ID: 1166594005

View in Genome Browser
Species Human (GRCh38)
Location 19:44028252-44028274
Sequence CCAGCTAAGCAGAAAGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 235}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166594005_1166594011 23 Left 1166594005 19:44028252-44028274 CCTCCCACTTTCTGCTTAGCTGG 0: 1
1: 0
2: 2
3: 24
4: 235
Right 1166594011 19:44028298-44028320 AGCTTTAATCTCCCTTGCTGTGG 0: 1
1: 0
2: 3
3: 11
4: 197
1166594005_1166594009 -7 Left 1166594005 19:44028252-44028274 CCTCCCACTTTCTGCTTAGCTGG 0: 1
1: 0
2: 2
3: 24
4: 235
Right 1166594009 19:44028268-44028290 TAGCTGGCTAGTGACCTCAATGG 0: 1
1: 0
2: 0
3: 1
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166594005 Original CRISPR CCAGCTAAGCAGAAAGTGGG AGG (reversed) Intronic
900429868 1:2596433-2596455 CCAGCTCACCAGACAGAGGGAGG - Intronic
902903095 1:19533788-19533810 CCAGCAAGGCAGGAAGTGGAAGG + Intergenic
906567947 1:46813890-46813912 CCTGCTAAGCAGAGGGTAGGAGG - Exonic
906637779 1:47421041-47421063 CCAGATGAGCAGAAGGTTGGAGG - Intergenic
907464917 1:54628524-54628546 CCAGCTACCCAGGAGGTGGGAGG + Intronic
907659883 1:56382185-56382207 CCAGAGAAGAAGAAAGAGGGAGG + Intergenic
912947172 1:114095089-114095111 TCAGCTGAGCAGAAAATGGCAGG + Intronic
914882193 1:151556006-151556028 GGAGTTAAGAAGAAAGTGGGGGG - Intronic
915614593 1:157027265-157027287 CCAGCTACTCAGGATGTGGGAGG + Intronic
917573659 1:176296744-176296766 CCAGGGAAGCTCAAAGTGGGCGG - Intergenic
917825101 1:178811611-178811633 TCAGCTACTCAGAGAGTGGGAGG - Intronic
917884029 1:179365967-179365989 CCAGCAAAGGAGGAAGTGAGCGG + Exonic
918823588 1:189292071-189292093 CCATCTAAGCAGAAAGTTAATGG - Intergenic
919268368 1:195304284-195304306 CCAGCTCAGGAGAAAGATGGAGG - Intergenic
920197450 1:204238512-204238534 CCATCTAGCCATAAAGTGGGTGG + Intronic
921683521 1:218062723-218062745 ACAGCTAAGAAGAAAGTGCAAGG + Intergenic
922358394 1:224798145-224798167 CCTGGTAAGCAGATAGTTGGAGG + Intergenic
923194642 1:231653398-231653420 CCAGCTAAGCAGCAAGGGCCAGG - Intronic
924363083 1:243261385-243261407 CCAGGTACACAGAAAGTGAGAGG + Intronic
924866227 1:247984189-247984211 CCAGTTAAGTAGGAGGTGGGGGG + Intronic
1063524726 10:6774207-6774229 AAAGCTAAGAAGAATGTGGGAGG - Intergenic
1067197653 10:44136189-44136211 CCAGGTAAGCATACCGTGGGTGG + Intergenic
1070257025 10:74821747-74821769 GCAGCCAAGCAGGAATTGGGAGG + Intergenic
1072685307 10:97533154-97533176 CCAGCTGAGCTGAAACTGAGAGG + Intronic
1073525885 10:104181608-104181630 CGAGCTAGGGAGAAAGTGGTGGG - Intronic
1074049261 10:109867489-109867511 AAAGCTAAGCAGGAAGTGGATGG + Intronic
1074252519 10:111765889-111765911 CCAGCTACTCAGGAGGTGGGAGG + Intergenic
1074563295 10:114553634-114553656 ACATCTAGGCAGAGAGTGGGAGG - Intronic
