ID: 1166599589

View in Genome Browser
Species Human (GRCh38)
Location 19:44082223-44082245
Sequence CAGGACAACCAGCAGGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 500
Summary {0: 2, 1: 0, 2: 3, 3: 37, 4: 458}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166599589 Original CRISPR CAGGACAACCAGCAGGAAGG AGG (reversed) Intronic
900115684 1:1026873-1026895 CAGCTCACCCAGCAGGCAGGAGG - Intronic
900310033 1:2029189-2029211 CATGGCGACCAGCAGGACGGAGG - Exonic
900370056 1:2328295-2328317 CAGGCCAGGCTGCAGGAAGGGGG - Intronic
900397527 1:2459305-2459327 AAGGAGGACCACCAGGAAGGAGG - Intronic
900397532 1:2459321-2459343 AAGGAGGACCACCAGGAAGGAGG - Intronic
900397537 1:2459337-2459359 AAGGAGAACCACCAGGAAGGAGG - Intronic
900397551 1:2459385-2459407 AAGGAGAACCACCAGGAAGGAGG - Intronic
900397570 1:2459449-2459471 AAGGAGAACCACCAGGAAGGAGG - Intronic
900397579 1:2459481-2459503 AAGGAGGACCACCAGGAAGGAGG - Intronic
900397584 1:2459497-2459519 AAGGAGGACCACCAGGAAGGAGG - Intronic
900397589 1:2459513-2459535 AAGGAGGACCACCAGGAAGGAGG - Intronic
900397594 1:2459529-2459551 AAGGAGGACCACCAGGAAGGAGG - Intronic
900397599 1:2459545-2459567 AAGGAGGACCACCAGGAAGGAGG - Intronic
900521539 1:3107764-3107786 CAGCACAACCAGGAGGCAGCTGG - Intronic
900846171 1:5103212-5103234 CAGGAGAGACAGCATGAAGGGGG - Intergenic
901089637 1:6632745-6632767 CTGCATCACCAGCAGGAAGGCGG - Intronic
902242859 1:15100319-15100341 CAGGACCCTCAGCAGGAGGGTGG + Intronic
902275576 1:15337121-15337143 CATGGCCACCAGGAGGAAGGGGG + Intronic
902651256 1:17839079-17839101 CTGGACAACCAGCTGGTAAGAGG - Intergenic
903348700 1:22704579-22704601 TAGGAGAACCATCAGGGAGGTGG - Intergenic
903592220 1:24465692-24465714 GAGGTCACACAGCAGGAAGGTGG - Intronic
903808707 1:26022693-26022715 CAGGACAAGCAGGAGCCAGGAGG - Exonic
904852398 1:33468769-33468791 GGGGACAGCCAGCAGAAAGGAGG - Intergenic
905043171 1:34976851-34976873 CGCGAGCACCAGCAGGAAGGCGG + Intergenic
905682885 1:39886885-39886907 CATGACAACCACCAGAAAGATGG + Intergenic
906086977 1:43144542-43144564 GAGGAAAAACAGCAGAAAGGAGG - Intergenic
906137714 1:43511396-43511418 TAGGACAAACAGATGGAAGGTGG - Intergenic
906188041 1:43876697-43876719 CCAGCCAACCACCAGGAAGGAGG - Intronic
907564210 1:55419501-55419523 CAGCACAACCACCAGCAAGCAGG - Intergenic
907670657 1:56472203-56472225 CATTCCATCCAGCAGGAAGGAGG - Intergenic
908267633 1:62394880-62394902 CAGAACCACCAGAGGGAAGGTGG - Intergenic
910189167 1:84577123-84577145 CAGGCCAACCTTCAGGAAGCAGG + Intergenic
912684557 1:111752091-111752113 CATTGCAGCCAGCAGGAAGGAGG - Intronic
912744227 1:112231732-112231754 CTGCACACCCAGCAGGCAGGTGG + Intergenic
912823820 1:112887711-112887733 CAGCCAAAGCAGCAGGAAGGCGG - Intergenic
913656099 1:120961609-120961631 CATGACAAACAGAAGGAAGCAGG - Intergenic
914044643 1:144080533-144080555 CAGGACAGCCCGAAGGAGGGGGG - Intergenic
914133467 1:144880153-144880175 CAGGACAGCCCGAAGGAGGGGGG + Intergenic
914520657 1:148412841-148412863 CATGACAAACAGAAGGAAGCAGG - Intergenic
915488727 1:156239890-156239912 CTGGGGAACCAGCAGGAGGGGGG - Intronic
915891782 1:159780593-159780615 CAGGGCATCCAGCGTGAAGGAGG + Intergenic
915896268 1:159813557-159813579 AAGGACTTCCAGCAGGATGGTGG + Intronic
916441135 1:164825981-164826003 AAGGACAACCTGGAGGAAGGTGG + Intronic
917097961 1:171418391-171418413 CAGGACAACTAGAAGGAGGTGGG + Intergenic
917498450 1:175564239-175564261 CAGGGCAGGCAGCAGGAGGGAGG - Intronic
918096562 1:181341096-181341118 CAGGACCACCATCAGGACGCGGG - Intergenic
920053980 1:203179714-203179736 CAGGACAAAGAGAAAGAAGGAGG - Intronic
920303791 1:205005987-205006009 CAGAACAAGCACCAGGAAGATGG + Intronic
920414995 1:205793211-205793233 CAGGACACACAGCTGGGAGGAGG + Intronic
921009694 1:211129014-211129036 CTGGAGAACCATCAGGAGGGAGG + Intronic
