ID: 1166596931

View in Genome Browser
Species Human (GRCh38)
Location 19:44058556-44058578
Sequence CAACCCAGAAGCAGGTCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 166}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166596931_1166596935 23 Left 1166596931 19:44058556-44058578 CCAGTGGACCTGCTTCTGGGTTG 0: 1
1: 0
2: 1
3: 14
4: 166
Right 1166596935 19:44058602-44058624 GCTATGTATCCAGAGAAGGCCGG 0: 1
1: 0
2: 0
3: 8
4: 130
1166596931_1166596936 26 Left 1166596931 19:44058556-44058578 CCAGTGGACCTGCTTCTGGGTTG 0: 1
1: 0
2: 1
3: 14
4: 166
Right 1166596936 19:44058605-44058627 ATGTATCCAGAGAAGGCCGGAGG 0: 1
1: 0
2: 0
3: 2
4: 104
1166596931_1166596934 19 Left 1166596931 19:44058556-44058578 CCAGTGGACCTGCTTCTGGGTTG 0: 1
1: 0
2: 1
3: 14
4: 166
Right 1166596934 19:44058598-44058620 AATAGCTATGTATCCAGAGAAGG 0: 1
1: 0
2: 0
3: 16
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166596931 Original CRISPR CAACCCAGAAGCAGGTCCAC TGG (reversed) Intronic
900217563 1:1489868-1489890 CGAGCCAGAAGCAGGACCTCGGG - Intronic
900338889 1:2178492-2178514 CCACCCAGAAGCGGGTTCACAGG - Intronic
900338895 1:2178534-2178556 CCACCCAGAAGCGGGTTCACAGG - Intronic
900422318 1:2560957-2560979 CTTCCCAGAAGCAGGCCCAGAGG + Intronic
900539978 1:3197759-3197781 CCACCCAGGAGCTGGCCCACAGG - Intronic
900541629 1:3205853-3205875 CAACCCTGAAGCCGGTGCAGCGG + Intronic
900755750 1:4433413-4433435 CCACACAGAAGCAGGTCACCAGG + Intergenic
902151651 1:14448037-14448059 CCACTCAGAAGCTTGTCCACAGG + Intergenic
902331479 1:15733062-15733084 CAAACCAGAGGCAGAACCACCGG - Intronic
903281144 1:22250719-22250741 CAGCCCAGAAGAAGGAGCACAGG - Intergenic
904961415 1:34336119-34336141 CATCTGAGAAGCAGGGCCACAGG - Intergenic
905812074 1:40920039-40920061 CAACCCAGAAATAGGTCCAGAGG + Intergenic
905893395 1:41530739-41530761 CAACCTAGAAGCAGGTGCCAGGG + Intronic
908983882 1:69992970-69992992 CAACCCACATACAGCTCCACTGG + Intronic
909021905 1:70440946-70440968 GAAGCCAGAAGCAGGTTGACTGG + Intergenic
913601093 1:120421678-120421700 CAAGACAGAAGCAGCTCCAGAGG - Intergenic
914085952 1:144454923-144454945 CAAGACAGAAGCAGCTCCAGAGG + Intronic
914191849 1:145418903-145418925 CAAGACAGAAGCAGCTCCAGAGG + Intergenic
914589774 1:149096904-149096926 CAAGACAGAAGCAGCTCCAGAGG + Intronic
915929090 1:160047533-160047555 CAGTGCAGAAGCAGGTCCAAAGG - Intronic
916676172 1:167065931-167065953 CAGCCAACAAGCAGGTCCCCGGG + Intronic
919378703 1:196826984-196827006 CCTCCCAAATGCAGGTCCACTGG + Exonic
919439057 1:197604462-197604484 CAACACAGCAGAGGGTCCACAGG + Intronic
924379253 1:243446671-243446693 CCACCCAGAAGCTGGGCCAGTGG + Intronic
1063291353 10:4753202-4753224 CAACCCAAATGCCTGTCCACCGG + Intergenic
1074211386 10:111338447-111338469 TAAAGCAGAAGCAGGTCCCCTGG - Intergenic
