ID: 1166597717

View in Genome Browser
Species Human (GRCh38)
Location 19:44065004-44065026
Sequence ATGTAGGTCTTTAGGTCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 159}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166597717_1166597721 7 Left 1166597717 19:44065004-44065026 CCCTGTGACCTAAAGACCTACAT 0: 1
1: 0
2: 0
3: 15
4: 159
Right 1166597721 19:44065034-44065056 CATCGTTATTTTTTCTGACATGG 0: 1
1: 1
2: 0
3: 31
4: 589
1166597717_1166597722 8 Left 1166597717 19:44065004-44065026 CCCTGTGACCTAAAGACCTACAT 0: 1
1: 0
2: 0
3: 15
4: 159
Right 1166597722 19:44065035-44065057 ATCGTTATTTTTTCTGACATGGG 0: 1
1: 0
2: 0
3: 26
4: 374
1166597717_1166597723 9 Left 1166597717 19:44065004-44065026 CCCTGTGACCTAAAGACCTACAT 0: 1
1: 0
2: 0
3: 15
4: 159
Right 1166597723 19:44065036-44065058 TCGTTATTTTTTCTGACATGGGG 0: 1
1: 0
2: 1
3: 24
4: 589

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166597717 Original CRISPR ATGTAGGTCTTTAGGTCACA GGG (reversed) Intronic
900657856 1:3768839-3768861 CTGGAGGTCGTGAGGTCACAAGG - Intronic
900902053 1:5523820-5523842 GAGTTGGTCTTCAGGTCACACGG + Intergenic
900902271 1:5525153-5525175 CAGTTGGTCTTCAGGTCACATGG - Intergenic
904947226 1:34208271-34208293 ATGAAGGCCTTTGGGTCAGAGGG + Intronic
907815999 1:57918868-57918890 GTGGAGGTCTTTGTGTCACAGGG - Intronic
908051612 1:60238957-60238979 GTGGAGGTGATTAGGTCACAAGG - Intergenic
908264721 1:62366993-62367015 TTGGAGGTGTTTAGGTCACAAGG + Intergenic
915350693 1:155223361-155223383 TCCTAGGTCTTTAGGTCCCATGG + Intergenic
916329280 1:163596168-163596190 ATGTATACCTGTAGGTCACAAGG - Intergenic
917390439 1:174530377-174530399 CTGTAGCTGTTTAGGTCTCAGGG + Intronic
917838841 1:178961413-178961435 ATGTAGGGTGTTGGGTCACATGG - Intergenic
919925128 1:202188235-202188257 ATGTAGGTGTTGGGGCCACAGGG + Intergenic
921353104 1:214257786-214257808 ATGTGGGTGATTAGGCCACATGG + Intergenic
922047260 1:221958201-221958223 ATGTATATGTGTAGGTCACAGGG - Intergenic
1066341018 10:34533869-34533891 ATGTAGATGTTTAGGGCAAATGG - Intronic
1068293517 10:55036059-55036081 TGGGAGGTCTTTAGGTCAGAGGG + Intronic
1069262349 10:66414608-66414630 CTGTAGTTGCTTAGGTCACAAGG - Intronic
1072622956 10:97092509-97092531 ATGTAGGTATATAGGTCTCTGGG - Intronic
1073934580 10:108615814-108615836 ATGTAGGTCTTTACTTGCCAAGG - Intergenic
1074518600 10:114196531-114196553 ATGTAGCTCTTTGGGTCTCCAGG + Intronic
1076411893 10:130257572-130257594 ATGGAGGCCTTTAGGGCAGATGG - Intergenic
1078892543 11:15570324-15570346 TGGGAGGTATTTAGGTCACAAGG + Intergenic
1079040880 11:17058451-17058473 ATGTAACTCTTAATGTCACATGG - Intergenic
1079801387 11:24874147-24874169 ATGAAGGTTTTTGGGCCACATGG + Intronic
