCATCAGCAGCGAGGAGG + Intronic
1149132174 17:53316122-53316144 CAGGGGAGTCAGAAGGGAGATGG + Intergenic
1150210163 17:63437473-63437495 CAGGCCCAGCAGCTGGGAGAAGG + Exonic
1151309517 17:73284947-73284969 CAGCTGCAGCAGGAGGGAGACGG - Exonic
1152015612 17:77748604-77748626 CAGGGGCCTCTGCATGGAGTGGG - Intergenic
1152125879 17:78446364-78446386 CAGGGGCATCCCTAGGCAGAAGG - Intronic
1152199398 17:78936267-78936289 CATGGACGTCAACAGGGAGAGGG + Intergenic
1152206580 17:78977555-78977577 CACGGGCATGGGCGGGGAGATGG + Intronic
1152320446 17:79606079-79606101 CAGGGGCAGCAGCAGTGAGAAGG + Intergenic
1152630320 17:81408080-81408102 CAGGGGCAGCAGGAGGAAGGGGG - Intronic
1152676745 17:81645212-81645234 CAGCAGCCCCAGCAGGGAGAAGG - Exonic
1152703567 17:81831833-81831855 CATGGGTATCAGTAGGGAGTGGG - Intronic
1153945816 18:10016282-10016304 CAGGAGCATCTGCAGGAAGCAGG + Intergenic
1153947338 18:10029470-10029492 CAGGGACATCAGCTGGGCCATGG + Intergenic
1154492922 18:14934848-14934870 CAGGGGCTGCAGGAGAGAGAGGG + Intergenic
1155054220 18:22170649-22170671 GAGGGGCATCCGCAGAGAGGCGG + Intronic
1156035385 18:32760879-32760901 CAAGGGCATCAGAAGGAAGTGGG - Intronic
1156497527 18:37535964-37535986 CAGGGGCGTGGGGAGGGAGATGG - Intronic
1156499742 18:37550133-37550155 GAGGGGGCTCAGCAGGGAAAGGG + Intronic
1157116872 18:44870298-44870320 CAGGTTCCTCAGCAGTGAGAGGG - Intronic
1157196249 18:45622525-45622547 GAGGGTCATCGGCAGGGAGATGG + Intronic
1157308879 18:46537096-46537118 AGGGGGCATTAGCAGGGACAAGG - Intronic
1157481844 18:48060227-48060249 CAGGGGAAGCAGAGGGGAGAAGG + Intronic
1157969219 18:52247130-52247152 AAGTGACATCAGCAGGGAGACGG + Intergenic
1158334869 18:56405361-56405383 CATGGCCATCAGCTGGGAGAGGG - Intergenic
1158480467 18:57817274-57817296 CAGGGCCAACATCAGGGAGTGGG + Intergenic
1158744495 18:60183643-60183665 CAGAGGAAACAGCAGGGATAGGG + Intergenic
1158786026 18:60712670-60712692 CAGGGTCATCAGAAAGGAAAGGG + Intergenic
1158867177 18:61649110-61649132 GAAGTGCATCAGCAGGGAGCAGG - Intergenic
1159019243 18:63129714-63129736 CCAGGGCATCAGCAGAGAGAAGG - Intronic
1159327575 18:66943151-66943173 CAGGGTCATCAGCATGCAGATGG - Intergenic
1159889917 18:73943621-73943643 CGGAGGCATGAGCAGGGTGAAGG - Intergenic
1160579623 18:79876158-79876180 CAGCGGCACCAGGCGGGAGATGG - Intronic
1160665404 19:325830-325852 ACTGGGCATCAGCAGGTAGACGG - Intronic
1160964699 19:1741956-1741978 CAAGGACACCAGCTGGGAGATGG + Intergenic
1161086868 19:2339493-2339515 CAGGCGGCTCAGCAGGAAGAGGG - Intronic
1162308039 19:9887551-9887573 CAGGGGCTTGACCATGGAGATGG - Intronic
1162424678 19:10587295-10587317 CAGGCGCTTCCGCAGGAAGAAGG - Exonic
1163004611 19:14389353-14389375 GAGGGGGATGAGGAGGGAGACGG + Intronic
1164373243 19:27659656-27659678 AAGGGGCATAAGCTGTGAGATGG + Intergenic
1165735070 19:38170593-38170615 CCGGGGCCTCTGCAGGGAGCTGG + Intronic
1165797303 19:38526558-38526580 AGGGGGCATCAGCAGGGTGGGGG - Intronic
1165935519 19:39386368-39386390 GAAGGGCAGCAGCAGTGAGAAGG - Exonic
1166044566 19:40222467-40222489 TCGGGGCTGCAGCAGGGAGATGG + Exonic
1166161092 19:40953855-40953877 CAAGGGCACCAGCAAGGAGCTGG - Intergenic
1166309641 19:41955755-41955777 CAGGGGCATAGCCTGGGAGATGG - Intergenic
1166333532 19:42091956-42091978 CAGAGGCATTAGCAGGGGCAGGG + Intronic
1166408948 19:42543487-42543509 CTGGGTCAGGAGCAGGGAGAGGG + Intronic
1166593916 19:44027602-44027624 CAGGGGCATCAGCAGGGAGAAGG - Intronic
1166712498 19:44946105-44946127 GGGGGGCGTCAGCAGGGAGAGGG + Intronic
1166862004 19:45816335-45816357 CAGGAGCATCCCCTGGGAGACGG + Intronic
1166895237 19:46018491-46018513 CAGGGGCAGCAGGAGGGACGGGG - Exonic
1166898246 19:46037510-46037532 CAGGGCCATCAGCAGGACCAGGG + Intergenic
1167044299 19:47040859-47040881 CAGGGGAGTGGGCAGGGAGACGG - Intronic
1167478188 19:49712962-49712984 CATGGTCATCAGCCTGGAGACGG - Exonic
1167576665 19:50320956-50320978 CAGGGGGCACAGCTGGGAGAGGG + Intronic
1167706488 19:51084174-51084196 CAGAGGCCCCAGCAGGGAGCAGG + Exonic
1167767926 19:51496685-51496707 CAGAGGCTTCAGCAGTGAGAGGG + Intronic
1167794055 19:51697657-51697679 CAGAGGGAGCAGCAGGGAGATGG + Intergenic
1168351426 19:55678340-55678362 CAGGGGCCCCAGCAGGAAGGAGG + Intronic