1075794212 10:125107257-125107279 CAAACCAGAGGAAGATCCACAGG - Intronic
1077194428 11:1272243-1272265 CACCCCCGAAGCGGGTCCCCAGG + Intergenic
1082747100 11:56976050-56976072 CAACCCAGAAACAGCTGCACTGG - Intergenic
1085996371 11:81919701-81919723 CAACCCCAAAACAGGTTCACTGG + Intergenic
1090184237 11:124725779-124725801 CACCCCACATGCACGTCCACTGG + Intergenic
1092804575 12:12207812-12207834 CAAACCATAAACAGGTCCACAGG + Intronic
1095492850 12:42753479-42753501 CAGCCCAGAAGGAGATCCATGGG + Intergenic
1098156209 12:67601753-67601775 CTCCCAAGAAGCAGGACCACAGG + Intergenic
1098393307 12:69992246-69992268 CAACCCAGAAGCTTTTACACTGG - Intergenic
1099648329 12:85390299-85390321 AAAACCAGCAGCTGGTCCACTGG - Intergenic
1100047281 12:90398322-90398344 ACATTCAGAAGCAGGTCCACTGG - Intergenic
1100796011 12:98182507-98182529 GAAGCCAAACGCAGGTCCACAGG + Intergenic
1101079408 12:101167470-101167492 AAACCCAGAAGAAAGTCCACTGG - Intronic
1101458266 12:104860429-104860451 CACCCCAGAAGCCGGTAGACTGG + Intronic
1101643408 12:106605646-106605668 ACACCCAGAAGCAGGTGAACTGG + Intronic
1102001288 12:109559446-109559468 CCACCCAGACCCAGGTCCAGTGG - Intronic
1103468881 12:121164166-121164188 CAGCCCAGAGGCAGGCACACTGG - Intronic
1104535883 12:129617684-129617706 GAACCAGGAAGCAGGTCCTCTGG - Intronic
1106701058 13:32229056-32229078 CAACCCAGAAGCAGCTGCCAAGG + Intronic
1110623411 13:77624592-77624614 CAACCCAGAACAAGCTCCAAAGG + Intronic
1113176169 13:107566523-107566545 CCAACAAGAAGCAGGTCCAAGGG + Intronic
1113568697 13:111338115-111338137 CACCCCAGAAGCAAGGCCGCAGG - Intronic
1115881917 14:37928882-37928904 CAACCCAGAAAGAAGTCTACGGG + Intronic
1118280341 14:64422637-64422659 CAGTCCAGAAGCAGCTACACTGG - Intronic
1120018939 14:79506228-79506250 CTACCAAGAAGCAGGATCACTGG + Intronic
1122576566 14:102746728-102746750 CAGCCCAGAAGCAGGCTCCCTGG - Intergenic
1123207204 14:106725070-106725092 CATCTCAGAAGCAGATCCCCTGG - Intergenic
1123212228 14:106772073-106772095 CATCTCAGAAGCAGATCCCCTGG - Intergenic
1123481965 15:20640548-20640570 CAGCCCTGGAGCAGGTTCACAGG - Intergenic
1123581523 15:21718886-21718908 CAGCCCAAGAGCAGGTGCACAGG - Intergenic
1123618172 15:22161509-22161531 CAGCCCAAGAGCAGGTGCACAGG - Intergenic
1123636047 15:22359817-22359839 CAGCCCTGGAGCAGGTGCACAGG + Intergenic
1126532947 15:49731359-49731381 TCACACAGAAGCAGGACCACTGG - Intergenic
1128776815 15:70326705-70326727 CACCTCAGAAGCTGGTCCATCGG - Intergenic
1129200189 15:73994019-73994041 CAACCTAGGAGCAGGTGCCCTGG - Intronic
1132222577 15:100116164-100116186 CAACCCTGAAGCGGGTCCTGGGG + Intronic
1133981053 16:10633546-10633568 CAAGCCAGCAGCAGGTCTGCTGG + Intronic
1134103561 16:11469805-11469827 CAGCCCAGGACCATGTCCACAGG + Intronic