1082740020 11:56900515-56900537 AAGGAGGTCTTCAGGACACAGGG - Intergenic
1084540218 11:69781932-69781954 AGGTGGGTCCTTAGGTAACATGG - Intergenic
1086701302 11:89902892-89902914 ATGTTGCTCCTCAGGTCACAGGG - Intergenic
1086704865 11:89941633-89941655 ATGTTGCTCCTCAGGTCACAGGG + Intergenic
1086874895 11:92083751-92083773 GTGGAGGTATTTTGGTCACAGGG + Intergenic
1087190481 11:95249209-95249231 AAGTGGGGCTTTAGGTCAAATGG + Intergenic
1087242145 11:95791060-95791082 ATGTAGCTCTTTTGGTCACGTGG + Intronic
1087425433 11:97979881-97979903 ATGTAGGTGGTTAAGACACATGG + Intergenic
1087427236 11:98006103-98006125 AAGTAGGTGTTTGGGGCACAGGG + Intergenic
1087790455 11:102400961-102400983 ATGTAGCTCTATAGGTCTGATGG - Intronic
1089279830 11:117366063-117366085 ATTTAGTTCTTTTTGTCACATGG + Intronic
1094315540 12:29134998-29135020 ATGTAGATGTGCAGGTCACAGGG + Intergenic
1097354499 12:58586395-58586417 ATGGAGGCCTTCAGGTCTCAGGG + Intronic
1099060167 12:77897955-77897977 CTGGATGACTTTAGGTCACAAGG + Intronic
1100983670 12:100184989-100185011 ATCTTGCTCATTAGGTCACATGG - Intergenic
1103877270 12:124137941-124137963 ATCTAGTTCTTTAGGTAAGAAGG - Intronic
1105064907 12:133188141-133188163 ATGGAGATCCTTAGGTCAGAGGG + Intronic
1105779430 13:23694113-23694135 ATTTAGATCTTTAATTCACAGGG - Intergenic
1106925198 13:34606339-34606361 TTGGAGGTCATTAGGTCACAGGG + Intergenic
1107645617 13:42491738-42491760 TGGGAGGTGTTTAGGTCACAAGG - Intergenic
1108801011 13:54094170-54094192 ATGTAGGTCTTTAATTCATCTGG + Intergenic
1109321822 13:60819229-60819251 ATGTTGTTCTTTGGGTCACAAGG + Intergenic
1109697565 13:65980003-65980025 TTGGAGGTCTTTAGTTGACAAGG - Intergenic
1110859242 13:80329364-80329386 ATTTAGGTCTTGATGTCACCTGG - Intergenic
1115383140 14:32762847-32762869 ATTAAGATCTTTAGGTCAAAAGG + Intronic
1116605310 14:46985436-46985458 ATGTAAGTTTTTATGTCCCATGG + Intronic
1116756095 14:48949959-48949981 AAGGAGGTGTTTAGGTCATAAGG - Intergenic
1116841883 14:49827062-49827084 ATGCAGGTGTTGAGGTCAGAGGG + Intronic
1118067492 14:62207585-62207607 ATGTTGTTCTTTATGTGACAAGG + Intergenic
1119124547 14:72113451-72113473 ATGTAGGTCTTTGAGTCCCCTGG - Intronic
1120139017 14:80906712-80906734 ATGTAGCTCTTTAAGTCTAAAGG - Intronic
1120382838 14:83804121-83804143 TGGTAGGTAATTAGGTCACAAGG + Intergenic
1124032260 15:26022354-26022376 ATTTGGGTCTTTATGTCAAAAGG + Intergenic
1128075453 15:64822788-64822810 ATGGGGGTCTTCAGGGCACAAGG - Intronic
1134177700 16:12021444-12021466 AAATAGGTCTTTCTGTCACAAGG + Intronic
1138073890 16:54021428-54021450 ATGTAGGCCATTAGATTACATGG + Intronic
1139054109 16:63160631-63160653 TTGTAGGTCTTTAATTCACCTGG + Intergenic