1075947457 10:126448499-126448521 CAAGCTAAGCCCAAAGTTGGTGG + Intronic
1077580038 11:3411308-3411330 CCAGCTACTCAGGAAGTGGGAGG - Intergenic
1080413657 11:32049817-32049839 CCAGAAAATGAGAAAGTGGGTGG - Intronic
1081730644 11:45369653-45369675 CCAGCGAAGCCCACAGTGGGAGG - Intergenic
1084155146 11:67309093-67309115 TGAGCTAAGCTGAGAGTGGGTGG - Intronic
1084236957 11:67794136-67794158 CCAGCTACTCAGGAAGTGGGAGG - Intergenic
1084479512 11:69410599-69410621 CCAGCTCAGCAGACACTGTGTGG - Intergenic
1084835443 11:71798694-71798716 CCAGCTACTCAGGAAGTGGGAGG + Intronic
1085017260 11:73182956-73182978 CCAGCTAAGCCCAGAGAGGGTGG - Intergenic
1085132993 11:74057848-74057870 CCAGCTACTCAGGAGGTGGGAGG + Intronic
1086184709 11:83999306-83999328 CCAGCTGAGGAGTAAGTGGCTGG - Intronic
1087402674 11:97687207-97687229 CCAGCAGAGCAGAATGTAGGCGG + Intergenic
1087456549 11:98394312-98394334 GCAGAAAAGCAGAAAGTTGGGGG - Intergenic
1088334993 11:108694008-108694030 ACAGCTAAGTAACAAGTGGGTGG + Intronic
1089081004 11:115776141-115776163 CCAACGAAGCAGAAAGTGTGTGG - Intergenic
1089423205 11:118347731-118347753 CCAGCTACTCAGGAGGTGGGAGG - Intronic
1090364274 11:126192949-126192971 CCAACTACAGAGAAAGTGGGTGG + Intergenic
1091405437 12:206449-206471 ACAGATAAACAGAAAGTGGTAGG - Intronic
1091929908 12:4387418-4387440 AAAGTTAAGCAGAAAGTGTGAGG - Intergenic
1091948482 12:4570920-4570942 CCAGCTAAGCAGAAAGGACAGGG - Intronic
1093317679 12:17670702-17670724 CTAGCTCAGCTGAAAGAGGGAGG + Intergenic
1094368165 12:29706247-29706269 CCAGCTATGCAGGAAGAGGAAGG + Intronic
1096256262 12:50063961-50063983 CCAGCTAGGCAGGGAGTGGAGGG + Intronic
1096857811 12:54497722-54497744 CCATCTAAGCTGAAAGTGTTTGG + Exonic
1098614461 12:72506194-72506216 CCAGCTATTCAGAAAGTTGATGG + Intronic
1100206585 12:92356487-92356509 GCAGCCAAACAGGAAGTGGGTGG + Intergenic
1100874547 12:98948368-98948390 CCAGTGAAGCAAACAGTGGGGGG + Intronic
1101496871 12:105263089-105263111 CCAGCTAGGCAGAATCTGAGTGG - Intronic
1101801377 12:108025138-108025160 CCAGCTATTCAGGAGGTGGGAGG - Intergenic
1102434681 12:112911654-112911676 CCAGCCAGCCAGTAAGTGGGAGG - Intronic
1102455610 12:113069247-113069269 CTAGCAAAGCAGGAAGTGGAGGG - Intronic
1102784574 12:115594141-115594163 CAAACTAAGCAGACAGAGGGGGG - Intergenic
1103420153 12:120774235-120774257 ACAGCAAAGTAGGAAGTGGGTGG - Intronic
1103863649 12:124034212-124034234 CCAGTGAATCAGAAACTGGGGGG - Intronic
1104089580 12:125504156-125504178 TCAGCTAAGCAGAAAGTCAATGG - Intronic
1104405096 12:128510574-128510596 CCAGCGATGCAGAAAATGTGAGG - Intronic
1105015585 12:132784954-132784976 CCATCGAGGCAGCAAGTGGGCGG - Intronic
1106122021 13:26867994-26868016 GCAGCCAAGCAGAAAGAGTGTGG + Intergenic
1108408751 13:50127636-50127658 CGAGCTGCGCAGAAACTGGGTGG + Intronic