1138332207 16:56224185-56224207 CAAGCCAGAAGCTGGTCCAGTGG + Intronic
1140757509 16:78081467-78081489 CACCCAGGCAGCAGGTCCACAGG - Intergenic
1141680614 16:85541635-85541657 CAACTCAGAAACAGGACCTCAGG - Intergenic
1142197488 16:88745453-88745475 CCACCCAGAAGAAGGTGCAGGGG + Intronic
1142346329 16:89556400-89556422 CACCCCAGGGGCAGGTCCACCGG + Intronic
1143757820 17:9079669-9079691 GAACCAGGAAACAGGTCCACTGG - Intronic
1143757845 17:9079749-9079771 GAACCAGGAAACAGGTCCACTGG - Intronic
1145123588 17:20282009-20282031 CAGCCCAACAGCAGTTCCACTGG - Intronic
1146280606 17:31541882-31541904 CAACCCTGCACCAAGTCCACTGG + Intergenic
1147120702 17:38333646-38333668 CTACTCAGAAGCAGGTATACAGG - Intronic
1150023252 17:61642988-61643010 AAACAAACAAGCAGGTCCACAGG + Intergenic
1150803964 17:68304231-68304253 GAATCAAGCAGCAGGTCCACAGG + Intronic
1151480685 17:74368654-74368676 CAGCCCACAAGCAGGTACCCGGG - Intronic
1151854753 17:76712900-76712922 CAACCCAATAGCAGATCCACAGG + Exonic
1152578775 17:81156906-81156928 CAACTCAGAAGCAGGGCCCTGGG + Intronic
1152640896 17:81448795-81448817 CCACCCAGAAGCAGGGACTCTGG - Intronic
1152701796 17:81823161-81823183 CATCCCAGGGGCAGGACCACAGG + Intronic
1152914480 17:83026368-83026390 CAGCCCAAAAGCCTGTCCACAGG + Intronic
1157003926 18:43559588-43559610 TCACACAGAAGCAGGGCCACTGG + Intergenic
1161057595 19:2198444-2198466 CCACCCAGACGCAGATCCAGAGG - Intronic
1161468278 19:4444110-4444132 CAACCCGGAATCAGGTCCTGGGG + Intronic
1164418218 19:28063627-28063649 CTCCCCAGAGTCAGGTCCACAGG - Intergenic
1164850247 19:31477252-31477274 CAGCCCAGAAGCAGGACCACAGG - Intergenic
1165071566 19:33258571-33258593 CAGCCCAGACACAGATCCACAGG - Intergenic
1166043568 19:40217057-40217079 CTACCTAGAAGCAGCTCCGCGGG + Intronic
1166596931 19:44058556-44058578 CAACCCAGAAGCAGGTCCACTGG - Intronic
1167236382 19:48318498-48318520 CAGCCCAGAACCAGGTCAAGCGG - Exonic
925657944 2:6169429-6169451 CAAACTAGAATGAGGTCCACAGG + Intergenic
926098538 2:10098375-10098397 GAACCCAGAAGAAGGGCCAAGGG + Intergenic
928174569 2:29024897-29024919 CTCCCCAGGAGCAGGTCCAGTGG - Intronic
928380058 2:30809937-30809959 GAACACAGCAGCAGGTCCAGCGG + Intronic
929414612 2:41734734-41734756 CCTCCCTGCAGCAGGTCCACTGG + Intergenic
929558771 2:42942624-42942646 CAATCCAGAAGCAGGCACAATGG - Intergenic
930798691 2:55419994-55420016 CAATCCAGAGGCAGCTGCACGGG - Intergenic
931204936 2:60137773-60137795 CAACCCAGAAGCCTGTCCTAAGG + Intergenic
932904877 2:75738785-75738807 CAAGCCAGGAGCATGTCCGCAGG - Intergenic
934512175 2:94954253-94954275 CAGCCCTGGAGCAGGTGCACAGG - Intergenic
935075085 2:99733756-99733778 AGACCCAGAAGCAGATCCACAGG - Intronic
937475111 2:122208392-122208414 AAACCCACAAGGAGCTCCACCGG - Intergenic
938142711 2:128809824-128809846 CAGCTCAGAATCAGGTCCATTGG - Intergenic
