ID: 1166597841

View in Genome Browser
Species Human (GRCh38)
Location 19:44066145-44066167
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 2, 1: 1, 2: 5, 3: 19, 4: 196}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166597839_1166597841 -2 Left 1166597839 19:44066124-44066146 CCTGCCAGCAGATCTGGGAAGAA 0: 1
1: 1
2: 1
3: 27
4: 291
Right 1166597841 19:44066145-44066167 AAATTGCAAGTGATTTAACCAGG 0: 2
1: 1
2: 5
3: 19
4: 196
1166597832_1166597841 26 Left 1166597832 19:44066096-44066118 CCAGAAGCAGGACCACATGAAGG 0: 1
1: 1
2: 4
3: 14
4: 149
Right 1166597841 19:44066145-44066167 AAATTGCAAGTGATTTAACCAGG 0: 2
1: 1
2: 5
3: 19
4: 196
1166597836_1166597841 14 Left 1166597836 19:44066108-44066130 CCACATGAAGGGTGGTCCTGCCA 0: 1
1: 0
2: 2
3: 19
4: 211
Right 1166597841 19:44066145-44066167 AAATTGCAAGTGATTTAACCAGG 0: 2
1: 1
2: 5
3: 19
4: 196
1166597840_1166597841 -6 Left 1166597840 19:44066128-44066150 CCAGCAGATCTGGGAAGAAATTG 0: 1
1: 0
2: 3
3: 29
4: 277
Right 1166597841 19:44066145-44066167 AAATTGCAAGTGATTTAACCAGG 0: 2
1: 1
2: 5
3: 19
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903934669 1:26887177-26887199 AAAAGGAAAGTGATTTACCCAGG - Intronic
905831175 1:41069391-41069413 AAATTGAAAGTGATTGCCCCTGG + Intronic
906266207 1:44432143-44432165 AAATTCAAAGTGCTTTAACATGG - Intronic
907933845 1:59024665-59024687 AATTGGCAACTAATTTAACCTGG - Intergenic
908607718 1:65818318-65818340 AAATTACAAGTAATTTAATAAGG - Intronic
909324391 1:74331819-74331841 AAATTCCTAGTGTTTTGACCAGG + Intronic
910334866 1:86116421-86116443 AAAGTACATATGATTTAACCTGG - Intronic
911017466 1:93348424-93348446 AAATTGCAAAAGATTTCAGCAGG + Intronic
913554792 1:119954574-119954596 AAATTGCAAATGTTTTATCAGGG + Intronic
914254480 1:145950225-145950247 CAATTGCAAGAGATTTATCAGGG + Intronic
915792139 1:158684270-158684292 GAATAGCAATTGAGTTAACCAGG + Intronic
916901722 1:169231848-169231870 TGATTCCAAGTGATTTAACTAGG + Intronic
916947050 1:169739349-169739371 AAATTCCAAGTGAGTAAACATGG - Intronic
918721804 1:187861842-187861864 AAGTGGAAAGTGATTTAACAGGG - Intergenic
919304778 1:195818302-195818324 AATTTGGAAGTGAATTCACCTGG + Intergenic
920218545 1:204378372-204378394 AAAGGGGAAGTGATTAAACCTGG + Intergenic
922410414 1:225368617-225368639 CAATTGCAAGAAAATTAACCCGG - Intronic
924751816 1:246900624-246900646 AAAATGCAAGTGAATGAATCTGG - Intronic
924812576 1:247416276-247416298 AAATTCCTAGTGCATTAACCAGG - Intronic
1063068201 10:2631499-2631521 AAATTGAGTGTGATCTAACCAGG - Intergenic
1064050493 10:12055542-12055564 AGATTAAAAGTGATTTAGCCAGG + Intergenic
1064405832 10:15061830-15061852 AAAATGCAAATGGTTTATCCTGG - Exonic
1065001121 10:21338497-21338519 AACTAGCAAGTGGTTTAACAGGG - Intergenic
1067254108 10:44618428-44618450 AAAATGTAAGTGATATGACCAGG - Intergenic