1168407002 19:56115695-56115717 CGGGGGCATCAGCACAGCGACGG + Intronic
1168663641 19:58185928-58185950 CAGGGGCACCAGTAGGAAAAGGG + Intronic
1168695403 19:58401245-58401267 CCGGGGCAAGAGGAGGGAGAAGG - Intergenic
1202673664 1_KI270710v1_random:20321-20343 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
925246074 2:2384305-2384327 AAGGAGCATCAGCAGGGAAATGG - Intergenic
925292451 2:2756662-2756684 CAGAGGCATGAGCAGAGATACGG + Intergenic
925419699 2:3702493-3702515 CCGGGGCCTCAGGAGGCAGATGG - Exonic
925556294 2:5134620-5134642 CAGGGCCCTCAGCAGGAGGAGGG + Intergenic
925736635 2:6969473-6969495 CAGGAGCATGAGCAGGGTGTGGG - Intronic
927217450 2:20676036-20676058 CTGGGGCCTCTGCAGGCAGAAGG + Intergenic
927711597 2:25329547-25329569 TAGGGGCATCAGCTGGGAGGGGG - Intronic
927925591 2:27011288-27011310 GAGGGGGATCAGCAGTTAGAGGG - Intronic
928851188 2:35749122-35749144 CAGGGAAATCAGGAAGGAGAAGG + Intergenic
929863798 2:45700834-45700856 CAGAGGCAGATGCAGGGAGAGGG + Intronic
932831049 2:74990612-74990634 AAGGGGCAGAAGGAGGGAGAGGG - Intergenic
933178921 2:79208064-79208086 TATGGGAATCAGGAGGGAGAAGG - Intronic
933550757 2:83772316-83772338 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
933600937 2:84329381-84329403 CAGGTGGCTCAGCAGAGAGAGGG + Intergenic
933899532 2:86839720-86839742 CAAAGACAGCAGCAGGGAGACGG + Intronic
934049197 2:88196185-88196207 CAGGGGCAGGAGCGGGGAGGAGG - Intergenic
934986756 2:98893096-98893118 CAGGCACAGCAGCAGGGAGCGGG + Intronic
935020497 2:99225904-99225926 CAGGGCCATCAGGCAGGAGAAGG - Intronic
935200648 2:100853742-100853764 CAGGGGCATCTGCAGCCAGGTGG + Intronic
935450611 2:103204683-103204705 CAGGGGAATCAGGCAGGAGAAGG + Intergenic
935712830 2:105914237-105914259 CAGGGAAATGAGCAGGGAGGCGG - Intergenic
935781028 2:106509506-106509528 CAAAGACAGCAGCAGGGAGATGG - Intergenic
936017344 2:108969749-108969771 CAGGGGCTTCAGCAGCTAGCTGG + Intronic
936040396 2:109145347-109145369 CAGGGTCATGAGCAGGGCCATGG - Intronic
937272379 2:120661218-120661240 GAGGGGCGGCAACAGGGAGAAGG - Intergenic
937678096 2:124613941-124613963 CAGGGCTATCAGATGGGAGACGG + Intronic
937683358 2:124668243-124668265 CCGGGGCTTCTGCAGGGAGCAGG + Intronic
938064332 2:128272938-128272960 CAGGGGCAACGGCAGGGGAAAGG + Intronic
938198910 2:129357072-129357094 GAGGGGCATTAGAGGGGAGAAGG - Intergenic
938911204 2:135887499-135887521 CAGGGGGATCAGCACAGACATGG + Intergenic
939322628 2:140644079-140644101 CTGGGGAATCAGCACGCAGAGGG - Intronic
939732980 2:145808359-145808381 CAGCAGAAACAGCAGGGAGAGGG - Intergenic
940087702 2:149879705-149879727 CAGGGCAATCAGCCAGGAGAAGG + Intergenic
940255531 2:151724301-151724323 CAGGGGCATCAGGAGGAAGCAGG + Exonic
942720927 2:178951692-178951714 CAGGGGCAACACCAGGGGTACGG + Intronic
942873959 2:180769227-180769249 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
943051265 2:182916068-182916090 GAGGAGCAGGAGCAGGGAGACGG - Intronic
943131050 2:183853533-183853555 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
943955743 2:194187319-194187341 CAGTGGCATCCACAGGCAGAAGG - Intergenic
944116451 2:196192125-196192147 TGGGGGCAGGAGCAGGGAGAGGG + Intergenic
944487351 2:200220921-200220943 CAGGGCTATCAGGAGAGAGAGGG - Intergenic
945375170 2:209071293-209071315 CAGGGACATCTGCTGGGAGGTGG + Intergenic
945965443 2:216181479-216181501 CAAGGGCATTAGCAGGAACATGG - Intronic
946018075 2:216620175-216620197 CAGTGGCCTCAGGAGGGTGAGGG + Intergenic
946154317 2:217797237-217797259 CAGGGGACTCAGCAGTGAGGTGG - Intergenic
946162046 2:217841303-217841325 CAGGGGAGCCAGCAGGGAGTGGG + Intronic
947112524 2:226734434-226734456 CACGGGCCTCAGCAGTGTGAGGG + Exonic
947293749 2:228607016-228607038 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
947614792 2:231548882-231548904 CAGGGGCACAAGAAAGGAGAAGG - Intergenic
947722131 2:232376643-232376665 CAAGGGCATCAGGTGGTAGAGGG - Intergenic
947722939 2:232380341-232380363 CAGGGGGCACAGCAGGGGGAGGG + Intronic
947952872 2:234163109-234163131 CAGGGTCATAAGCAGGCAAAGGG + Intergenic
948055076 2:235005051-235005073 CAGGGGGATCTGCAGGCGGATGG - Intronic
948460253 2:238125611-238125633 CAGGGGTAAAAGCGGGGAGACGG + Intronic