1139399429 16:66668992-66669014 ATGTAGGTTTTTATCTCACTGGG - Intronic
1139717489 16:68825252-68825274 ATGTAAGTGGTTAGGCCACAGGG + Intronic
1141268588 16:82519267-82519289 ATGTAGGTCTTTGGGGCAAATGG + Intergenic
1144208153 17:12993670-12993692 ATGAAGGTCTGTATGTCACACGG - Exonic
1148544335 17:48505580-48505602 ATCTAGTTATTTTGGTCACAAGG + Intergenic
1149432143 17:56602958-56602980 ATGTGTGTCTTAAGGTCACTCGG - Intergenic
1150245605 17:63672519-63672541 ATATAGGTCTCTAGCTCAGAGGG + Intronic
1151009116 17:70473015-70473037 AAGTTGATCTTTAGGTCACTGGG - Intergenic
1156248482 18:35327069-35327091 ATGCAGTACTTTAGTTCACATGG + Intergenic
1156794305 18:41023637-41023659 ATGTAGTTCTTTTGGTAAAAAGG + Intergenic
1158423594 18:57319071-57319093 ATGTAGGTCTGGAGGCCAGAAGG - Intergenic
1159031103 18:63233154-63233176 TTGGAGGTGATTAGGTCACAAGG - Intronic
1159194885 18:65100640-65100662 CTGTTATTCTTTAGGTCACATGG - Intergenic
1160129249 18:76209730-76209752 ATGTCTGTCTCTAGCTCACAAGG + Intergenic
1160468479 18:79104053-79104075 AGGAAGGGCTTTAGGTCACCAGG - Intronic
1164723185 19:30446602-30446624 GTGGGGCTCTTTAGGTCACACGG - Intronic
1165473247 19:36015255-36015277 CTGTAGGACTTGAGGGCACAGGG + Exonic
1166597717 19:44065004-44065026 ATGTAGGTCTTTAGGTCACAGGG - Intronic
1168431034 19:56280801-56280823 TGGGAGGTATTTAGGTCACAAGG - Intronic
1168614958 19:57830152-57830174 ATGTAGTTCCCTAGGTAACAAGG - Intronic
929453869 2:42053202-42053224 GGGCAGGTCATTAGGTCACAGGG - Intronic
931768473 2:65477542-65477564 ATGTAGGTGTCCAGGTCTCAAGG - Intergenic
931884582 2:66603207-66603229 ATGTAGGTATTTAGTGCAAAAGG - Intergenic
931947761 2:67330150-67330172 AGGGAGGTAGTTAGGTCACAAGG + Intergenic
932853548 2:75211252-75211274 ATATAGGTCTTTAATTCACCTGG + Intergenic
932967610 2:76495833-76495855 ATGTAGGTCTTTTCTTAACATGG + Intergenic
940304705 2:152213056-152213078 GTGGAGGTGTTTGGGTCACAGGG - Intergenic
940380204 2:153007232-153007254 ACTTAGGTCTTTAGTTCACTTGG + Intergenic
940678633 2:156755842-156755864 GTGTAGGTGTTTAAGTCACAGGG - Intergenic
941301494 2:163808177-163808199 TTGCAGGTCTGTAGGTCAGATGG - Intergenic
944254680 2:197613700-197613722 ATGAAGGTCATTTGGTAACAAGG - Intronic
945236317 2:207635090-207635112 ATGGAGGTATTTAGGTCATAAGG - Intergenic
1170016290 20:11785958-11785980 ATTCAGCTCTTTAGGTCAAAAGG - Intergenic
1170141296 20:13127470-13127492 ATGTAGGACTTCAGGTCAGCTGG - Intronic
1171836368 20:30154562-30154584 TTGGAGCTCTTTAGGTCCCACGG + Intergenic
1174681094 20:52409205-52409227 ATGTAGTTCTTTAGGTGAGAGGG + Intergenic
1175784681 20:61705100-61705122 ATGTCCCTCTTTAGGACACAGGG + Intronic
1181855403 22:25777784-25777806 ATGGTGGTCTCTAGGTGACATGG + Intronic