1111718276 13:91909231-91909253 CCAGCTCAGCAGAGGCTGGGAGG - Intronic
1113330870 13:109326272-109326294 CCAGCTTATCAGAATCTGGGTGG - Intergenic
1113910807 13:113840343-113840365 GCAGCTAAGCAGAAAGAGGGGGG - Intronic
1114461501 14:22888890-22888912 CTAGCTACTCAGGAAGTGGGAGG + Intergenic
1115203405 14:30875869-30875891 CCATCTCAGCGGAAAATGGGAGG + Intronic
1115755453 14:36523166-36523188 CCAGCGAAGCAGAGCGTGGTCGG - Intergenic
1116919714 14:50560346-50560368 CCACAGAAGCAGAAAGTGGAGGG - Intronic
1117755245 14:58968123-58968145 CCAGCAAAGCAGAAATGTGGTGG + Intergenic
1119264495 14:73256001-73256023 CTAGCTAAGCAGAGGGTGGAAGG + Intronic
1120236124 14:81893183-81893205 CCTGCTAATAAGAAATTGGGAGG - Intergenic
1121458061 14:94051830-94051852 CCAGGTGGGCAGTAAGTGGGTGG - Intronic
1122412793 14:101534523-101534545 CCTGCAATGCAGAAAGTAGGGGG + Intergenic
1123218996 14:106839462-106839484 CTAGCTATGCAGAAAGTGCATGG - Intergenic
1124136129 15:27037906-27037928 CCAGGCAAGCAGCAAGTTGGTGG - Intronic
1124618359 15:31259184-31259206 CCAGCTACTCAGGAGGTGGGAGG + Intergenic
1126227643 15:46289831-46289853 CCAGCAAAGCAGTATGGGGGAGG + Intergenic
1126283922 15:46988813-46988835 CCAGCACAGCAGAAAGAGGTGGG - Intergenic
1128232113 15:66042693-66042715 CCAGCAAACCAGAAGCTGGGAGG - Intronic
1128502186 15:68234284-68234306 AGAGATAAGCAGAATGTGGGTGG + Intronic
1129275327 15:74441683-74441705 CTGGGTAAGCAGAAAGAGGGAGG + Intergenic
1129944656 15:79528202-79528224 CCAGATAAGCAGGAAGGGAGAGG + Intergenic
1130870470 15:87967411-87967433 CCAGCTTAGGAGAAAGAGGAAGG + Intronic
1132146771 15:99433808-99433830 CCCGCTGAGCAGAACCTGGGGGG + Intergenic
1132234595 15:100209748-100209770 CCAGCGTGGCAGAAAGTGGATGG + Intronic
1132720207 16:1312046-1312068 CCAGACAGGGAGAAAGTGGGGGG - Intronic
1133348561 16:5086554-5086576 CCAGCTACTCAGGAAGTGGGAGG - Intronic
1133422694 16:5660338-5660360 CCAGCTAAGCCGAAAACGCGAGG - Intergenic
1135528804 16:23234752-23234774 CCAGCTACTCAGGAGGTGGGAGG + Intergenic
1135934095 16:26764546-26764568 CCAGCACAGGAGAAAGAGGGAGG + Intergenic
1136027934 16:27481922-27481944 CTGGCTAATCAGAAAGTGTGGGG - Intronic
1136708554 16:32212184-32212206 CCAGCTCAGCAGAGGCTGGGAGG + Intergenic
1136759353 16:32717228-32717250 CCAGCTCAGCAGAGGCTGGGAGG - Intergenic
1136808754 16:33153158-33153180 CCAGCTCAGCAGAGGCTGGGAGG + Intergenic
1137547500 16:49414639-49414661 TCATTTAAGGAGAAAGTGGGGGG - Intergenic
1137596789 16:49729139-49729161 ACAGCTTAGCAGAAGGTGTGGGG + Intronic
1137725445 16:50653657-50653679 CCAGCTAAGGAGGAAGAGGAAGG + Intergenic
1137949954 16:52774218-52774240 CCAGCTATTCAGAAGGTGGAAGG + Intergenic
1141820176 16:86440340-86440362 TCAGCAAGGCAGTAAGTGGGGGG - Intergenic