948673418 2:239583319-239583341 CAGGCGCATCAGCAGGTCCAGGG - Exonic
948681035 2:239634848-239634870 CAGGGACCCCAGCAGGGAGGTGG + Intergenic
948692937 2:239718431-239718453 CAGGGCCAGGAGAAGGGAGATGG - Intergenic
948954759 2:241279603-241279625 CGTGTGGATCAGCAGGGAGATGG + Intronic
1168978200 20:1983666-1983688 CAGGGAGGCCAGCAGGGAGAGGG - Intronic
1169275301 20:4229778-4229800 CAGGGGCACAAGCAGTGAGGGGG - Intronic
1169349226 20:4854706-4854728 GAGGGGCTTCAGAAGGGAGTGGG + Exonic
1170207244 20:13811583-13811605 GTGGGGCCTCAGCAGGGTGAAGG + Intronic
1170781625 20:19430624-19430646 CAGGAGCATCTCAAGGGAGAAGG - Intronic
1170791211 20:19511051-19511073 CAGGGTCAGCAGCAGGGTGGGGG - Intronic
1171062965 20:21984292-21984314 CAGGAATATCAGGAGGGAGATGG + Intergenic
1171088475 20:22261861-22261883 CAGGGGCTAGAGCAGAGAGAGGG - Intergenic
1171321288 20:24246746-24246768 CAGGGTCTTAAGCAGGGAGCTGG + Intergenic
1171378997 20:24718942-24718964 CAGGGGTGGCAGCAGGGAGGAGG - Intergenic
1171541802 20:25964632-25964654 CAGAGGCTTCAGCAGAGGGAAGG + Intergenic
1171722144 20:28573819-28573841 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1171801444 20:29623493-29623515 CAGGGCAATCAGAAAGGAGAAGG + Intergenic
1171844807 20:30260789-30260811 CAGGGGCTTGAGCAGAGGGAAGG + Intergenic
1172162020 20:32875403-32875425 CAGGGGGCACAGAAGGGAGATGG - Intronic
1172594496 20:36141032-36141054 AAGGGACAGCAGCTGGGAGAAGG + Intronic
1173522404 20:43709784-43709806 CGGGGGAAACAGAAGGGAGAGGG - Intronic
1173589186 20:44210848-44210870 GAGGAGCATAAGCAGGGGGAGGG - Intergenic
1173981765 20:47229959-47229981 CAGGTGCAGGAGCAAGGAGAAGG + Intronic
1174036231 20:47670006-47670028 GAGGGTCATCAGCTGGGAAACGG + Intronic
1175083502 20:56440520-56440542 GAGTGGCATGAGCAGGGAGGAGG - Intronic
1175171717 20:57085607-57085629 CACGGGCATCTGGATGGAGATGG - Intergenic
1176347501 21:5763357-5763379 AAGGGGAATCAGCAAGGAGATGG - Intergenic
1176347960 21:5768534-5768556 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1176354315 21:5883941-5883963 AAGGGGAATCAGCAAGGAGATGG - Intergenic
1176354774 21:5889118-5889140 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1176379195 21:6103349-6103371 CAGAGGCAGCAGCAGGGGCAGGG + Intergenic
1176379201 21:6103367-6103389 CAGGGGCAGCAGCAGGGGCAGGG + Intergenic
1176379221 21:6103421-6103443 CAGGGGCAGCAGCAGGGGCAGGG + Intergenic
1176496867 21:7555921-7555943 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1176497326 21:7561098-7561120 AAGGGGAATCAGCAAGGAGATGG + Intergenic
1176541822 21:8161427-8161449 AAGGGGAATCAGCAAGGAGATGG - Intergenic
1176542281 21:8166604-8166626 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1176560773 21:8344472-8344494 AAGGGGAATCAGCAAGGAGATGG - Intergenic
1176561232 21:8349649-8349671 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1176635089 21:9185080-9185102 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1176638276 21:9270053-9270075 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1178116382 21:29421739-29421761 CAGGGCAATCAGGAAGGAGAAGG + Intronic
1178319674 21:31595914-31595936 CAGGAACACAAGCAGGGAGAGGG - Intergenic
1178564148 21:33667924-33667946 CAGGGGCTCCAGCAAGCAGATGG + Intronic
1178908473 21:36655144-36655166 CAGGAGCTTGGGCAGGGAGAGGG - Intergenic
1179053155 21:37906575-37906597 CAGCAGCATCACCAGGGAGCTGG - Intronic
1179655377 21:42841522-42841544 CAGGTGCCTCAGTTGGGAGAAGG + Intergenic
1179744252 21:43434816-43434838 CAGGGGCAGCAGCAGGGGCAGGG - Intergenic
1179744272 21:43434870-43434892 CAGGGGCAGCAGCAGGGGCAGGG - Intergenic
1179744278 21:43434888-43434910 CAGAGGCAGCAGCAGGGGCAGGG - Intergenic
1180185000 21:46135103-46135125 CCAGGGCCTCTGCAGGGAGAGGG + Intergenic
1180295697 22:10932506-10932528 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1180370698 22:12033354-12033376 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1180371590 22:12042887-12042909 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1180415062 22:12701730-12701752 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1180422318 22:12877550-12877572 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1181508997 22:23380539-23380561 CAGGGGCAGGAGGAGGGACAGGG - Intergenic
