ID: 1166594730

View in Genome Browser
Species Human (GRCh38)
Location 19:44035357-44035379
Sequence CAAGTGAAGAAAAGGGTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166594727_1166594730 19 Left 1166594727 19:44035315-44035337 CCTGTCTCTACTCTGTCAATAGA No data
Right 1166594730 19:44035357-44035379 CAAGTGAAGAAAAGGGTGACTGG No data
1166594725_1166594730 25 Left 1166594725 19:44035309-44035331 CCAAGCCCTGTCTCTACTCTGTC No data
Right 1166594730 19:44035357-44035379 CAAGTGAAGAAAAGGGTGACTGG No data
1166594726_1166594730 20 Left 1166594726 19:44035314-44035336 CCCTGTCTCTACTCTGTCAATAG No data
Right 1166594730 19:44035357-44035379 CAAGTGAAGAAAAGGGTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166594730 Original CRISPR CAAGTGAAGAAAAGGGTGAC TGG Intergenic
No off target data available for this crispr