1142009319 16:87705861-87705883 CCAGCTTAGCTGAGAGTGTGAGG + Intronic
1203061508 16_KI270728v1_random:977537-977559 CCAGCTCAGCAGAGGCTGGGAGG - Intergenic
1144026665 17:11282805-11282827 GCTGCCAAGCAGCAAGTGGGAGG + Intronic
1149325113 17:55522248-55522270 CCAGCTATGCAGATAATCGGAGG - Intergenic
1150298930 17:64032344-64032366 CCAGCTCAGCAGGAGGTGGATGG - Intergenic
1150936225 17:69638590-69638612 CCAGCCATGAAGAAAGTAGGAGG - Intergenic
1151496064 17:74458846-74458868 CCAGCACAGCAGAAAGATGGAGG - Intergenic
1151968500 17:77444808-77444830 CGGGCTAAGAAGTAAGTGGGCGG + Intronic
1156018902 18:32577492-32577514 CCTGCTAACTAGAAAGTGGGAGG - Intergenic
1160562376 18:79766734-79766756 CCAGCTAAGCCGGAAGAGGAGGG - Intergenic
1161320253 19:3637739-3637761 ACTGCCAAGCAGAAGGTGGGGGG + Intronic
1163565445 19:18048456-18048478 CCAGCGATCCAGGAAGTGGGGGG + Intergenic
1166594005 19:44028252-44028274 CCAGCTAAGCAGAAAGTGGGAGG - Intronic
1166809846 19:45508424-45508446 CCAGTTAAGCAGATTGTGTGCGG - Intronic
926085944 2:10020416-10020438 CCAGCTACTCAGGAGGTGGGAGG - Intergenic
926145900 2:10397028-10397050 CCAGCTCAGCAGAAAGAGCAGGG + Intronic
927366431 2:22302393-22302415 CCAGGCAAACTGAAAGTGGGAGG - Intergenic
927644420 2:24867873-24867895 ACTAATAAGCAGAAAGTGGGGGG + Intronic
928680803 2:33700339-33700361 CCAGCAAAGCAGTAAGGAGGTGG - Intergenic
929797435 2:45071081-45071103 CCAGCTGAGCAGAACTTGGGGGG + Intergenic
933682335 2:85113286-85113308 TCATCTTGGCAGAAAGTGGGTGG - Intergenic
933767539 2:85720333-85720355 CCAGCTAAGTGAATAGTGGGGGG + Intergenic
935810023 2:106788574-106788596 TCACATGAGCAGAAAGTGGGCGG - Intergenic
937733912 2:125266411-125266433 CCAGCTACTCAGGAGGTGGGAGG + Intergenic
938954321 2:136284149-136284171 GCAGCTCAGAGGAAAGTGGGTGG - Intergenic
939457256 2:142453585-142453607 ACAGCAATGCAGAAGGTGGGAGG + Intergenic
941001233 2:160205501-160205523 TCAGCTAAGCAGCAAGGGGGTGG + Intronic
942223777 2:173796883-173796905 CCAGATAAGCTGAAACAGGGGGG + Intergenic
942306457 2:174612001-174612023 CCAGCTACTCAGGAGGTGGGAGG - Intronic
942578939 2:177395570-177395592 CCAGCTAAGTAGGAAGTAGAAGG - Intronic
943093797 2:183404806-183404828 CAAGCAAAGCAGCAAGGGGGAGG + Intergenic
943509355 2:188804596-188804618 CCAGCAAAGGAGAAAGATGGAGG - Intergenic
943971415 2:194412286-194412308 ACAGCAAAGAAGAAAGTGGGAGG - Intergenic
944396389 2:199272456-199272478 CCAGCTGAGCCGAAAGAGTGTGG + Exonic
944844625 2:203656286-203656308 CCAGCTAAGCTTAAAGGAGGTGG + Intergenic
946476177 2:220008677-220008699 CAAGCAAATCAGAAAGTGGTGGG - Intergenic
947882606 2:233532063-233532085 CCAACGAATCAGACAGTGGGTGG + Intronic
948305335 2:236942779-236942801 CAACCTCAGCTGAAAGTGGGTGG - Intergenic
1170014873 20:11769280-11769302 CCAGCTACTCAGAAGGTGGGAGG - Intergenic