1181891786 22:26069629-26069651 TTGGAGGTGTTTAGGTCACAGGG + Intergenic
1184629151 22:45762601-45762623 GTGTATGTGTTTAGGCCACAGGG + Intronic
950759650 3:15209780-15209802 ATGTAAGTCTATAGGAAACAAGG - Intronic
950904229 3:16523114-16523136 TAGTAGGTGTTTGGGTCACAGGG - Intergenic
951926215 3:27911421-27911443 TTGTATGGCTTTAGATCACACGG + Intergenic
956206806 3:66763138-66763160 CTGTAAGTCTTTAGCTAACAGGG + Intergenic
957118144 3:76054279-76054301 ATTTAGTTCTTTAGGTCAGATGG + Intronic
957729580 3:84115866-84115888 ATGTATATGTTCAGGTCACAGGG + Intergenic
961978547 3:131052766-131052788 CTGTAGGGCTTTAGGTCAGAGGG - Intronic
964169215 3:153748594-153748616 TTGGAGGTATTTAAGTCACAAGG + Intergenic
964807092 3:160622340-160622362 ATGAAGGTATTTAGGACACCTGG - Intergenic
968248650 3:197183412-197183434 GTGTAGGTCTTTAGCACAAAAGG - Intronic
971502924 4:27335702-27335724 AGGGAGGTCATTAGGTCACGAGG - Intergenic
971754797 4:30693810-30693832 ATGTACTTCTTAAGGGCACATGG - Intergenic
973605578 4:52584084-52584106 AGGAAGGTGTTTAGGTCACGAGG + Intergenic
973780953 4:54287854-54287876 ATTTTGGGCTTTGGGTCACATGG + Intronic
974617873 4:64313225-64313247 TTGTAAGTATTTAGGTCATATGG - Intronic
977004384 4:91546218-91546240 ATGTAGGTCTATAGTTTACTTGG + Intronic
980885299 4:138756178-138756200 CGGTAGGTATTTAGGTCACGAGG - Intergenic
981752739 4:148108423-148108445 ATGTCATTCTTTAGGTCAAAAGG - Intronic
986530356 5:8730738-8730760 AAGTAAGTGTTTAGGTAACAAGG - Intergenic
986921603 5:12690373-12690395 ATTTGGCTCTTTAGGTCAAAAGG + Intergenic
987683832 5:21171179-21171201 ATATAGTTATTTAGGTCAAAGGG + Intergenic
989946762 5:50243997-50244019 ATGTATGTATTCAAGTCACATGG - Intergenic
991231926 5:64343847-64343869 AGGTAGCTCTTTAGGGCAAAAGG + Intronic
992557323 5:77916323-77916345 AGGGAGGTGTTTGGGTCACAGGG + Intergenic
992560823 5:77951148-77951170 AAAGAGGTGTTTAGGTCACAAGG + Intergenic
995365397 5:111354294-111354316 ATGGAGGTATGTAGGTCAAAGGG + Intronic
995401165 5:111743346-111743368 ATATATTTCTTGAGGTCACAGGG - Intronic
998137488 5:139681870-139681892 ATGAAGGGCTTAAGGGCACAGGG - Intronic
999514498 5:152287418-152287440 TGGGAGGTGTTTAGGTCACAAGG + Intergenic
1000019657 5:157308187-157308209 ATGTACCTCTTTAAGTGACAAGG - Intronic
1000862850 5:166477021-166477043 ATGGAGGTGTTTAGGTCATGAGG + Intergenic
1002970491 6:2012579-2012601 ATGTGAGAATTTAGGTCACAGGG + Intronic
1005457954 6:26039598-26039620 ATTTAGGTCTTTACATCACAAGG - Intergenic
1011177805 6:84584832-84584854 ATAGAGGTGTTTGGGTCACAAGG - Intergenic
1011503309 6:88014084-88014106 ATGGAGGTTTGTAGCTCACAGGG - Intergenic
1013708422 6:112867709-112867731 ATTTGTGTCTTTTGGTCACATGG - Intergenic