1067542941 10:47169505-47169527 AAATTTCAAATGTTTTCACCTGG + Intergenic
1070345093 10:75533925-75533947 ATATTGCAAGTGACTCAAACTGG + Intronic
1072101583 10:92234251-92234273 AAATAGGAAGTGACTTACCCAGG - Intronic
1073799141 10:107022255-107022277 AGAATGCAAGTTAATTAACCCGG - Intronic
1073941344 10:108702336-108702358 AAAAGGCAAGTCATTCAACCTGG - Intergenic
1074942276 10:118247270-118247292 AACTGGGAAGTGATTTAAACTGG - Intergenic
1078888888 11:15535456-15535478 AATTTGGAAGTGAGTTAAGCAGG - Intergenic
1079807321 11:24949701-24949723 GAATCTCAAGTGATTTAGCCTGG - Intronic
1079858244 11:25633290-25633312 AAATTGCAAGTCTTGTAGCCTGG - Intergenic
1080980665 11:37401578-37401600 AAATTGGAAGTGTGTTAGCCTGG - Intergenic
1083466855 11:62853275-62853297 AAATTGCAAGTTATTTGAGGAGG - Intergenic
1086238516 11:84661109-84661131 AAATTGCAGGTGACTTTACCTGG - Intronic
1086776396 11:90839516-90839538 AAATTACAAGGGATTTAGTCTGG + Intergenic
1088255546 11:107899979-107900001 AAATTGTAAGTGAGGTAACTGGG + Intronic
1088324563 11:108588351-108588373 AAATAGCAAGAGATTTAAAGTGG + Intronic
1088555731 11:111058842-111058864 AAATTGCAACTGACTTGACAGGG + Intergenic
1089179127 11:116568904-116568926 AAACTGCAAGTGATTTGCCTAGG - Intergenic
1089656512 11:119950856-119950878 AAATTGCATCTGATTAAAACAGG - Intergenic
1091099372 11:132856254-132856276 AAATGGGAACTGATTTAACCTGG + Intronic
1093285778 12:17259659-17259681 AACTTGCAAGTAATATAATCAGG - Intergenic
1093405033 12:18794141-18794163 AAACTGCCAATGATTTACCCTGG + Intergenic
1094337359 12:29375043-29375065 GAATTGAAAGTGATTTAATATGG - Intronic
1094708278 12:32936058-32936080 AAATTGGAAGTGGCTTAACTAGG - Intergenic
1095298910 12:40559433-40559455 AAATTGCACCTGATGTAAACAGG + Intronic
1101191765 12:102341273-102341295 AAATTGCAAGTGCTTTCACATGG + Intergenic
1106314332 13:28579778-28579800 AAAATCCAACTGCTTTAACCTGG + Intergenic
1113176108 13:107565850-107565872 AAATTTAAAATGATTTAACTTGG + Intronic
1113847431 13:113400682-113400704 AAACTGCCAGTGACTTCACCAGG - Intergenic
1115117344 14:29897045-29897067 AAATTGTAAGTGGTTTTATCTGG - Intronic
1115653419 14:35420191-35420213 AAATTCCAAGTGAATTGCCCTGG + Intergenic
1116261480 14:42633957-42633979 AAATTGCAACAAATTTAACCAGG + Intergenic
1116324409 14:43513831-43513853 AAATAACAAGTGAAATAACCTGG + Intergenic
1117613553 14:57508708-57508730 AAATAGAAAGTGTTTTTACCAGG - Intergenic
1117645910 14:57852565-57852587 AAATTGCAAGTGCTTGAAGCTGG - Intronic
1118099878 14:62585675-62585697 AACTTACAAGTGATTTAGCAAGG - Intergenic
1119063095 14:71496523-71496545 ACATTGCAAATGGTCTAACCTGG + Intronic
1119281215 14:73409800-73409822 AGATTCCAAGTGATTTTACCAGG + Intronic
1120066381 14:80045834-80045856 AAATTGCCAGAAATCTAACCAGG - Intergenic
1120360606 14:83496776-83496798 AAATTGCAAATCATTTAAACTGG + Intergenic