1171295358 20:24012401-24012423 CCAGTTGAGCAGGAAGCGGGAGG + Intergenic
1172392520 20:34575468-34575490 CCAGCCAAGCCCACAGTGGGAGG - Intronic
1174174341 20:48635582-48635604 CCAGCCAGGCAGACAGTGTGAGG - Intronic
1178477192 21:32947295-32947317 CTAGGTAAGCAGAAAGGGGCTGG + Intergenic
1178892684 21:36533234-36533256 CCAGCCAGGCAGAGAGTGGCTGG + Intronic
1181025425 22:20124782-20124804 CCAGCCTATCTGAAAGTGGGGGG - Intronic
1181743678 22:24940873-24940895 CCAGCTACTCAGCAGGTGGGAGG - Intronic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
1183281643 22:36935627-36935649 CAGGCTGCGCAGAAAGTGGGAGG + Exonic
1183799868 22:40153297-40153319 CCAGCTTAGGAGAAAGAGGAGGG + Intronic
1184058689 22:42068746-42068768 CTTGCAAAGCAGTAAGTGGGAGG + Intronic
949316713 3:2764502-2764524 GCAGCAGAGCAGAAAGTGGTGGG + Intronic
950587165 3:13902029-13902051 ACAGATAAGCACAAATTGGGTGG + Intergenic
951233496 3:20207401-20207423 ACAGCTAAGCAGAAAGGTGAAGG - Intergenic
951309113 3:21102201-21102223 ACAGCTAACCAGGAAGTGAGAGG - Intergenic
951922654 3:27873189-27873211 TCAGGTCAGCAGAAATTGGGTGG + Intergenic
953100487 3:39820931-39820953 CAACCCAAGCAGAAAGTGGATGG - Intronic
953336553 3:42098937-42098959 CCAGCTGGACAGGAAGTGGGCGG + Intronic
954453856 3:50586410-50586432 CCAGCTATGCCTAAAGGGGGAGG + Intergenic
955684560 3:61537104-61537126 CCAGCTACTCAGGAGGTGGGAGG + Intergenic
957052910 3:75423903-75423925 CCAGCTACTCAGGAAGTGGGAGG - Intergenic
960157082 3:114307113-114307135 CCAGCTGAGCAGAAATCTGGAGG - Intronic
960293146 3:115911464-115911486 CCAGCTACTCAGGAGGTGGGAGG - Intronic
960296923 3:115955758-115955780 CCAGCTAAGCAGGTAGGGTGTGG - Intronic
961301937 3:125927628-125927650 CCAGCTACTCAGGAAATGGGAGG + Intergenic
961710967 3:128827897-128827919 CCATCTACCCATAAAGTGGGAGG - Intergenic
961886537 3:130100204-130100226 CCAGCTACTCAGGAAGTCGGAGG - Intronic
961958029 3:130824506-130824528 CCAGGTAAGCAGATAGTCAGAGG - Intergenic
965222546 3:165945298-165945320 CCAGCTACTCAGGAGGTGGGAGG + Intergenic
966473320 3:180317087-180317109 CAGGCAAAGCAAAAAGTGGGAGG - Intergenic
966734630 3:183179277-183179299 CCAGCTACGCAGAAAGCAGCCGG - Exonic
966870813 3:184289521-184289543 GCAGCCAAGGAGAAAGTGAGCGG + Exonic
967171746 3:186827419-186827441 CCAGCTACGCAGAAAGCAGCCGG + Intergenic
967708480 3:192679481-192679503 CCAGCTACTCAGGAGGTGGGAGG + Intronic
967825918 3:193877288-193877310 GCCCCTGAGCAGAAAGTGGGAGG + Intergenic
968995705 4:3944223-3944245 CCAGCTAGTCAGGAAATGGGAGG - Intergenic
969461872 4:7333305-7333327 CCAGCTAGGCAGAAAGTGAGAGG - Intronic
969758274 4:9164503-9164525 CCAGCTAGTCAGGAAATGGGAGG + Intergenic
969818246 4:9702026-9702048 CCAGCTACTCAGGAAGTGGGAGG + Intergenic
971262714 4:25071496-25071518 CCAGCAAATCAGAAAGGAGGAGG + Intergenic