944400826 2:199324180-199324202 CATCCCAGACGAAGGTTCACAGG + Intronic
944635146 2:201668845-201668867 CAAACCAGAAGCAGGCACCCTGG + Intronic
947909018 2:233789665-233789687 CAGCCCAGGAGCTGGGCCACGGG + Intronic
948707875 2:239806422-239806444 GAGACCAGAAGCAGGTCCCCTGG - Intergenic
948790651 2:240374848-240374870 AAACCCTGAAGCAGCTCCTCTGG + Intergenic
1173197965 20:40931580-40931602 CAACCTAGAAGCAGCTGCACAGG + Intergenic
1173908877 20:46649421-46649443 GAACCCAGGAGCAGATCCAAGGG - Intronic
1175487551 20:59356322-59356344 AACCCCAGATGCAGGTCCCCTGG - Intergenic
1178737839 21:35168666-35168688 CAAGCTAGGAGCAAGTCCACAGG + Intronic
1181179277 22:21055635-21055657 CAAGCCGGGAGCAGGTCCCCAGG + Intronic
1181756076 22:25025978-25026000 CCACCCAGAATCAGGGCCATTGG - Intronic
1185222683 22:49636842-49636864 TGACACAGACGCAGGTCCACAGG + Intronic
950229523 3:11264230-11264252 CAAACCTGAAGTAGCTCCACAGG - Intergenic
955392802 3:58533602-58533624 CCACCTAGAAGCAGCTTCACAGG - Intronic
956399677 3:68863647-68863669 CAACCCAGAAGCTGGAAGACTGG - Intronic
961828861 3:129612996-129613018 GAACCCAGATCCAGGGCCACAGG - Intergenic
962423208 3:135246250-135246272 CAACCCAGAAGGAGCTCTAGGGG + Intronic
965776377 3:172235999-172236021 CATCTCAGAAGCAGCTCAACTGG + Intronic
968609727 4:1551487-1551509 CAACCCACATGCAGGGACACAGG - Intergenic
969129524 4:4981314-4981336 CAAGGCAGAAGCAAGGCCACAGG - Intergenic
970771316 4:19615586-19615608 CAGGCCAGTACCAGGTCCACAGG - Intergenic
971013590 4:22464946-22464968 TTCCCCAGAAGCAGGTCCCCAGG - Intronic
977911725 4:102545174-102545196 CAACCCATCTGCAGGTCCAGAGG + Intronic
982123176 4:152161269-152161291 CTCCCCAGAAGCAGGTTCCCGGG + Intergenic
985640770 5:1062631-1062653 CAAACCAGGAGCAGGTGCTCGGG + Intronic
986884854 5:12220989-12221011 GAACCCAGAAACAAATCCACAGG - Intergenic
989279814 5:39627916-39627938 CAATCCAGCGGCTGGTCCACTGG - Intergenic
990115609 5:52386946-52386968 AAACCCAGAAGCAGCTCTGCTGG + Intergenic
993984536 5:94582195-94582217 CAACACTGCAGCAGGGCCACCGG - Intronic
996081238 5:119260648-119260670 CAAACCAAAAGCATTTCCACTGG + Intergenic
997227198 5:132217926-132217948 CAGCACAGAAGCAAGTCCCCTGG + Intronic
999398217 5:151244348-151244370 CCACCAAGAAGCAGAGCCACAGG + Intronic
999437084 5:151571328-151571350 CACCCCAGTCCCAGGTCCACTGG + Intergenic
1000998488 5:167982486-167982508 GAACACAGAAGCGGGCCCACAGG - Intronic
1001368911 5:171176038-171176060 CAAACCAGAGCCAGCTCCACAGG - Intronic
1001923603 5:175619772-175619794 CAAGCCACAAGCAGGTGCTCAGG + Intergenic
1003352331 6:5329743-5329765 CAACCCAGGAGGAGATACACAGG + Intronic
1005294695 6:24413658-24413680 TAACCCGGAAGCAGTTCCTCTGG + Intronic
1006642015 6:35494527-35494549 CTACCCAGAGGCAGATCCTCAGG + Intronic