921039589 1:211416840-211416862 CAGGGTCCCCAGCAGGAAGGTGG - Intergenic
921050673 1:211509079-211509101 CAGGAGAGCCAGCAGCCAGGGGG - Intergenic
921110872 1:212035511-212035533 AAGAAAAACCAGCAAGAAGGCGG - Exonic
921161408 1:212474820-212474842 CAGGACTCCAAGCAGAAAGGGGG + Intergenic
921584422 1:216930746-216930768 CAGGAAAGGCTGCAGGAAGGAGG + Intronic
921650215 1:217669956-217669978 CAGGAGAACAAGCAGAGAGGAGG - Intronic
922171516 1:223159571-223159593 CAGCACCAACAGCAGGAAAGAGG - Intergenic
923548738 1:234944189-234944211 AAGGACAAGGAGGAGGAAGGAGG + Intergenic
923755311 1:236786043-236786065 CAGGACAACCAGCTGCAGAGGGG + Intergenic
924280342 1:242430694-242430716 GAGGAGAACCAGCAGGTAGAAGG - Intronic
1063189753 10:3682274-3682296 CAGGTCACACAGCAGGCAGGCGG + Intergenic
1063431253 10:5990456-5990478 CATTCCAACCAGCAAGAAGGAGG - Intergenic
1064143257 10:12807644-12807666 CAGGACAAGGAGCAGGTAGCCGG - Intronic
1064309065 10:14195669-14195691 CATGATTCCCAGCAGGAAGGTGG + Intronic
1065108925 10:22420930-22420952 CAGGAGAACCAGCAGCAGGTTGG + Intronic
1066453302 10:35550544-35550566 CAGGAGAAGCAGCAGGCATGGGG - Intronic
1066652910 10:37676355-37676377 CAAGAGAAACAGCAGGAATGAGG - Intergenic
1067205767 10:44211500-44211522 CAGGAGAAGCAGCATGAGGGGGG - Intergenic
1067557362 10:47282322-47282344 GAGGGCAGTCAGCAGGAAGGGGG - Intergenic
1068030683 10:51700635-51700657 AAGGACAAGCAGCTGGAAAGAGG + Intronic
1068137487 10:52965219-52965241 CAGGACTACCAGCAGCAGGAGGG - Intergenic
1070168739 10:73916594-73916616 AATGACAACCAGCAAGAAAGCGG - Exonic
1070402776 10:76067977-76067999 CAGGGAAACCTGCAAGAAGGGGG + Intronic
1071712983 10:88067865-88067887 CTGGAGCACCATCAGGAAGGGGG + Intergenic
1072069136 10:91899738-91899760 CAGGGCAAGTAGGAGGAAGGAGG - Intergenic
1072166172 10:92815078-92815100 CAGTCCAGGCAGCAGGAAGGAGG - Intergenic
1072753338 10:97999825-97999847 CAGGACGACCAGCTGCAAAGAGG + Intronic
1072788141 10:98298427-98298449 CAGGTCACCCAGCAGGAATGTGG - Intergenic
1076156015 10:128206564-128206586 CAGGACAACCAGCCAGGAGGAGG - Intergenic
1076661909 10:132061130-132061152 CATCACAACTAGCAAGAAGGTGG - Intergenic
1077098509 11:810248-810270 TAGGGCAGCCAGCAGGTAGGAGG - Exonic
1077134161 11:990432-990454 CAGAACAACAATCAGGAACGAGG - Intronic
1077741369 11:4849134-4849156 CATGCCCACCAGCAAGAAGGTGG + Exonic
1078315134 11:10288542-10288564 CAGGACAACCAGCTGCAGAGAGG - Intronic
1080777616 11:35400979-35401001 CAGGACAACTGGAAGCAAGGAGG + Intronic
1083181119 11:60986307-60986329 CAGTCTCACCAGCAGGAAGGTGG + Intronic
1083530383 11:63416380-63416402 CATGACAACCCGCAGGAATGTGG + Intergenic
1083756057 11:64792232-64792254 CAGGGCGGCCAGCAGGAAGGTGG + Exonic
1083769981 11:64861436-64861458 CAGGGCATACAGCAGGCAGGTGG - Intronic
1083924679 11:65798710-65798732 CAGGACAGCCTCCAGGAAGCAGG + Intergenic
1084795443 11:71501917-71501939 CATGAAGATCAGCAGGAAGGGGG - Intronic
1085258920 11:75193254-75193276 CAGGACCACCAGCAGGAAGATGG - Exonic
1086085059 11:82945432-82945454 CAGGACAACCAGCAGTAGAAAGG - Intronic
1088256504 11:107908433-107908455 GAGGGCAGCCAGCAGGTAGGAGG - Intronic
1088895095 11:114072487-114072509 CAGGACCCCCATCAGTAAGGTGG - Intronic
1089763985 11:120749654-120749676 GAGGACAGACAGCAGGAAGATGG + Intronic
1089893824 11:121907597-121907619 GAGGACAACCAGCTGGCTGGGGG - Intergenic
1090280550 11:125452413-125452435 CAAGACAAACAGCATGCAGGGGG + Intronic
1090656865 11:128852823-128852845 AAGGAAGACAAGCAGGAAGGGGG + Intronic
1090705427 11:129332067-129332089 CAGGAAAATCAGCAGGAACCGGG - Intergenic
1091047116 11:132334603-132334625 CAGGCCAAGCAGCTGGAGGGTGG + Intronic
1091344235 11:134842263-134842285 CGGGACAATCAGCAGGAGGGAGG + Intergenic
1091889886 12:4045041-4045063 CTGGAAGACCAGGAGGAAGGGGG + Intergenic
1092060332 12:5545642-5545664 CAGGAGAAGTAGAAGGAAGGGGG + Intronic