1181594717 22:23906812-23906834 CTGGGGCCTCTGCAGGGAGTTGG + Intergenic
1181681747 22:24500245-24500267 CAGGGGCATTTGCGGGGAGGGGG - Exonic
1182052174 22:27321715-27321737 CAGGGGCATCAGAGGTGAGCTGG + Intergenic
1182948494 22:34348469-34348491 CAGAGGCAGCAACATGGAGAAGG + Intergenic
1183063771 22:35350224-35350246 CAGGGGAGCCAGGAGGGAGAGGG - Intergenic
1183161248 22:36114788-36114810 CAGGTGCAGCAGAAGGGAGACGG - Intergenic
1183751438 22:39723260-39723282 CAAGGTCATCAGAAAGGAGAAGG - Intergenic
1183954408 22:41370762-41370784 CAGGGGCAGCACGAGGGAGAGGG - Intronic
1184403265 22:44286118-44286140 CAGGGGCACCTGCAGGAAGGAGG - Intronic
1184677635 22:46052423-46052445 CTGGGGCCTCAGCAGGGGCAGGG + Intronic
1185302040 22:50086828-50086850 ATGGGACATCAGCAGGCAGAGGG - Intergenic
1185336381 22:50272429-50272451 TGGGGGCATGAGCACGGAGAAGG - Intergenic
1203246762 22_KI270733v1_random:77846-77868 AAGGGGAATCAGCAAGGAGATGG - Intergenic
1203247221 22_KI270733v1_random:83022-83044 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
949973721 3:9434821-9434843 TAGGGGAATGAGCAGGGGGAAGG + Exonic
950090382 3:10290531-10290553 CAGGGCACTCAGCAGGGAGGGGG + Intronic
950228900 3:11259105-11259127 CAGGGGCATCAGCTGGGGGCTGG - Exonic
950492600 3:13315009-13315031 CAGGGGCATGAGGAGGGTGAGGG + Intergenic
950827751 3:15843256-15843278 CAGGGACATCATCAAGGGGATGG + Intronic
951783072 3:26386732-26386754 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
952730362 3:36631782-36631804 CAGGGTCATCATCAGTGAGAAGG + Intergenic
952945885 3:38477743-38477765 CATGGGCAACACCAGGGGGACGG - Intronic
953024737 3:39138290-39138312 CATGGGCTTCATCATGGAGAAGG + Exonic
954297363 3:49681708-49681730 CAAGGCCAGCTGCAGGGAGAGGG - Exonic
954459891 3:50620320-50620342 CTGGGGCAACTGCGGGGAGAGGG - Intronic
954673830 3:52304856-52304878 CTGGGGCATAAGCTGTGAGATGG + Intergenic
954855573 3:53641128-53641150 AAGGGGCATCAGGAGGGGCAGGG + Intronic
954987245 3:54806200-54806222 CAGGGCAATCAGGCGGGAGAAGG + Intronic
956513251 3:70017577-70017599 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
956557314 3:70538246-70538268 CAGGTAAATCAGCAGTGAGAGGG - Intergenic
956689627 3:71863860-71863882 CAGGGTCATCAGAAGGCAGAGGG + Intergenic
957176801 3:76821740-76821762 CAGTGGCATCTGCAGGCAGAGGG + Intronic
958904729 3:99929220-99929242 CAGGGCCACCACTAGGGAGAAGG - Intronic
960238597 3:115314299-115314321 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
960992305 3:123319858-123319880 CAGGGGCACCAGCAGAGGGCTGG + Intronic
961096042 3:124157857-124157879 CAGGGGCATTCGCAGGGGAAAGG - Intronic
961219396 3:125187763-125187785 CAGGGGAATCAGCATGAGGAGGG - Intronic
961413652 3:126741936-126741958 CAGGAGCTGCATCAGGGAGAGGG - Intronic
961516886 3:127443630-127443652 CAGGCACACCAGCAGGGAGAGGG + Intergenic
962264507 3:133935480-133935502 AAGGGGCAGCAGCAGAAAGAAGG - Intronic
962314520 3:134350880-134350902 CAGGGGCAGCAGCAAGGGAAGGG - Intergenic
963090436 3:141478554-141478576 CAGGGGCATCAAGTGGGAGCAGG + Intergenic
963939169 3:151083576-151083598 AAGGGACAACAACAGGGAGAGGG + Intergenic
963973269 3:151452918-151452940 CAGGGGCAGCAGCAGGTACGAGG + Intronic
965800922 3:172493243-172493265 CAGGGCCATCAGGCAGGAGAAGG - Intergenic
966883329 3:184361797-184361819 CCCGGGCATCCGCAGGGAGCCGG - Intronic
968086385 3:195875795-195875817 CGGGGGCAGCAGGAGGTAGAAGG - Intronic
1202748620 3_GL000221v1_random:134968-134990 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
968504609 4:966070-966092 CACAGACATCTGCAGGGAGAGGG + Exonic
968831201 4:2933789-2933811 CAGGGGCAGCAGCAGCGTGAAGG + Exonic
968889596 4:3361441-3361463 CTGGGGCATCAGCCCGGAGCAGG + Intronic
969029220 4:4197751-4197773 CATAAGCATCAGCAGGGTGATGG + Exonic
969202707 4:5618416-5618438 TAGGGCCAGCAGCTGGGAGACGG + Intronic
969610104 4:8223010-8223032 CAGGGGCTGCAGAAGGGAAAGGG - Intronic
969619037 4:8269785-8269807 CAGGGGCATCCCCAGGGCGCAGG - Exonic
970840354 4:20461543-20461565 CAAGGGCAGAAGCAGAGAGATGG + Intronic
973648536 4:52974167-52974189 CAGGGCAATCAGGAAGGAGAAGG + Intronic