1013858605 6:114605987-114606009 CAGAAGGTGTTTAGGTCACAAGG + Intergenic
1016341414 6:143065220-143065242 ATGTATATGTGTAGGTCACAGGG + Intronic
1017178321 6:151525831-151525853 AAGTAGGACTGTGGGTCACAGGG + Intronic
1018285456 6:162232683-162232705 TTCAAGGTCTTTAGATCACAGGG + Intronic
1020312223 7:6876831-6876853 ATGTCACTCTTTATGTCACAGGG + Intergenic
1022339733 7:29456784-29456806 ATGCAGGCATTTAGGGCACAGGG + Intronic
1023758072 7:43438782-43438804 ATGTATTTCTTTAGGTAACAGGG + Intronic
1026528310 7:71174818-71174840 ATGTAGACGTGTAGGTCACAGGG + Intronic
1028213871 7:88108134-88108156 ATGTAAGTCTTTGCATCACAAGG - Intronic
1029028847 7:97447733-97447755 ATGAAGTTCTTTAGGGCAGATGG - Intergenic
1029079837 7:97964117-97964139 ATGTTGCTCTTAATGTCACATGG + Intergenic
1032713776 7:134486727-134486749 ATGGAGGTCCTTAAGACACAGGG - Intergenic
1036210758 8:6839120-6839142 ATGTAGGTCTTTACTCTACATGG - Intergenic
1036766090 8:11550157-11550179 AGGTGGTTCTTTAGATCACAGGG + Exonic
1041575935 8:59395394-59395416 AGGTAGGTTTTTATGTCAAAGGG + Intergenic
1042034369 8:64515332-64515354 ATCTAGGACTTTAAGTCACCTGG + Intergenic
1045798509 8:106074847-106074869 ATGTAGGAGTTTAGCTTACATGG + Intergenic
1046411148 8:113844646-113844668 AATTAGGTAATTAGGTCACAGGG + Intergenic
1047255005 8:123207734-123207756 AGGTGGGTCTTTGGGTCTCAGGG - Exonic
1047550517 8:125867459-125867481 ATGTAAATCTTAATGTCACAGGG - Intergenic
1047937591 8:129797703-129797725 ATGTAAGACTTTATCTCACAAGG - Intergenic
1051597256 9:18837775-18837797 ATTTAGGTTTTTGGGCCACATGG - Intronic
1053031011 9:34777809-34777831 CTGTAGCTGTTTAGGTCTCAGGG + Intergenic
1055015861 9:71617224-71617246 ATGTAAGTCTTTAATTCACCTGG - Intergenic
1056965943 9:91162984-91163006 AGGTAGGTGTTCAGGTCAGAAGG - Intergenic
1058567438 9:106301579-106301601 ATGTATGTCTCTAGTTCATAGGG - Intergenic
1062313865 9:135955754-135955776 AGGTAGATCTTTAGGTCATCAGG - Intronic
1187415890 X:19092972-19092994 AAGTAGGTAAGTAGGTCACAAGG + Intronic
1188280724 X:28265272-28265294 ATGGAGGTAATTAGGTCATAAGG + Intergenic
1188332503 X:28892516-28892538 ATGTATATGTGTAGGTCACAGGG + Intronic
1188333358 X:28898110-28898132 ATGTATATGTGTAGGTCACAGGG + Intronic
1188553132 X:31382954-31382976 ATGTATATGTGTAGGTCACAGGG - Intronic
1188670236 X:32873139-32873161 CTGTAGGTCCTCAGGACACATGG + Intronic
1190390482 X:49926408-49926430 ATGTCTGTCTTTAGATGACAAGG - Intronic
1195019633 X:100813838-100813860 ATGTCTGTCTTTATGCCACATGG - Intergenic
1197310475 X:124899202-124899224 ATGTAGTACTTTAGGTAACAAGG - Intronic
1199335203 X:146611260-146611282 ATGTAAGTCCTACGGTCACAAGG + Intergenic
1201604778 Y:15772622-15772644 ATGTATATGTGTAGGTCACAGGG - Intergenic