1120721713 14:87896325-87896347 AAATCGTATGTGATTTAAGCAGG - Intronic
1121213049 14:92223643-92223665 AAAATGCAAGAGTTTTACCCAGG + Intergenic
1123880344 15:24673208-24673230 AAATTACAAGTAATCTCACCTGG + Intergenic
1125467777 15:39971747-39971769 AAACTGTAACTGATTTAAGCTGG - Intronic
1125695318 15:41632347-41632369 AGATTGCAAGTCATGTAGCCTGG + Intronic
1126556103 15:49989175-49989197 AAATTAAAACTGATTTAAACTGG + Intronic
1129613698 15:77081869-77081891 CAATTGCCAGTGATTGTACCAGG + Intronic
1130548058 15:84870716-84870738 AAATTCCAAGTGAAAGAACCTGG + Exonic
1132037164 15:98494045-98494067 CAATGGCAACTGACTTAACCAGG + Intronic
1132437317 15:101818984-101819006 AAATAGCAAGATATTTATCCAGG - Exonic
1133541547 16:6760245-6760267 AAATTGCAAATGGTTTAAAAAGG + Intronic
1138388222 16:56651243-56651265 AGATTGAAAGTGATTAAACAGGG + Intronic
1139102462 16:63785247-63785269 AATTTGCATGTCATTTAAGCTGG - Intergenic
1141967664 16:87457823-87457845 AATTGGCAAGTGAGTTAACTTGG - Intronic
1144371676 17:14597365-14597387 AAATTGAAAGTGGGTCAACCAGG - Intergenic
1146495199 17:33315881-33315903 AACTAGAAAGTGATTGAACCAGG - Intronic
1149821625 17:59784839-59784861 AATTTGCAAGTCATTTAACTTGG - Intronic
1154307223 18:13239484-13239506 AATTAGCTAGTGAATTAACCAGG + Intronic
1155714974 18:28930736-28930758 AAATTGCAAATGAGTTTATCAGG + Intergenic
1155801381 18:30108782-30108804 AAATAGCAAGTAATTTAAGAAGG + Intergenic
1155811620 18:30243396-30243418 AAATGGTAAGTGTTTTTACCTGG + Intergenic
1155946488 18:31858283-31858305 AAGTTGAAAGTAATTTAACACGG + Intronic
1156272111 18:35545202-35545224 AAATTGCAAGTCACGTAGCCTGG + Intergenic
1163905179 19:20146026-20146048 AAATTGCATGTGATGAAACGTGG - Intergenic
1165019559 19:32912618-32912640 AGATTGTAAGTGTTTCAACCAGG - Intronic
1166587741 19:43965885-43965907 AAATTGCAAGTGACCTAACCAGG + Exonic
1166590742 19:43996174-43996196 AAATTGCAAAAGACTTAACCAGG + Exonic
1166594329 19:44031898-44031920 AAATTGCAAGTGACTTAACCAGG + Exonic
1166597841 19:44066145-44066167 AAATTGCAAGTGATTTAACCAGG + Exonic
1166602188 19:44106477-44106499 AAATTGCAAGTGATTTAACCAGG + Exonic
1166604755 19:44130931-44130953 AAATTTCAAGTGACTTAACCAGG + Exonic
1166609298 19:44175579-44175601 AAATTGCAAATGACTTAACCAGG + Exonic
1166614900 19:44234795-44234817 AGGTTGCAAGTGAATTAACCAGG + Exonic
924963109 2:51767-51789 AAACTGCAAGTCATGTATCCCGG - Intergenic
926769171 2:16352692-16352714 AAATGGCAAATGAGTTAAACTGG - Intergenic
929115315 2:38438943-38438965 AAATAGCAAGTGATCTAGCATGG - Intergenic
929980626 2:46675993-46676015 AATTTGTATGGGATTTAACCTGG - Intergenic
930109881 2:47669409-47669431 AAACTGCAAGTGATGTAGCTTGG - Intergenic
930402828 2:50912376-50912398 ATATTGCATGTGATTTAAGATGG + Intronic
931506884 2:62938467-62938489 AATTTGCAAGTTATTTGACTAGG + Intronic
932220084 2:69992503-69992525 AAATCGCAAATGATTTTAACAGG - Intergenic