973693888 4:53470487-53470509 CAGGGCAATCAGGAAGGAGAAGG + Intronic
973772119 4:54216807-54216829 TAGGGACAGGAGCAGGGAGAGGG - Intronic
973871685 4:55172787-55172809 CAGGGGCCGCAGCAGGGAGAAGG - Intergenic
975292604 4:72694767-72694789 CAGGGCAATCAGCCAGGAGAAGG - Intergenic
975858478 4:78650358-78650380 CAGTGAGATCAGCAAGGAGATGG - Intergenic
977756949 4:100682782-100682804 CAGGGGAGCCAGAAGGGAGATGG - Intronic
977897034 4:102376745-102376767 CAGGGCAATCAGGTGGGAGAAGG - Intronic
977998710 4:103529288-103529310 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
978157349 4:105505178-105505200 CAGGGGTATGAGCAGGGTTAAGG + Intergenic
978909916 4:114050768-114050790 CAGGGTCATCAGAAAGGAAAGGG + Intergenic
979658626 4:123226205-123226227 CAGGGCAATCAGGAAGGAGAAGG - Intronic
981562525 4:146063438-146063460 CAGGGGACTCAGTGGGGAGATGG + Intergenic
981605080 4:146531640-146531662 CAGGGCAATCAGGCGGGAGAAGG + Intergenic
982054998 4:151539675-151539697 CAGGGCACTCAGCAGGGAGTGGG - Intronic
984261249 4:177445337-177445359 CGGGGGAACCAGAAGGGAGACGG - Intergenic
984275200 4:177600807-177600829 CAGGGGCAACAGCATGCAGGTGG - Intergenic
984684978 4:182657330-182657352 CAGGGTCATCTGCTGAGAGAGGG - Intronic
984713638 4:182905975-182905997 TAGGGGCAGCATCAGGAAGATGG - Intronic
985039927 4:185879840-185879862 CTGGAGCATCAGCACGGTGAGGG + Intronic
1202753173 4_GL000008v2_random:28465-28487 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1202759072 4_GL000008v2_random:93262-93284 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
986044320 5:4022800-4022822 CAGGGAGTCCAGCAGGGAGAAGG - Intergenic
986264627 5:6181314-6181336 CAGGGGAACCACCAGGGAGTTGG - Intergenic
986351976 5:6888803-6888825 CAGGTGGGTCAGGAGGGAGAGGG + Intergenic
986400970 5:7379703-7379725 CAGGGGCATCACCTGGAAGCGGG - Intergenic
987079093 5:14410316-14410338 GAGAGGCATAAGGAGGGAGATGG - Intronic
987174773 5:15296084-15296106 CAGGGGAATCAGGCAGGAGAAGG + Intergenic
987261695 5:16210860-16210882 CAGGTGGAAGAGCAGGGAGAGGG + Intergenic
987397988 5:17443576-17443598 CAGGGGAGACAGAAGGGAGATGG - Intergenic
991027280 5:62043727-62043749 AACGGGCATCAGCAGGGTAAGGG - Intergenic
991091274 5:62696138-62696160 CCAGGGCAGCAGCAGGGAGTAGG + Intergenic
992159845 5:73990646-73990668 GAGGGGAGTCAGCAGGGAGAAGG - Intergenic
992483781 5:77176499-77176521 CATGGGCATGAGCAGGAGGAGGG + Intergenic
995046331 5:107652974-107652996 CTGGGGCATCAGATGGGTGAGGG - Intronic
996012687 5:118498762-118498784 CAGGGCAATCAGACGGGAGAAGG - Intergenic
997185230 5:131875141-131875163 CAGGGCAATCAGCCAGGAGAAGG + Intronic
997381964 5:133444693-133444715 TAGGGGCTTCTGCAGGGAGCTGG + Intronic
997595815 5:135106840-135106862 CAGAGGCTCCAGCAGTGAGAGGG + Intronic
998374363 5:141681405-141681427 CAAGGGAATGAGCAGGGAAAAGG - Intronic
998501915 5:142640535-142640557 GATGCGCATGAGCAGGGAGATGG + Intronic
998519102 5:142783631-142783653 CAGGGGCACCTCCAGGTAGAAGG - Intronic
998736793 5:145151249-145151271 CAGGGCAATCAGGCGGGAGAAGG + Intergenic
999823620 5:155253233-155253255 CAGGGGACTCAGCAGTGACAAGG - Intergenic
1000145403 5:158448792-158448814 CAGAGGCATGAACAAGGAGAGGG - Intergenic
1000862497 5:166473197-166473219 CAGAAGCATGAGCAGAGAGAAGG + Intergenic
1001628880 5:173159987-173160009 CATGGGGATCAGCAGGATGATGG + Exonic
1001629387 5:173163477-173163499 CATGAGCGTCACCAGGGAGAAGG - Intronic
1002000689 5:176194878-176194900 CAGGGGCAGGAGCGGGGAGCGGG + Intergenic
1002091490 5:176809454-176809476 GAGGGGAATGAGCAGGGTGAGGG - Intergenic
1002206679 5:177567824-177567846 CAGGAGCATCTGCAGGGAATGGG + Intergenic
1002253653 5:177944109-177944131 CAGGGGCAGGAGCGGGGAGCGGG - Intergenic
1002270449 5:178068416-178068438 CAGGGGCATGGGATGGGAGATGG - Intergenic
1002707770 5:181174255-181174277 CAGAGGCACCAGCTGGGAAACGG + Intergenic
1002767979 6:259293-259315 CAGTGTCAGCAGCAGGGAAAGGG - Intergenic
1002777433 6:341089-341111 CAGGGGCACCTCCAGGGAGAGGG - Intronic
1002971101 6:2021035-2021057 CAGGAGAAGCAGCTGGGAGAAGG - Intronic
1003111145 6:3253112-3253134 CCTGGTCATCAGCAGGAAGAGGG - Intronic
1003191202 6:3876429-3876451 CAGGATCATCAGCAAAGAGAGGG - Intergenic