972086604 4:35225065-35225087 CCAGCTACTCGGAAGGTGGGAGG - Intergenic
972422286 4:38899986-38900008 CTATCTAAGCAGAAAGAGGCTGG + Intronic
973614577 4:52665711-52665733 TCATCTAAGCAAAAAGAGGGAGG - Intergenic
974125076 4:57686111-57686133 CCAGATAAGCAGATAGTGCAGGG - Intergenic
976081880 4:81364916-81364938 CCAGCTAAGTAGAAAGTTGTTGG + Intergenic
978350238 4:107813637-107813659 CCAGCTACTCAGGAGGTGGGAGG - Intergenic
978721904 4:111920021-111920043 ACAGCTAAGGAGAAAATGGGAGG - Intergenic
979531621 4:121774453-121774475 CCAGCAAGGCAGAAGGTGGAAGG - Intergenic
980387931 4:132111063-132111085 CCATCTAGCCATAAAGTGGGTGG - Intergenic
980969348 4:139555393-139555415 CCAGCCAAGCAGGAAGGGGGAGG + Intronic
985030837 4:185787722-185787744 CCAGCAACGCAGATTGTGGGCGG + Intronic
986006688 5:3674113-3674135 CCAGCTCTGTAGAAAGAGGGTGG - Intergenic
986716470 5:10527716-10527738 CCAGCTACGCGGGAGGTGGGAGG - Intergenic
987037832 5:14035908-14035930 CTAGCTAAGTAGGGAGTGGGAGG + Intergenic
988490349 5:31700484-31700506 CCACCTAAGCAGGACATGGGTGG - Intronic
988560928 5:32280482-32280504 CCAGCTAAGTAGAAAATCTGAGG + Intronic
989187860 5:38642432-38642454 CCAGCTAAGGAGAATAAGGGGGG + Intergenic
989240864 5:39201990-39202012 CCTTCTAAGCTGACAGTGGGGGG - Exonic
991254504 5:64599454-64599476 GCAGCTCAGCAGAAGGTGGAGGG + Intronic
991472796 5:66986727-66986749 CCAGCTACTCAGGAAGTGGGAGG - Intronic
991479465 5:67061704-67061726 CTTGTTAAGCAGAAAGAGGGAGG - Intronic
992254246 5:74905819-74905841 CCAGCTACTCAGGAGGTGGGAGG - Intergenic
995014956 5:107299461-107299483 CCAGCTACTCAGAAGGTGGGAGG + Intergenic
997446303 5:133942886-133942908 CCAGCCTAGCAGAAGGAGGGTGG + Intergenic
997642008 5:135455497-135455519 CAAGCTAAGCAGAGAGGTGGGGG + Intergenic
998106732 5:139473595-139473617 CCAGGCACACAGAAAGTGGGAGG - Intergenic
999060375 5:148627620-148627642 CAAGCTAAGGAGTAAGTGAGTGG + Intronic
999159683 5:149485070-149485092 CCAGCTACCCAGAAGGTGGAGGG - Intergenic
999346932 5:150831645-150831667 CCAGCCAAGCAGATAAAGGGAGG - Intergenic
1001872253 5:175167108-175167130 CCAGCTATTTTGAAAGTGGGAGG - Intergenic
1002667309 5:180834523-180834545 TCAGCAAATCAGAAAGCGGGTGG + Intergenic
1006225568 6:32534263-32534285 CCAGCTACTCAGGAGGTGGGTGG + Intergenic
1006805917 6:36789025-36789047 CCAGCTCAGCATTCAGTGGGAGG - Intronic
1007293900 6:40806650-40806672 CCAGCCAAGCAAATACTGGGTGG + Intergenic
1011704714 6:89989501-89989523 CCACCTAAGCAGAAGGGAGGTGG - Intronic
1012115029 6:95285944-95285966 CCATCAAAACAAAAAGTGGGAGG - Intergenic
1015465106 6:133540283-133540305 CCTGTTAAGCAGAATGTTGGAGG - Intergenic
1016608768 6:145964391-145964413 CCAGCGCAGGAGAAAGGGGGCGG - Intronic
1019815608 7:3197598-3197620 CCAGCACTGCAGAAGGTGGGGGG + Intergenic