1092228527 12:6764443-6764465 CAGGAAAAATAGGAGGAAGGTGG + Intronic
1092240649 12:6834125-6834147 CAGGACAGGCAGAATGAAGGGGG - Intronic
1092447070 12:8567850-8567872 CTGGACAACCAGCTGCAAAGAGG - Intergenic
1093314728 12:17634148-17634170 CAGAACAAACAGAATGAAGGGGG - Intergenic
1097188799 12:57209850-57209872 CAGCACAAGCAGCCCGAAGGTGG + Exonic
1097986861 12:65792866-65792888 CAAGACAACCACCTGGAAGGAGG - Intergenic
1098188846 12:67926540-67926562 CAGGAGAACTAGGAGGAAGCTGG - Intergenic
1099780128 12:87183428-87183450 CAGGACAACAGCCAGGAGGGAGG + Intergenic
1101022248 12:100565144-100565166 CAGGAGCAACAGAAGGAAGGTGG + Intergenic
1101034047 12:100687330-100687352 CAGGACAACCAGCAGGAAGGAGG - Intergenic
1101807294 12:108075516-108075538 CATTCCAGCCAGCAGGAAGGAGG - Intergenic
1102478254 12:113202665-113202687 CAGTCTAGCCAGCAGGAAGGAGG - Intronic
1102829906 12:115988427-115988449 CAGGACAGACAGCAGGGAAGGGG - Intronic
1102957764 12:117070411-117070433 CAGCCCAGCCTGCAGGAAGGAGG - Intronic
1103320520 12:120090326-120090348 CCAGACAACCAGCTGAAAGGGGG - Intronic
1104072301 12:125356436-125356458 CTGAACACCCAGGAGGAAGGTGG - Intronic
1104143037 12:126006609-126006631 CAGGACAACAAGAAGTAAGAGGG - Intergenic
1104180617 12:126376774-126376796 CAGGCCATGCAGCAGGAAGTTGG + Intergenic
1104307777 12:127624923-127624945 CAGGACAACTGGAAGGTAGGGGG + Intergenic
1104857953 12:131910579-131910601 CACCCCGACCAGCAGGAAGGAGG - Intronic
1105048582 12:133027802-133027824 CAGGACAACCAGCTGCAGAGAGG + Intergenic
1105600748 13:21884842-21884864 CAGGACAAACAGGAGGGGGGTGG + Intergenic
1106760023 13:32859023-32859045 CAGCAGATCCTGCAGGAAGGGGG + Intergenic
1107418709 13:40225217-40225239 GAGGAAAACCAGCAGGGTGGGGG + Intergenic
1107887941 13:44890195-44890217 CAGGAAAACAGGCAGGAAGAAGG + Intergenic
1108593950 13:51934677-51934699 CAGGACAGCCAGCAGCAGGATGG - Exonic
1110061121 13:71039586-71039608 CAGGACATGCAGCAGGGATGTGG + Intergenic
1110972543 13:81783174-81783196 CGGGACAACTAGCAGGTAGTAGG - Intergenic
1112591814 13:100770351-100770373 CAGGACTCCCAGAAGGAAGAGGG - Intergenic
1113333364 13:109353797-109353819 CAGGTAAACCAGGAGAAAGGAGG + Intergenic
1113970733 13:114186257-114186279 CAGGACAACCAGCTTCAGGGAGG + Intergenic
1114281074 14:21192751-21192773 CAGGACAACCAGCTGCAGAGAGG + Intergenic
1115485027 14:33901937-33901959 CAGGACAACCAGCTGCAGAGAGG + Intergenic
1116077292 14:40127185-40127207 CAGAACCACAAGCTGGAAGGAGG - Intergenic
1117630238 14:57683792-57683814 CAGGACTTCCAGTAGGAAAGGGG + Intronic
1117892236 14:60438215-60438237 CAAGTCAACCAGCAGTAAGATGG + Intronic
1118601066 14:67471788-67471810 CAGGGCAGCCAGCAGGGAAGAGG + Exonic
1118746666 14:68779018-68779040 CAGGACAAACAGCCGGAGAGGGG + Intergenic
1118974287 14:70663953-70663975 AAGGTCACCCAGCTGGAAGGGGG - Intronic
1121117965 14:91356886-91356908 GGGGAGCACCAGCAGGAAGGTGG + Intronic
1122286579 14:100655922-100655944 CAGGACCACCAGCAGGAGCCAGG - Intergenic
1122883308 14:104699704-104699726 CAGGACCCCCTGCAGGGAGGAGG + Intronic
1122937746 14:104967745-104967767 CAGGAACACAAACAGGAAGGGGG + Intronic
1123216585 14:106813789-106813811 CAGGACGACCAGCTGCAGGGAGG + Intergenic
1123216596 14:106813845-106813867 CAGGACGACCAGCTGCAGGGAGG + Intergenic
1202936348 14_KI270725v1_random:91540-91562 CAGGACAGCCCGAAGGAGGGGGG + Intergenic
1123411939 15:20067858-20067880 GAGGTAAATCAGCAGGAAGGAGG + Intergenic
1123521283 15:21074977-21074999 GAGGTAAATCAGCAGGAAGGAGG + Intergenic
1124047252 15:26161707-26161729 CAGTACCAGCAGGAGGAAGGTGG - Intergenic
1124219223 15:27834945-27834967 TAGGACATTCAGCAGCAAGGAGG + Intronic
1125332039 15:38591929-38591951 CAGGACAACCAGAAGTTGGGGGG - Intergenic
1127482665 15:59391673-59391695 CAGGGCAGCCAGAAGGTAGGGGG + Intronic
1128498230 15:68210326-68210348 CTGGAGCCCCAGCAGGAAGGGGG - Intronic