1003265372 6:4561022-4561044 TAGTGGCATCATCAGAGAGAGGG + Intergenic
1003285943 6:4734138-4734160 GAGGGGAAACAGCAGAGAGAGGG - Intronic
1004247915 6:13997933-13997955 CTGGGGCATCGGGTGGGAGACGG + Intergenic
1004334469 6:14751631-14751653 CAGGGGCATCCCCAGGGATTTGG + Intergenic
1005496657 6:26393382-26393404 CAGGACCACCAGAAGGGAGAGGG + Exonic
1005835004 6:29702335-29702357 CAGGAGCAGCAGCAGGAACAAGG + Intergenic
1005921528 6:30406213-30406235 CAGGGGAAAGAGCAGGCAGAAGG - Intergenic
1006186475 6:32184256-32184278 CGGAGGCCACAGCAGGGAGAGGG - Exonic
1006338075 6:33431447-33431469 CAGGGGAATGGGCAGGGAGCAGG - Intronic
1006446860 6:34084495-34084517 GAGGGGCACCTGCAGGGAGGAGG + Intronic
1006651417 6:35554874-35554896 CAGAGTCAGCAGCAGGGAGAAGG + Intergenic
1006844286 6:37051707-37051729 AAGGGGCCTCAGCAGGCACATGG + Intergenic
1007112648 6:39321881-39321903 CAGGGATATGAGCTGGGAGAGGG + Intronic
1007183941 6:39951451-39951473 CAGGAGAAACAGCAGGGATATGG - Intergenic
1007249002 6:40482945-40482967 CAGTGGCTGCAGCAGGGACAGGG - Intronic
1007428182 6:41760534-41760556 CAGGGACAGGAGCAGTGAGATGG + Intergenic
1007727058 6:43922931-43922953 CAGGGCAACCAGCTGGGAGATGG + Intergenic
1007738096 6:43994401-43994423 CAGGAGGATCAGCTGGGAGAAGG - Intergenic
1008976848 6:57437124-57437146 CAGGAGCAGGAGCAAGGAGAGGG + Intronic
1009181082 6:60518002-60518024 CAGAGGGATCAGCAGTGAGTGGG - Intergenic
1009517184 6:64635316-64635338 CAGGGCAATCAGGCGGGAGAAGG - Intronic
1009659395 6:66591536-66591558 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1010575952 6:77531360-77531382 CAGGGGCTTGAGCAGTGACAGGG + Intergenic
1011533209 6:88347520-88347542 CAGGGGCATTATCATGGTGAAGG + Intergenic
1012939188 6:105399786-105399808 TAGGAGCAACAGCAGGGATAAGG + Intronic
1013108430 6:107046064-107046086 CAGGGGCATCACCAGGGCCCTGG - Intronic
1013561427 6:111309309-111309331 TGGTGGAATCAGCAGGGAGATGG + Intronic
1014383252 6:120770555-120770577 CAGGTCCCTCAGCAGGGAAATGG - Intergenic
1014465710 6:121754307-121754329 CAGAGAATTCAGCAGGGAGATGG - Intergenic
1014952796 6:127578075-127578097 CTGTGTCATCAGCAGGGAGTGGG - Intronic
1015352668 6:132241194-132241216 CAGGGGCCTCAGTTGGAAGACGG + Intergenic
1016990629 6:149925677-149925699 CAGGGGCATCGTCCGGGAGCGGG - Intergenic
1017831990 6:158138758-158138780 CAGGGGCATAAGAATAGAGAAGG + Intronic
1017896773 6:158686862-158686884 CAGGGCCAGGAGGAGGGAGAAGG - Intronic
1018383776 6:163284709-163284731 GAGAGGCATCAGAAGGGAGGCGG - Intronic
1018423269 6:163658443-163658465 CACTGTCAGCAGCAGGGAGAAGG - Intergenic
1018545888 6:164934781-164934803 CAGGCGCCTCAGCAGGATGAGGG + Intergenic
1018738880 6:166712284-166712306 CAAGGCCAGCAGCAGGCAGAAGG + Intronic
1018978706 6:168584897-168584919 AGGGGGCATCAACTGGGAGATGG - Intronic
1019303196 7:319525-319547 CTCGGAGATCAGCAGGGAGAAGG + Intergenic
1019390928 7:786734-786756 GGGGGGCATCATCAGGGTGAGGG + Intergenic
1019513274 7:1429052-1429074 CTGGGGCATCAGGTGGGAGGTGG - Intronic
1019543095 7:1560246-1560268 CAGGGACAGGAGCAGGGAGGTGG - Intronic
1019660805 7:2223036-2223058 CAGTTGCCTCTGCAGGGAGAGGG + Intronic
1020057564 7:5128432-5128454 CAGGGGCAGCAGCAGGGACCGGG + Intergenic
1020169962 7:5837550-5837572 CGGGGGCAGCAGCAGGGACCGGG - Intergenic
1020254931 7:6497731-6497753 CTGCGGCCTGAGCAGGGAGATGG - Intronic
1020956850 7:14750503-14750525 AATGGGCATCAGAATGGAGATGG - Intronic
1021639972 7:22727462-22727484 CAGGAGCAGCCCCAGGGAGAAGG - Exonic
1022040070 7:26572708-26572730 CAGGTACCTCAGGAGGGAGAAGG - Intergenic
1022794659 7:33722530-33722552 CTGGGGCAGCAGCAGGCAGAAGG - Intergenic
1024051787 7:45628351-45628373 CATGGGCAGGAGCATGGAGATGG - Intronic
1024053132 7:45642150-45642172 CCAGGTCATCAGCAGGCAGAAGG + Intronic
1024323883 7:48093775-48093797 CAGGGGGAGCAGCGGGGACAGGG - Intronic
1024561677 7:50649975-50649997 CTGGGTCATGAGCAGAGAGATGG + Intronic
1025236731 7:57239675-57239697 CAGGGGTTCCAGCAGAGAGAAGG - Intergenic
1025293261 7:57750956-57750978 CAGGGGCTTGAGCAGAGGGAAGG + Intergenic
1025995428 7:66524553-66524575 AAGGGGGATCAGGAGGGTGAGGG + Intergenic
1026131566 7:67625415-67625437 CGGGGGCCTCTGCAGGGAGCTGG - Intergenic