933769917 2:85736937-85736959 AATTTGCAAGTGGTTTAGCTGGG - Intergenic
935670230 2:105549181-105549203 AAACTGCAATTTATTTAACTAGG + Intergenic
937690123 2:124746081-124746103 AAATTGCAAATGATATAAAGTGG + Intronic
940273985 2:151920015-151920037 TAATTGCAAGGCATTTAACTTGG - Intronic
940773569 2:157863807-157863829 AAATTCCAAGTCTTTTAACTTGG + Intronic
941773333 2:169365145-169365167 AAATTGCAACTGAATTAACCTGG - Intergenic
941860417 2:170273248-170273270 TAATTAAAAGTGATTTAGCCTGG + Intronic
943769449 2:191700619-191700641 AAATTGCAAGGAAATTAAACGGG + Intergenic
943922986 2:193733887-193733909 ATATGCCAAATGATTTAACCTGG + Intergenic
944413084 2:199460540-199460562 AAAATGCAAATGGTTTAGCCAGG + Intronic
945581919 2:211605646-211605668 AAATTACATGTGATATAACTTGG - Intronic
947319625 2:228902057-228902079 AAATTGCAAATAATTTCTCCTGG - Intronic
1173697394 20:45030531-45030553 AAATAGGAAGTAATTTAATCAGG + Intronic
1174688087 20:52474792-52474814 AAATTGTAAGAGGTTTAAGCAGG + Intergenic
1174936246 20:54873264-54873286 AAATAGCTAGTGATTGAACTGGG - Intergenic
1176996688 21:15562994-15563016 AAACTGCAAGAGATTTCACATGG + Intergenic
1178824034 21:36000452-36000474 AAATTGCAGATAATTTAACAGGG - Intronic
1183045530 22:35216636-35216658 ACTATGCAAGTGTTTTAACCAGG - Intergenic
1184439674 22:44501459-44501481 AAACTGCAAGTCATGTAGCCTGG - Intergenic
1185168860 22:49279713-49279735 AAATTTCAAGTGATCTATGCTGG - Intergenic
950469542 3:13175928-13175950 AAATTGCAAGCTAATTACCCAGG - Intergenic
951149295 3:19268491-19268513 AAATCCCAAGTGATCTAACTTGG - Intronic
953034163 3:39197230-39197252 TGAGTGCAAGTGATTTAACCGGG + Intergenic
956534594 3:70261720-70261742 AAACTGCAAGTCATATAACCTGG + Intergenic
957173800 3:76777667-76777689 AAATTGCACGTGCTTTACTCTGG + Intronic
957179917 3:76863167-76863189 AAATTGCAAGGAATTTCACGTGG - Intronic
957661531 3:83161336-83161358 AAATTCCTAGTGGTTGAACCTGG + Intergenic
959559235 3:107760568-107760590 AGAGTGCAAGTGATTTAATAAGG + Intronic
959737985 3:109682971-109682993 AAATTGCATCTGACTTAAGCTGG + Intergenic
959982859 3:112537022-112537044 AAATTGCAAGTGATGTGAGATGG - Intronic
962437071 3:135376783-135376805 AAAGTGCATTTGTTTTAACCAGG + Intergenic
963317225 3:143772493-143772515 GAATTACACATGATTTAACCTGG - Intronic
964388372 3:156173281-156173303 AGATGGCCAGTGAGTTAACCAGG + Intronic
964926019 3:161958972-161958994 TGAGTGCAAGAGATTTAACCAGG - Intergenic
967359312 3:188611507-188611529 CAATTGCAACAGATTTACCCAGG + Intronic
970608505 4:17704579-17704601 ACACTTCAAGTGATTTAACCTGG - Intronic
970776283 4:19678622-19678644 TACTTGTAAGTGATTGAACCAGG + Intergenic
971011804 4:22446291-22446313 AAATTGCCAGTGTTTTTACCTGG - Intronic
971448324 4:26776826-26776848 AAACTGCAAGTGATTTATAAGGG - Intergenic
971541425 4:27821755-27821777 ATATTGAAAGTGATTTAATAAGG + Intergenic