1129230171 15:74192656-74192678 CTGGCCAGCCAGCAGGTAGGTGG - Intronic
1129454728 15:75670591-75670613 CAGGGCAGCCAGCAGGAGAGGGG - Intergenic
1130995219 15:88899652-88899674 CAGGACTGGCAGCAGTAAGGTGG - Exonic
1131265234 15:90911627-90911649 CAGGGCCACAAGCAGGAGGGTGG - Intronic
1132979515 16:2729307-2729329 CAGCACAAGCATCAGAAAGGAGG + Intergenic
1133058673 16:3160260-3160282 CAGGACAAGCATCGGGAAAGGGG + Intergenic
1134079856 16:11317206-11317228 CAGGAGACACAGCTGGAAGGAGG + Intronic
1134186310 16:12087825-12087847 CACGTCAACCAGGAGGAAGAGGG - Exonic
1134676814 16:16096507-16096529 GAGGACAGCCAGAAGGAATGTGG - Intronic
1135393999 16:22117097-22117119 CAGGACAGCCTGCAGGGATGAGG - Exonic
1136548368 16:30967913-30967935 CAGGCAAACTAGGAGGAAGGTGG - Intronic
1138394845 16:56695888-56695910 CAGGACAACCAGTAGCAGAGAGG + Intronic
1139469249 16:67169652-67169674 CTGGACATCCAGCAGGAGTGGGG - Exonic
1139923384 16:70473101-70473123 CTGGACCACCAGGAGGATGGGGG + Exonic
1140140871 16:72256295-72256317 CAGGTCAACAGGCAGGGAGGTGG + Intergenic
1141278933 16:82613269-82613291 CAGGAGAAGCAGCAGAAATGAGG - Intergenic
1141775785 16:86121837-86121859 CGGGACAAGCAGGAGGAGGGAGG - Intergenic
1142029420 16:87831157-87831179 GAGGACCACCAGCAGGCAGGTGG - Exonic
1142273693 16:89104601-89104623 CAGGAGAAGCAGAGGGAAGGTGG - Intronic
1203099374 16_KI270728v1_random:1291932-1291954 CAGGACGACCAGCTGCAGGGAGG + Intergenic
1143682983 17:8491441-8491463 TAGGAGACCCAGCAGAAAGGTGG + Intronic
1143853211 17:9828278-9828300 CAGAACATCCTTCAGGAAGGTGG + Intronic
1144807339 17:17976791-17976813 CTGGAAAGCCAGCAAGAAGGAGG + Intronic
1146679953 17:34799916-34799938 GAGAACAAGCAGGAGGAAGGGGG - Intergenic
1146680631 17:34805217-34805239 CAGTCCACACAGCAGGAAGGAGG - Intergenic
1146761540 17:35483028-35483050 CAGGACAACCAGCCGCAGAGTGG + Intronic
1146832501 17:36081971-36081993 GAGAAGAACCAGCAGGAAGTTGG + Intergenic
1146846983 17:36188288-36188310 GAGAAGAACCAGCAGGAAGTTGG + Intronic
1148218336 17:45846033-45846055 CAGCAGGGCCAGCAGGAAGGAGG - Exonic
1148326075 17:46784188-46784210 CATGAGAAACAGGAGGAAGGAGG + Intronic
1149885594 17:60336867-60336889 CAGAACAACCAGCAGGATACTGG - Intronic
1150096616 17:62381682-62381704 GAGGGCAGCCAGCAGGAGGGAGG - Intronic
1150139581 17:62716889-62716911 AAGGACAAGCAGCAGGAGGGTGG + Intronic
1150466291 17:65395602-65395624 CATTGCAGCCAGCAGGAAGGAGG - Intergenic
1150529182 17:65959023-65959045 CAGGACAACCAGCTGCAGAGAGG + Intronic
1150952838 17:69822003-69822025 CAGGACAACCAGCTGCAGAGAGG + Intergenic
1151127900 17:71865091-71865113 CAGGGCAACAAAGAGGAAGGGGG + Intergenic
1151310793 17:73291375-73291397 CAGGCCACCCAGCAGGATTGAGG + Intronic
1151314210 17:73311836-73311858 CAGGGCACCCAGCGCGAAGGCGG + Intronic
1152099094 17:78290707-78290729 AAGGACACTCAGCAGGCAGGCGG - Intergenic
1152188724 17:78875300-78875322 AAGGACAAACAGAAGGAAAGAGG + Intronic
1152352717 17:79792401-79792423 ACGGACAAACAGCAGGACGGAGG + Exonic
1152522231 17:80863214-80863236 CAGGACAAGGAGCACCAAGGGGG + Intronic
1152698666 17:81808384-81808406 TGGGTCAACCTGCAGGAAGGTGG + Intronic
1153778982 18:8477950-8477972 CAGTGGAAGCAGCAGGAAGGTGG + Intergenic
1154066115 18:11108998-11109020 CAGTACCACCAGCACCAAGGTGG + Intronic
1154145205 18:11861247-11861269 AAGGAGAGCCAGCAGGAGGGAGG - Intronic
1155830861 18:30513666-30513688 CAGGACAACCAGTAGTAGAGAGG - Intergenic
1156814966 18:41298594-41298616 CAGTACAACCTGCAGAAATGTGG + Intergenic
1158243644 18:55406095-55406117 CAGCACAGCCAGCAGGAGGCTGG + Intronic
1160973742 19:1782150-1782172 CAAGTCAACCAGCATGCAGGGGG - Exonic
1160974245 19:1784897-1784919 CAGGACCACCAGCAGGATGGAGG + Exonic
1162715928 19:12633481-12633503 CAGGAAAATGAGCAGGAAGCAGG - Intronic
1162934577 19:13975273-13975295 CAGGAGAACCACCCTGAAGGTGG + Intronic