1026139588 7:67694256-67694278 CCGGGGCATCTGCAAGGAGTGGG - Intergenic
1026622426 7:71961770-71961792 CAAGGGCAGCAGAAGAGAGAGGG + Intronic
1026987078 7:74561419-74561441 AAGGGGGATCAGGAGGGTGAGGG + Intronic
1027189193 7:75988041-75988063 CAGGGGCAGGAGCTGGGACAAGG - Intronic
1029173915 7:98650381-98650403 TTGGAGCATCAGAAGGGAGAAGG + Intergenic
1029449286 7:100631937-100631959 CAGGTGCACCTGCAGGGAAAGGG + Exonic
1031985598 7:128162830-128162852 CAGGGGCATCAGCATGGCAGAGG + Intergenic
1031986127 7:128165955-128165977 CAGGGGCAGGGGCAGGAAGAGGG + Intergenic
1032182458 7:129692074-129692096 CAGGGGAATGTGGAGGGAGAGGG - Intronic
1032848232 7:135770138-135770160 CAGGGGCTGCAGGAGAGAGACGG + Intergenic
1033301478 7:140189976-140189998 CAGGGGCAGATGCATGGAGAAGG + Intergenic
1034286248 7:149885110-149885132 CATGGCCAGGAGCAGGGAGAGGG - Intergenic
1035641051 8:1185377-1185399 CAGGGCCATCTGCAGGTACAAGG + Intergenic
1035642761 8:1196604-1196626 CAGAGGCATCTGCAGGTCGAGGG + Intergenic
1035848079 8:2886526-2886548 CAGGGTCGTCAGCTGGGAGATGG - Intergenic
1036256123 8:7208131-7208153 CAGGTGAAGAAGCAGGGAGAGGG + Intergenic
1036361361 8:8079368-8079390 CAGGTGAAGAAGCAGGGAGAGGG - Intergenic
1036648454 8:10626303-10626325 CAGAGGGCTGAGCAGGGAGAGGG + Intronic
1036889613 8:12587655-12587677 CAGGTGAAGAAGCAGGGAGAGGG + Intergenic
1037441055 8:18916569-18916591 CAGGGGCTACAGCAGGGAGGAGG + Intronic
1037696234 8:21226640-21226662 CAAGGTCATCAGCTGGGAAAAGG - Intergenic
1037905507 8:22713906-22713928 CAGGGGAGCCTGCAGGGAGAGGG - Intronic
1039429887 8:37517558-37517580 CAGGGCGGCCAGCAGGGAGAGGG - Intergenic
1039554862 8:38468307-38468329 CCGGGGCCTCCGCAGGGCGATGG - Intronic
1040008701 8:42642900-42642922 CTGGGGCAGCAGCAGGGGGCAGG - Intergenic
1040055758 8:43056038-43056060 TAGTGGCCCCAGCAGGGAGAGGG - Intronic
1040910226 8:52510608-52510630 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1041252256 8:55945936-55945958 CAGCGGCAGCAGGATGGAGACGG - Intronic
1042313899 8:67405462-67405484 CAGGACCATTAGCAGGGGGAAGG - Intergenic
1042364626 8:67922582-67922604 CAGGGTCATCAGAAAGGAAAGGG + Intergenic
1042594140 8:70427664-70427686 CAGGGGCAGAGGCTGGGAGAAGG - Intergenic
1042840372 8:73117410-73117432 CAGTGGCTTCAGCAGAGAGGAGG + Intronic
1045471248 8:102514195-102514217 CACGGGCATCAGGTGGGAAAGGG + Intergenic
1045498275 8:102726544-102726566 GAGGAGAATCAGCAGGGAGCAGG + Intergenic
1046945629 8:119971681-119971703 GAGGGGCAGAAGCGGGGAGAAGG + Intronic
1047381892 8:124372137-124372159 CAGCGGCAGCAGCCGGGACATGG + Exonic
1047499637 8:125431177-125431199 TAGGGGCAGCAGCAGGTAGTCGG - Exonic
1048517048 8:135120695-135120717 CAAGGACATCAGAAGGCAGAAGG - Intergenic
1049106428 8:140616661-140616683 CAGGGGCAGCAGCAGTGGGCAGG + Intronic
1049191063 8:141287872-141287894 CAGGGGCACCTGGAGGAAGACGG + Intronic
1049204258 8:141356083-141356105 CAGGGGCCACAGCTGGGAAATGG - Intergenic
1049219675 8:141423282-141423304 CAGGGGTCTCAGCTGCGAGAGGG - Intronic
1049327051 8:142027371-142027393 CAGGGGCAGCTGCACAGAGAGGG + Intergenic
1049354196 8:142179583-142179605 CAGGGGCGACAGCAGGGAAATGG - Intergenic
1049747394 8:144268822-144268844 CAGAGGCAGCAGCAGGGCAAGGG + Intronic
1051349402 9:16184930-16184952 CAGGGGTAACAGCAGGCAGTGGG + Intergenic
1051765962 9:20524024-20524046 CAGGGGAAGTGGCAGGGAGAAGG + Intronic
1052640129 9:31156942-31156964 CAGGGTAATCAGGAAGGAGAAGG - Intergenic
1053415533 9:37944834-37944856 CAGGAGAAGCTGCAGGGAGAAGG - Intronic
1054150098 9:61595654-61595676 CAGGGGCTTGAGCAGAGGGAAGG - Intergenic
1054163279 9:61695023-61695045 CAGGGGCTTGAGCAGAGGGAAGG - Intergenic
1054469864 9:65526758-65526780 CAGGGGCTTGAGCAGAGGGAAGG - Intergenic
1055091822 9:72370826-72370848 CAGGAGAATCACCTGGGAGATGG + Intergenic
1056468147 9:86879126-86879148 CAGGGTCATCAGAAGGCAGAGGG + Intergenic
1056832738 9:89929860-89929882 CAGGGGCAGAGGAAGGGAGAAGG + Intergenic
1057080766 9:92172914-92172936 CAGGGGCACCAGCAGGTGCAAGG - Intergenic
1057489546 9:95510785-95510807 AAGGGGGAGGAGCAGGGAGAAGG + Intronic
1058398162 9:104580319-104580341 CACAGGCATCTGCAGTGAGAAGG + Intergenic
1058962169 9:110002008-110002030 CAGGGCAATCAGGAAGGAGAAGG - Intronic