1020068030 7:5204790-5204812 CCAGCTATGCAAGAAGGGGGAGG - Intronic
1020319984 7:6932642-6932664 CCAGCTACTCAGGAAGTGGGAGG - Intergenic
1021988828 7:26123042-26123064 CCATCTAGCCATAAAGTGGGTGG + Intergenic
1023461983 7:40408408-40408430 CTAAGTAAGCAGAAAGCGGGAGG - Intronic
1024306657 7:47934954-47934976 GCAGCTAAGCAGGAGGTGGGAGG + Intronic
1029128088 7:98309113-98309135 CCAGCGAAGTAGAGAGTGGCAGG - Intronic
1029536596 7:101161018-101161040 GCAGCCAAGGAGAAAGAGGGGGG - Exonic
1030180815 7:106707124-106707146 CCAGCTGGGCAGAAGATGGGAGG - Intergenic
1032072175 7:128814940-128814962 CCAGATAAGCAGAAAGGAGGAGG + Intronic
1033078334 7:138270369-138270391 CCAGCTATTCAGGAGGTGGGAGG - Intergenic
1033452796 7:141476748-141476770 GCTGCAAAGCAGAAAGTGTGCGG - Exonic
1033632941 7:143178980-143179002 CCAGCACAGGAGAAAGTTGGAGG + Intergenic
1034182600 7:149149729-149149751 CCAGCTACTCAGGAGGTGGGAGG + Intronic
1039164867 8:34666924-34666946 CCAGCAAAGAAAAAAGTGGGAGG - Intergenic
1041942314 8:63402300-63402322 CAAGCAAAGCTGGAAGTGGGAGG + Intergenic
1042532914 8:69833169-69833191 CCTGCAAAGCAGAAAGAGGGCGG + Exonic
1042713058 8:71741014-71741036 CCAGCTATACACAGAGTGGGTGG + Intergenic
1044599357 8:93988374-93988396 CCAGCTTAACTGAAAGTGGAGGG - Intergenic
1045011186 8:97960069-97960091 CCAGCTACTCAGAAGATGGGAGG - Intronic
1045153948 8:99444776-99444798 CCAGCTACTCAGGAGGTGGGAGG - Intronic
1046518126 8:115289468-115289490 CCAGCACAGGAGAAAGTTGGAGG + Intergenic
1048730706 8:137437649-137437671 CCAGACAAGTAGAAAGGGGGAGG - Intergenic
1049582609 8:143419758-143419780 CAAATTCAGCAGAAAGTGGGAGG + Intronic
1050203756 9:3176459-3176481 CCAGCTAAGCAAAGAGCTGGAGG - Intergenic
1051758680 9:20435631-20435653 CTATGTAGGCAGAAAGTGGGAGG + Intronic
1052251603 9:26404974-26404996 CCAGATAATCAGAAGGTGGTAGG - Intergenic
1053485471 9:38451339-38451361 CCAGACAAGCAAAAACTGGGGGG - Intergenic
1054955554 9:70905850-70905872 CCAGCTACCCGGGAAGTGGGAGG - Intronic
1055409255 9:76010243-76010265 CCAGTTAATCTGAAAGTTGGTGG - Intronic
1060108003 9:120886418-120886440 GCAGCTAGACAGAAAGTGGGTGG + Intronic
1060433315 9:123569816-123569838 CCAGCAAAGCAGCAAGAGGTGGG + Intronic
1062331637 9:136047495-136047517 CCAGCGAGGTGGAAAGTGGGCGG - Intronic
1062375892 9:136261774-136261796 CCCTCGAAGCAGAAAGCGGGGGG - Intergenic
1185815422 X:3150690-3150712 GCTTTTAAGCAGAAAGTGGGAGG - Intergenic
1186941269 X:14510302-14510324 CCAGCTCAGCAGAAATTTGGTGG - Intergenic
1187317166 X:18206839-18206861 CCAGCTAAGCAGGACGGAGGTGG + Intronic
1189320320 X:40083568-40083590 CCGGCGAAGAAGAAAGGGGGAGG + Intronic
1192061066 X:67826735-67826757 CCAGCTACACAGGAGGTGGGAGG + Intergenic
1198772996 X:140150685-140150707 CTACCTAGGCAAAAAGTGGGTGG + Intergenic