1162950753 19:14070981-14071003 CTTGACATCCAGCAGGATGGAGG - Intergenic
1163602477 19:18257408-18257430 CAGGGCAGCCAGCTGGTAGGCGG + Exonic
1166230277 19:41422454-41422476 CAGGACGAGAACCAGGAAGGAGG - Intronic
1166592182 19:44009294-44009316 CAGGACCACCAGCCAGAAAGGGG - Intronic
1166597281 19:44060959-44060981 CAGGGCCACTAGCTGGAAGGAGG - Intronic
1166599589 19:44082223-44082245 CAGGACAACCAGCAGGAAGGAGG - Intronic
1166686033 19:44796884-44796906 CAAGAGAGCCAGCAGGAAGCGGG + Intronic
1167655166 19:50759029-50759051 CAGGAAGCCCAGCAGGAAGTGGG - Intergenic
1168099477 19:54133681-54133703 CAGGACAAGCAGCAGCCTGGTGG + Intergenic
1168351426 19:55678340-55678362 CAGGGGCCCCAGCAGGAAGGAGG + Intronic
1202684201 1_KI270712v1_random:33952-33974 CAGGACAGCCCGAAGGAGGGGGG - Intergenic
925273131 2:2629356-2629378 CAGGACAAGCACCAGGCATGTGG - Intergenic
925553684 2:5104990-5105012 CAGGAGCACCAGCTGGAGGGAGG + Intergenic
928287392 2:30004760-30004782 CAGAAGAGCCAGCACGAAGGAGG - Intergenic
929481532 2:42312897-42312919 CAGGACAACTTGAAGGTAGGTGG - Intronic
930227535 2:48809499-48809521 CATTACAGCCAGCAGGATGGAGG - Intergenic
931217457 2:60260003-60260025 CAGGAGACCCAGGAGGAAGCTGG - Intergenic
931464558 2:62475124-62475146 CAGGAGAAGCAGCAGGAAGGGGG + Intergenic
932500567 2:72179514-72179536 AAGGAGAACCTGCAGGAAGCAGG + Intronic
933864634 2:86505051-86505073 CAAGACAACCAGCTCGAAGCAGG + Exonic
934247518 2:90320900-90320922 CAGGACAGCCCGAAGGAGGGGGG + Intergenic
934261806 2:91481701-91481723 CAGGACAGCCCGAAGGAGGGGGG - Intergenic
936514686 2:113174233-113174255 CGGGACACAGAGCAGGAAGGGGG - Intronic
937928059 2:127183011-127183033 AAGCACACCCATCAGGAAGGTGG - Intergenic
938105353 2:128526312-128526334 CAGGAGAACCAGAGGGAGGGTGG - Intergenic
938370395 2:130764521-130764543 TTGAACAGCCAGCAGGAAGGGGG + Exonic
938849413 2:135245298-135245320 CTGGGCAATCAGCAGGAAGTTGG + Intronic
940413120 2:153389361-153389383 CAGGAGTACCAGCAGGGAAGTGG + Intergenic
941686114 2:168450767-168450789 CAGGAGAACCACCTGGGAGGTGG + Intergenic
942193467 2:173494101-173494123 AATGACAACCAGCAGAAAGCAGG - Intergenic
942765821 2:179455383-179455405 CATGAGAACCAGCAGCATGGAGG - Intronic
943773121 2:191740333-191740355 CATGACAACCAGCAGACAGCTGG - Intergenic
943820398 2:192314641-192314663 CAGGACAACCAGCTGCAGAGAGG - Intergenic
946211451 2:218150461-218150483 CAGCACCAGGAGCAGGAAGGTGG - Intergenic
947064760 2:226210688-226210710 CAAGACAACCAGGTGGAGGGAGG - Intergenic
947316708 2:228866622-228866644 CAGGACAACCAGCTGCAGAGAGG + Intronic
947713342 2:232328159-232328181 CAGGACACCCAGCAGGTAAAAGG - Intronic
947855259 2:233319637-233319659 CAGGGCACCCAGGAGGAAGGTGG - Intronic
948840491 2:240646476-240646498 CAGGACACCCAGCCCGAAGCCGG - Intergenic
1168862060 20:1052650-1052672 CAGGACAAAGAACAGGGAGGTGG + Intergenic
1170273957 20:14562735-14562757 CAAGAGACCCAGCAAGAAGGAGG - Intronic
1170836503 20:19889141-19889163 CAGGAAATCCTGCTGGAAGGGGG - Intronic
1172873938 20:38152859-38152881 GAGGCCAAGCAGGAGGAAGGGGG + Intronic
1172904624 20:38359893-38359915 CAGGAGTACCAGCAGGAATGGGG + Intronic
1172983481 20:38962661-38962683 CAGGACAAGCATCAGTAACGAGG - Intronic
1173186008 20:40840801-40840823 AAGGAAAAACAGAAGGAAGGAGG + Intergenic
1173339304 20:42139404-42139426 CAGGAATACCAGTAGGAAAGGGG + Intronic
1173372173 20:42446861-42446883 CAGGATTACCAGATGGAAGGAGG - Intronic
1173395892 20:42679020-42679042 CAGCAGACCCAGCAGGAATGAGG + Intronic
1173667111 20:44771032-44771054 AAGGTCACACAGCAGGAAGGGGG + Intronic
1173801793 20:45898742-45898764 CAGGACAGCCCACAGGGAGGTGG + Exonic
1174166444 20:48586910-48586932 CAGTACAAGCAGCTGGAAGACGG - Intergenic
1174369452 20:50076776-50076798 CAGGGCCACCAGCAGCAATGAGG + Intergenic
1174721764 20:52820331-52820353 CAGAAGAAACAGCAGGAATGGGG + Intergenic
1175326842 20:58135492-58135514 CAGGTAAGCCAGCAGGGAGGCGG + Intergenic