972291750 4:37696085-37696107 AGATTGCAAAAGTTTTAACCTGG + Intergenic
974476280 4:62386095-62386117 AAATTGCCTGTGCTTTAATCTGG + Intergenic
978907224 4:114020696-114020718 AAATCTCTAGTGATTTAAGCTGG - Intergenic
979605649 4:122636044-122636066 AATTTGCAAGTGTTTTAGCAGGG + Intergenic
981066318 4:140490304-140490326 AAATTGCAATTCATATAGCCTGG + Intronic
981174056 4:141659753-141659775 AATATGCAAGAGATTTAAACAGG + Intronic
982188716 4:152830962-152830984 TAATGGCAAGTGCTTTAACTTGG + Intronic
983145301 4:164207247-164207269 AAATTGGCAGTGCTGTAACCAGG - Intronic
984073377 4:175145112-175145134 AAATTTCAAGGGATTAAAACCGG - Intergenic
987164687 5:15183811-15183833 AAATTGTAAATGATTTTTCCAGG - Intergenic
987647464 5:20693010-20693032 ATATTACAAGTGATTTATCTAGG + Intergenic
988733674 5:33999099-33999121 AAAATGCTAGTGATTTAGCTAGG + Intronic
989154434 5:38330670-38330692 AAATTGCAAGTGATCAAGGCAGG - Intronic
990319599 5:54616833-54616855 AACTTGCCTGTGTTTTAACCAGG + Intergenic
991495124 5:67219067-67219089 AAACTGCAAGTCATATAGCCTGG + Intergenic
993347133 5:86798125-86798147 AAATTCCAATTATTTTAACCTGG + Intergenic
994311419 5:98276137-98276159 AAATTGACAGACATTTAACCTGG - Intergenic
994582935 5:101670712-101670734 AACTTGCAAGTTATTGAAACAGG + Intergenic
994826021 5:104713462-104713484 AAATTGCAAGTGAATAATCATGG - Intergenic
995683343 5:114744828-114744850 AAATTGCAACTTATTTAAAGGGG + Intergenic
996501485 5:124221877-124221899 AAAATGCCACTGAGTTAACCAGG - Intergenic
998667912 5:144319541-144319563 AAAATGCATGTTGTTTAACCAGG - Intronic
998881402 5:146648932-146648954 AAAATCCAAGTTATTTAACTTGG - Intronic
999268902 5:150285003-150285025 AAACAGCAAGTGATTCACCCAGG + Intronic
1003158091 6:3613429-3613451 AAATTTAAAGTGACTTATCCAGG + Intergenic
1008328405 6:50215557-50215579 AAATTGCACATTATTAAACCAGG - Intergenic
1009793975 6:68442271-68442293 AAATTGCAAGTGATGTAGCCAGG + Intergenic
1010309631 6:74369689-74369711 AAATTGTAAGAGATTAAAACTGG - Intergenic
1010819139 6:80392920-80392942 AAATTGCATGTTATTTAAGCCGG - Intergenic
1011009373 6:82686427-82686449 AAATAGCAAGTTATTTAACTTGG - Intergenic
1011568489 6:88707352-88707374 AAATTGCATGTGATTTTAGGTGG - Intronic
1011907530 6:92390692-92390714 AAATTGAAAGAGATCTAACTGGG + Intergenic
1012498615 6:99863424-99863446 AAATTGCAGGTGAATTTTCCAGG + Intergenic
1013509374 6:110830557-110830579 AATTTGCATGTGATTAAAACTGG + Intronic
1016114729 6:140266162-140266184 AATTTGCAAGTGATATCATCTGG + Intergenic
1017216865 6:151918296-151918318 CACTTGCATGAGATTTAACCAGG - Intronic
1017298853 6:152833645-152833667 ATATTGCAAGTATTTTAACCTGG + Intergenic
1020075039 7:5252321-5252343 AATTTGCAATTGCTTTAAGCAGG - Intergenic
1021487722 7:21185226-21185248 AAATTGCAAGTGGTTTCAAAAGG + Intergenic