1058963075 9:110009802-110009824 CATGAGGATCTGCAGGGAGAGGG - Intronic
1059428408 9:114235672-114235694 CAGGGGCAGGGGCAGGGGGAGGG - Intronic
1060197273 9:121631877-121631899 CAGGGCTTTCAGCAGGGAGCAGG + Intronic
1060409820 9:123392818-123392840 CTGGGGCCTCGGCAGGGAAAGGG - Intronic
1060510019 9:124224856-124224878 CAGTGGCAGCATCAGGGACATGG + Intergenic
1060745281 9:126127106-126127128 GTGGGGCATCAGCAGGGAATAGG + Intergenic
1060819762 9:126654546-126654568 CAGGGGCTGGAGCAGGTAGAAGG + Intronic
1060827042 9:126693467-126693489 CAGGGGCAGCAACGGGGAGATGG - Intronic
1061120218 9:128637302-128637324 CAGGGGCTGCAGCAGGAAGGTGG + Intronic
1061123135 9:128656540-128656562 CCAGGGCATCCGCTGGGAGACGG - Exonic
1061328835 9:129879840-129879862 CAAGGCCAGCAGCAGGCAGAGGG - Intronic
1061604111 9:131695544-131695566 CAGGGGCATCAGGAGCGAGTTGG + Intronic
1061848319 9:133400497-133400519 GAGGTGCAGCAGCAGGGAGCAGG - Exonic
1061848363 9:133400642-133400664 AAGGTGCAGCAGCAGGGAGCAGG - Intronic
1061873783 9:133534200-133534222 CAGGGGCCTAAGCAGGTGGAGGG - Intronic
1062056785 9:134472957-134472979 CTGGGGCCTCACCTGGGAGAGGG - Intergenic
1062160970 9:135079643-135079665 CAGAGGCTGCAGCAGGAAGAAGG + Intronic
1062539486 9:137035267-137035289 CCGGGGCAGCAGCAAGGTGAGGG + Exonic
1062564522 9:137158256-137158278 CAGGAGAAGGAGCAGGGAGAAGG + Intronic
1203757870 Un_GL000218v1:152382-152404 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1203463096 Un_GL000220v1:60908-60930 AAGGGGAATCAGCAAGGAGATGG - Intergenic
1203463554 Un_GL000220v1:66083-66105 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1203717258 Un_KI270742v1:165058-165080 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1203533959 Un_KI270743v1:13175-13197 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1203651482 Un_KI270751v1:128644-128666 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1186331234 X:8536374-8536396 CAGGGACATTGGCAAGGAGATGG + Intronic
1186489248 X:9958616-9958638 CAGGTGCTTCTGCAGGGAGTGGG - Intergenic
1186786290 X:12959155-12959177 CAGGGGCAGCAGTGAGGAGAAGG - Intergenic
1187529824 X:20086211-20086233 CATGGACATCAGCAGTGTGAGGG - Intronic
1187901451 X:24030113-24030135 CTAGGGCAGAAGCAGGGAGATGG + Intergenic
1188105837 X:26145767-26145789 AAGGGGCATCTGCAGAGAGCAGG - Intergenic
1188557263 X:31426772-31426794 CATGGGCATCAGCAGGTTCAAGG - Intronic
1189377139 X:40474886-40474908 CAGGGGCAGGAAGAGGGAGAAGG + Intergenic
1190877600 X:54470726-54470748 CCGGGGCATCTGCAGGTAGCTGG + Exonic
1192153131 X:68724238-68724260 CAGAGCCCTCACCAGGGAGAAGG - Intronic
1192928609 X:75781928-75781950 CTGGGGGAGCGGCAGGGAGAAGG - Intergenic
1193031964 X:76908039-76908061 CATGTGCATCAGCAGGGAAGTGG - Intergenic
1193130076 X:77910599-77910621 CAGGGGCATCACCCGGAAGTGGG + Intergenic
1195248277 X:103017083-103017105 CAGGGGAGTCAGCAAGGAGTAGG - Intergenic
1195367292 X:104138711-104138733 CGGGGGAACCAGAAGGGAGATGG + Intronic
1197498667 X:127217887-127217909 CAGGGGAATCAGGCAGGAGAAGG + Intergenic
1197619982 X:128736880-128736902 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1198327307 X:135586574-135586596 CGGGGGCACCAGCAGGCTGAAGG - Intergenic
1198416883 X:136429380-136429402 CAGGGGCAGGAGCAGGGAGGTGG - Intergenic
1199492485 X:148416241-148416263 AAGGTGCATCAGCAGGCACAAGG - Intergenic
1199527694 X:148810876-148810898 GAGGGGGATCAGGAGGGAGTTGG - Intronic
1200117110 X:153774200-153774222 CCTGGGCATCAGCAAGGAGGAGG + Exonic
1200134664 X:153869070-153869092 CGGGGGCCTCAGCTGGGAGCAGG - Intronic
1200704741 Y:6432629-6432651 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1201029370 Y:9732079-9732101 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1201536056 Y:15049679-15049701 CAGGGGAATCAGGCAGGAGAAGG - Intergenic
1201772211 Y:17625810-17625832 AAGGGACAACTGCAGGGAGAAGG + Intergenic
1201829344 Y:18280176-18280198 AAGGGACAACTGCAGGGAGAAGG - Intergenic
1201941940 Y:19469509-19469531 CAGGGCAATCAGCCAGGAGAAGG - Intergenic
1202379261 Y:24261494-24261516 GAGGGGCAGCAGAAGGGTGAAGG - Intergenic
1202491521 Y:25408627-25408649 GAGGGGCAGCAGAAGGGTGAAGG + Intergenic