1175948401 20:62569458-62569480 CAGGACCTCGGGCAGGAAGGTGG - Intronic
1175961910 20:62641790-62641812 CAGGACAGACGGCAGGAAGCCGG + Exonic
1176159670 20:63641867-63641889 CAGGGCTAGCAGCAGGCAGGGGG - Intronic
1176257297 20:64158946-64158968 CAGGAGAAGCAGGAGGAAGCAGG - Intronic
1176587149 21:8598059-8598081 CAGGACAGCCCGAAGGAGGGGGG - Intergenic
1178382481 21:32122286-32122308 CAGGTCTACCAGCAGGGTGGAGG + Intergenic
1179169555 21:38962414-38962436 CAGGATGCCCAGCAGGAAGTGGG - Intergenic
1179297901 21:40079629-40079651 CAGGAACTCCAGAAGGAAGGAGG - Intronic
1179822752 21:43946129-43946151 CAGGACAACCAACTGGAAGCTGG - Intronic
1179937159 21:44613083-44613105 CAGGGGACCCAGCAGGCAGGTGG - Intronic
1179939600 21:44629017-44629039 CAGACCAGACAGCAGGAAGGAGG + Intronic
1179944037 21:44658628-44658650 CAGCTCAGCCATCAGGAAGGTGG - Intronic
1180244625 21:46538920-46538942 CAGGACAAAGGGCAGGAGGGTGG - Intronic
1180269980 22:10575056-10575078 CAGGACAGCCCGAAGGAGGGGGG - Intergenic
1180587927 22:16909807-16909829 CAGGACAGCCCGAAGGAGGGGGG + Intergenic
1180897408 22:19346909-19346931 AAGAATAATCAGCAGGAAGGAGG + Intronic
1180898264 22:19353114-19353136 CAGGACAGGCAGCAGGACGGAGG - Intronic
1180905183 22:19405504-19405526 CAGGACAAACAGCAGAACGTGGG + Intronic
1182332419 22:29560784-29560806 CAGGAGAACCAGGAGGCAGTGGG - Exonic
1182741504 22:32571294-32571316 CAGAACAACCAGTAGGCAGCGGG + Intronic
1182851103 22:33475038-33475060 CAGGACATGCACCAGGGAGGGGG + Intronic
1183505242 22:38205117-38205139 CAAGACCACCAGCAGAATGGAGG - Intronic
1184282656 22:43447068-43447090 CAGAACCACCAGCAGGGGGGAGG - Intronic
1184300037 22:43553275-43553297 GAGCAGAACCAGGAGGAAGGAGG + Intronic
1184403265 22:44286118-44286140 CAGGGGCACCTGCAGGAAGGAGG - Intronic
1184751520 22:46489062-46489084 CTGGGTGACCAGCAGGAAGGTGG - Intronic
1184918104 22:47587104-47587126 CAGGACAGCCAGCAGGAGAGAGG - Intergenic
1184997343 22:48217993-48218015 GAGTGCAAACAGCAGGAAGGAGG - Intergenic
1185100160 22:48836077-48836099 CAGGACAACAGGCAGGCTGGAGG - Intronic
949392157 3:3574189-3574211 GAGGAAAAACATCAGGAAGGTGG + Intergenic
949506620 3:4734405-4734427 AAGGACAAGCAGCATAAAGGAGG + Intronic
950090382 3:10290531-10290553 CAGGGCACTCAGCAGGGAGGGGG + Intronic
950223242 3:11212652-11212674 CATTAAAACCAGCAGGATGGTGG - Intronic
950263779 3:11560390-11560412 CAGGACAGCCAGCAAGGAGCTGG + Intronic
950421574 3:12902736-12902758 CAGGACAGCCAGCTGGACAGAGG + Intronic
950657915 3:14448729-14448751 GAGGACAAACATCAGAAAGGTGG + Intronic
950889195 3:16387913-16387935 GAAGAAAACCAGCAGAAAGGTGG - Intronic
951387581 3:22061413-22061435 CAGGACTTCCAGCAGGGATGTGG - Intronic
952603941 3:35121076-35121098 GAAGACAAGCAACAGGAAGGTGG + Intergenic
953449729 3:42996104-42996126 CAGGGCAACCAGCAAACAGGGGG + Intronic
953881105 3:46691901-46691923 AAGGACAAACAGGTGGAAGGGGG + Intronic
954660939 3:52226466-52226488 CAGGACAGCCAGAAGGGAGGTGG - Intergenic
954873846 3:53787725-53787747 CATGAGGACCAGCAGGAAGAGGG + Intronic
955241485 3:57182524-57182546 CAAGACAACCAGCAGCAGAGAGG - Intergenic
955424598 3:58775196-58775218 GAGGACAACTAGAAGCAAGGAGG + Intronic
956422871 3:69102614-69102636 CAGGTCATACAGCAGGAATGTGG + Intronic
956462275 3:69484690-69484712 CTGGACAACCAGCAGCAGAGAGG - Intronic
956641543 3:71420357-71420379 TAGGGCAAGTAGCAGGAAGGTGG + Intronic
956678202 3:71754375-71754397 CACGCCCAGCAGCAGGAAGGCGG - Exonic
956989958 3:74751663-74751685 CAGGACAACCAGCCGTAGAGAGG - Intergenic
957140731 3:76352331-76352353 GAGGAAAACCAGTAGGAACGAGG - Intronic
958556866 3:95690384-95690406 CAGAACAGCGAGCATGAAGGAGG - Intergenic
963083163 3:141413271-141413293 GAGGACCTCCTGCAGGAAGGTGG - Intronic
963458532 3:145577367-145577389 TAGGACAACCTGGAGGAAGCTGG + Intergenic
964027132 3:152088161-152088183 CAGGAAAAACAGCAGGATGGGGG + Intergenic