1007386313 6:41522599-41522621 TAACCCAGATGCAGGTTTACAGG + Intergenic
1007761709 6:44137152-44137174 CAATCCACAAGCAGGTCAACCGG - Intronic
1014132087 6:117846329-117846351 CCCCACAGAAGCAGGACCACTGG - Intergenic
1019025301 6:168957202-168957224 CAACCCTGGAGCACGTCTACAGG + Intergenic
1021101756 7:16592317-16592339 AAATCCAGAAGCAGCTCAACTGG - Intergenic
1022254883 7:28646029-28646051 CAACCCTGAAGCAGAGCCAGTGG - Intronic
1026877936 7:73890445-73890467 AGACACAGAAGCAGGGCCACTGG - Intergenic
1027198677 7:76048488-76048510 CAAGCCAAGAGCAGGTCCTCTGG - Intronic
1029688626 7:102165734-102165756 CATCCTAGAAGAAGTTCCACGGG - Intronic
1030092030 7:105866215-105866237 CATCACAGAATCAGGTACACCGG + Intronic
1030542431 7:110847733-110847755 GAGCCCAGAAACAGGGCCACAGG + Intronic
1035813927 8:2517733-2517755 AAATCCAGAAGTAGGTACACAGG - Intergenic
1037833086 8:22200621-22200643 CAACACAGGTGCTGGTCCACAGG - Intronic
1038129373 8:24712557-24712579 CACTCCAGCAGCAGGTCAACTGG + Intergenic
1038278130 8:26138968-26138990 CTTCCCAGAAGCAGGATCACTGG + Intergenic
1043728942 8:83650471-83650493 AGATCCAGAAGCAGGTTCACTGG - Intergenic
1048101650 8:131358819-131358841 TCACACAGAAGCAGGTCCACTGG + Intergenic
1048447802 8:134504955-134504977 CACCCCAGACCCAGGTACACGGG + Intronic
1048533615 8:135273016-135273038 CCATCCACAGGCAGGTCCACAGG - Intergenic
1049549701 8:143251379-143251401 CCACCCAGTGGCAGGTCCACAGG + Intronic
1049671009 8:143869864-143869886 CCACCGAGGAGCAGGTCCAGAGG - Exonic
1051362750 9:16295265-16295287 CAGCCCAGAACCAGGTAGACTGG + Intergenic
1055115890 9:72605299-72605321 GAATCCAGAAGCAGATTCACTGG + Intronic
1056240585 9:84642551-84642573 CCACCTAGAAGCAGGTGGACTGG - Intergenic
1056606811 9:88092798-88092820 CAACCCAGAAGCGGGCCAAAGGG - Intergenic
1062325936 9:136012505-136012527 AAACCCAGAGGCAGGTCCCAGGG + Intronic
1062493839 9:136822287-136822309 CAACCAAGGAGCAGGTCTGCAGG - Intronic
1186446997 X:9639140-9639162 AAACCTACAAGCAGGTTCACAGG - Intronic
1190878935 X:54479149-54479171 AAACCCAGAAGCATGTGCTCAGG - Intronic
1190934875 X:54989772-54989794 CAAAACAGAAGCTGGTCCAAGGG + Intronic
1192159280 X:68770685-68770707 CAACCCAGAAACAGACTCACAGG + Intergenic
1193044096 X:77033824-77033846 CTACACAGAAGTGGGTCCACTGG - Intergenic
1193044147 X:77034108-77034130 TCACACAGAAGCAGGCCCACTGG - Intergenic
1193330551 X:80231660-80231682 CTACCCATAAACAAGTCCACTGG - Intergenic
1194424827 X:93723262-93723284 CAAACTAGAAGGAGGTACACAGG - Intergenic
1202054417 Y:20814767-20814789 CTATACAGAAGCAGGTCTACTGG - Intergenic
1202268801 Y:23049531-23049553 AAACCCAGAAGCATGGACACAGG + Intergenic
1202421793 Y:24683271-24683293 AAACCCAGAAGCATGGACACAGG + Intergenic
1202448993 Y:24986807-24986829 AAACCCAGAAGCATGGACACAGG - Intergenic