1021624853 7:22583029-22583051 AAACTGCAAGTCATATAACCTGG - Intronic
1024861442 7:53847110-53847132 AAATTGCTAGTGACATAAACAGG - Intergenic
1024927259 7:54630364-54630386 AAATTGCATGTCATGTAAACAGG + Intergenic
1024957185 7:54935011-54935033 AAAATTCAAGTCATTTCACCTGG + Intergenic
1025204028 7:56981223-56981245 AATTTGCAATTGCTTTAAGCAGG + Intergenic
1025667912 7:63595711-63595733 AATTTGCAATTGCTTTAAGCAGG - Intergenic
1026327846 7:69326162-69326184 TAATCACAAGTGATTTACCCTGG - Intergenic
1029839781 7:103349748-103349770 AAATTGAAAGTAACTTAATCAGG - Intronic
1030100786 7:105943422-105943444 AGATAGCAAGCAATTTAACCTGG + Intronic
1030428362 7:109409433-109409455 AAGTTGGAAGTGTTTTATCCAGG - Intergenic
1031698694 7:124895409-124895431 AAATTGCATCTCATTTAACCAGG - Intronic
1033933391 7:146552028-146552050 AAAATGCAACTGATATAAGCTGG + Intronic
1034838820 7:154376642-154376664 CCATTGCAAGTCAATTAACCAGG - Intronic
1043274255 8:78373505-78373527 AAATTGTAAGTGATGAAGCCAGG + Intergenic
1044136085 8:88587484-88587506 AAATAGCAAGTGCTTTAATGGGG - Intergenic
1045719364 8:105089732-105089754 AAAGTTCAAATGATTTAAACAGG + Intronic
1046241542 8:111502008-111502030 AATTTACAAGCTATTTAACCTGG + Intergenic
1047069338 8:121325404-121325426 AAATTCCAAATTATTTAACATGG - Intergenic
1047439416 8:124863541-124863563 AAAATGCATGTGAGTTAACTAGG + Intergenic
1047788753 8:128180833-128180855 ATATGGCAATTGATTTAAACAGG + Intergenic
1049861736 8:144903075-144903097 AAACTGAAAGTCATGTAACCCGG - Intergenic
1050289002 9:4134214-4134236 CAATTGCAAGTGATCTAAATTGG - Intronic
1051718035 9:20005761-20005783 CAAAGGCCAGTGATTTAACCAGG + Intergenic
1052655512 9:31353741-31353763 AAAATGCAAGGGATTTGGCCGGG - Intergenic
1053211478 9:36232435-36232457 AAATTCCAAATGACTTACCCTGG + Intronic
1053593742 9:39538530-39538552 AAATTGCAAGCAAATTAATCTGG - Intergenic
1053851529 9:42293581-42293603 AAATTGCAAGCAAATTAATCTGG - Intergenic
1054572508 9:66826423-66826445 AAATTGCAAGCAAATTAATCTGG + Intergenic
1055791933 9:79931729-79931751 AAATTGCATATGATTTGCCCTGG + Intergenic
1056106769 9:83354922-83354944 AAATTGTAAGTCATTGAACAAGG + Intronic
1056690969 9:88808433-88808455 AAATTGCAAGACATGTATCCTGG + Intergenic
1059993175 9:119884388-119884410 AAATTGCATGTGTTTCATCCTGG + Intergenic
1186074643 X:5864881-5864903 GAAATGCAAATGATTGAACCAGG + Intronic
1186209881 X:7239161-7239183 AAATCACAAGTGATTTAAATAGG + Intronic
1191899318 X:66024334-66024356 AAAGTCCAAATTATTTAACCTGG + Intronic
1193246470 X:79236436-79236458 AAACTGCTTGTGATTTTACCGGG - Intergenic
1194151899 X:90336362-90336384 AAATTCCAAGTGACTTAAATGGG + Intergenic
1195630335 X:107049201-107049223 AGATTGCAAGAGATTTATCTCGG + Intergenic
1195811286 X:108833413-108833435 AAAGTGGAAGAGATTTAATCTGG - Intergenic
1197092130 X:122551770-122551792 GAATAGCAAGTGGTATAACCTGG + Intergenic