964276380 3:155012689-155012711 CTGGACAATAAGCAGGAAGAAGG - Intergenic
965236081 3:166125310-166125332 CACAACACCCAGCAGTAAGGTGG - Intergenic
965422787 3:168482800-168482822 CAGGAAAGCCAGCAGGAATGTGG - Intergenic
966457669 3:180136046-180136068 CAGGACAACTTGAAGGGAGGAGG - Intergenic
966491518 3:180532310-180532332 CAGGACAACCAGCTGTAGAGAGG + Intergenic
967984045 3:195082338-195082360 CAGGAAGACCACCAGGGAGGGGG - Intronic
968079435 3:195835970-195835992 CAGGAGAACCAACCGGGAGGAGG - Intergenic
969243946 4:5920411-5920433 CATCACAACCAGCATGAAGTAGG - Intronic
969320820 4:6411396-6411418 CAGCAGGAGCAGCAGGAAGGAGG + Intronic
969338091 4:6523316-6523338 CAGGCCACACAGCAAGAAGGAGG - Intronic
970516047 4:16831244-16831266 TAGGACAAGCAGCAAGGAGGTGG + Intronic
970920221 4:21385302-21385324 CAGAACCACCAGCAGGAGGTGGG + Intronic
971366683 4:25983292-25983314 CTGGAAAAGGAGCAGGAAGGAGG + Intergenic
972158797 4:36198234-36198256 CAGGACGACCAGCTGCAGGGAGG - Intronic
972427734 4:38950282-38950304 CAGGACAGAGAGCAGGGAGGGGG - Intergenic
973116641 4:46468453-46468475 CAGGACCACCATCATAAAGGAGG + Intronic
974003071 4:56530420-56530442 CCGTACAACGCGCAGGAAGGCGG + Intergenic
974972969 4:68853827-68853849 CAGGACAACCAGCTGCAGAGAGG - Intergenic
975429609 4:74273285-74273307 CTGGACAGCCAGAAGAAAGGGGG + Intronic
976734495 4:88296401-88296423 CAGGACAACCAGCTGCAGAGAGG - Intergenic
979878239 4:125920830-125920852 CAGGACTGACAGCATGAAGGCGG - Intergenic
980180260 4:129392913-129392935 CAGGACAACCAGCTGCAGAGAGG + Intergenic
984951075 4:185008209-185008231 AAGGACATCCACCAGGAAGATGG - Intergenic
984973489 4:185210134-185210156 CAGGATCCCCAGCAGGAAGGCGG - Intronic
985849274 5:2376683-2376705 CAGGAAGCCCAGCAGGATGGGGG + Intergenic
987043477 5:14085104-14085126 GAGGACAATGAGAAGGAAGGAGG - Intergenic
988503040 5:31799306-31799328 CAGAACAGCCTGCAGGAAGGTGG + Exonic
990515794 5:56529893-56529915 CAGGACAAAAAGCAGGAACCAGG - Intronic
990923459 5:60993770-60993792 CAGGACAACAAGCTGCAAAGAGG - Intronic
991359277 5:65803019-65803041 CAGGACAACCAGCTGCAGAGAGG - Intronic
991556436 5:67900180-67900202 CAGGACAAAAAGCAGGAAACTGG + Intergenic
991636828 5:68714722-68714744 CATGACCAACAGGAGGAAGGAGG - Intergenic
991947647 5:71915238-71915260 CAGGGGAAAGAGCAGGAAGGAGG - Intergenic
992350334 5:75921615-75921637 CAGGAAAAACATCAAGAAGGGGG - Intergenic
992542003 5:77775356-77775378 CAGGACAACTAGAAGGTTGGGGG - Intronic
992735398 5:79714245-79714267 CAGGAAAACCAGGATGCAGGTGG - Intronic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
994160046 5:96547346-96547368 CATAAGAACCAGAAGGAAGGAGG + Intronic
995511816 5:112918241-112918263 AAGAACAACCAGTAGGAAGAGGG + Intronic
995654846 5:114414083-114414105 CAGAAAATCCAGCAGGAAGTAGG - Intronic
996086203 5:119308222-119308244 CTGGAAAACCTGCAGGAAAGAGG - Intronic
996826575 5:127688885-127688907 GATGACAGCCAGCAAGAAGGTGG - Intergenic
996923808 5:128799827-128799849 CAGGACAACCAGCTGCACAGAGG - Intronic
997925509 5:138027336-138027358 CAGAAAAGCCAGCAGGAAGCTGG + Intronic
998025837 5:138815479-138815501 CAGGGCACCCAGCAGGAAAGAGG - Intronic
998691808 5:144595596-144595618 CAGGCCAATCAGCAGGATGTGGG + Intergenic
1001750993 5:174131312-174131334 CATAAGAATCAGCAGGAAGGTGG + Intronic
1001821653 5:174715041-174715063 AAGGCCACCCAGCTGGAAGGAGG + Intergenic
1001996234 5:176161368-176161390 CTGGACTTCCAGCAGGGAGGGGG + Intergenic
1002065683 5:176650602-176650624 CAGCAGACCCAGCAGGCAGGAGG + Intronic
1003040694 6:2684999-2685021 CAGGGCAACCTGGAGGAAAGTGG - Intronic
1004180556 6:13377484-13377506 CAGGGCACACAGCAGGAAAGTGG - Intronic
1004507419 6:16258385-16258407 AAGGACAAAGACCAGGAAGGAGG + Intronic
1005399436 6:25416376-25416398 CAGGTCATCCAGCAAGTAGGTGG - Intronic
1005496657 6:26393382-26393404 CAGGACCACCAGAAGGGAGAGGG + Exonic
1005608330 6:27498309-27498331 AAGGAGAACCCACAGGAAGGTGG - Intergenic
1005781962 6:29201731-29201753 CAGGACAACCAGCTGCAGAGAGG + Intergenic
1006510900 6:34520503-34520525 AAGGTCACACAGCAGGAAGGAGG - Intronic
1006911780 6:37567959-37567981 CACAACAGCCAGCAGGAAGGAGG + Intergenic
1007072375 6:39047264-39047286 AATTCCAACCAGCAGGAAGGAGG - Intergenic
1007091729 6:39189062-39189084 CAGGACAACCAGCAACAACATGG + Exonic
1007229239 6:40336868-40336890 CAGAGCAACCAGAAGGATGGGGG + Intergenic
1007727058 6:43922931-43922953 CAGGGCAACCAGCTGGGAGATGG + Intergenic
1010424667 6:75714509-75714531 CATGAAAACCAGAAGGCAGGAGG - Intronic
1011368695 6:86609220-86609242 CAGGATGACCAGCAGGTTGGGGG - Intergenic
1011509847 6:88088383-88088405 CAGGAGAACCTGCAGAAGGGAGG + Intergenic
1012429629 6:99151069-99151091 AAGGACATGAAGCAGGAAGGGGG + Intergenic
1013375584 6:109510544-109510566 CAGGACAACCAGTAGCAGAGAGG + Intronic
1013817968 6:114121937-114121959 CAGGACTTCCAGCAGGAAGAAGG - Intronic
1014892126 6:126855557-126855579 AAGGTCACCCAGCAGGAAGTTGG + Intergenic
1015383023 6:132591399-132591421 CAGGTCAAAAAGAAGGAAGGAGG + Intergenic
1015554861 6:134450670-134450692 CAAGACAACCAGCAGGACTCAGG + Intergenic
1015785743 6:136921180-136921202 CAGGACAACCGGCAGGCGGAGGG - Intergenic
1017057913 6:150454458-150454480 CTGGAAAACCAGCAGGGAGAGGG + Intergenic
1017655331 6:156622224-156622246 CTGGACTCCGAGCAGGAAGGTGG + Intergenic
1018136559 6:160783789-160783811 CTTGACAAGCACCAGGAAGGCGG + Intergenic
1018333879 6:162763300-162763322 CTTGAGAAGCAGCAGGAAGGAGG + Intronic
1018454193 6:163937611-163937633 CAGGACAACTAGAAGTAGGGAGG + Intergenic
1018469541 6:164083406-164083428 GAGGACCACCTGCCGGAAGGAGG + Intergenic
1018857682 6:167687126-167687148 CAGGGCAGCCAGCAGGCAGCAGG - Intergenic
1019177207 6:170166033-170166055 TGAGACAACCAGCAGGCAGGAGG + Intergenic
1019357068 7:586040-586062 CATGCCAGTCAGCAGGAAGGAGG - Intronic
1019479455 7:1259925-1259947 CAGGACCACCACGAGGGAGGAGG - Intergenic
1019789848 7:3004114-3004136 CATGGTAACCAGCAGGAAGCTGG - Intronic
1019863654 7:3684347-3684369 CTTTACAACCACCAGGAAGGGGG - Intronic
1020141564 7:5614765-5614787 GAGGCCAGCCAGCAGCAAGGAGG - Intergenic
1020678448 7:11207485-11207507 CAGGAAAACAAACAGGAAGAAGG + Intergenic
1020761284 7:12270219-12270241 CAGGACGACCAGCGGTAGGGAGG + Intergenic
1020812415 7:12863848-12863870 CAGGATAACCAGCAGCATAGAGG - Intergenic
1021031596 7:15744212-15744234 CAGCACACAAAGCAGGAAGGGGG - Intergenic
1021175424 7:17444376-17444398 CAGGAAAACCTTCAGGAAGATGG - Intergenic
1022809280 7:33853025-33853047 CATGACAACGAGCAGTAGGGAGG - Intergenic
1023677435 7:42645016-42645038 AAGGACTACCAGAAGGAAGAGGG + Intergenic
1023983598 7:45082932-45082954 GTTGAGAACCAGCAGGAAGGAGG - Exonic
1024331504 7:48159988-48160010 CAGGAAGGCCAGCAGGAAGAAGG - Intergenic
1024345165 7:48305883-48305905 CAGGAAAATCAGCAGGAACTTGG + Intronic
1024480268 7:49855445-49855467 CAGGACTCTCAGCAGGGAGGAGG + Intronic
1027600758 7:80237757-80237779 CAGGAGAAAGAGCATGAAGGGGG + Intergenic
1027989768 7:85343191-85343213 CAGGAAATCCAGCAGGATTGTGG + Intergenic
1028411413 7:90534180-90534202 CATCACAATCAGCAGGAAGGAGG + Intronic
1028763396 7:94521265-94521287 AAGGATAACCATCAGGAATGAGG + Intronic
1029496786 7:100899644-100899666 CATTCCAGCCAGCAGGAAGGAGG + Intergenic
1029782112 7:102744771-102744793 CAGGACAACCAGTAGTAGAGAGG + Intergenic
1029886895 7:103882499-103882521 CAAAAAAACCAGCAGGCAGGAGG - Intronic
1030006094 7:105121664-105121686 AAGGAAAACCAACAGGAAGCAGG + Intronic
1030066123 7:105660534-105660556 AAGGACAAGTAGTAGGAAGGAGG - Intronic
1031118446 7:117693511-117693533 CAGGACAACCAGAAAGAATTTGG - Intronic
1031248651 7:119350739-119350761 CAGGACAACCAGCTGCAGAGAGG + Intergenic
1031446923 7:121866117-121866139 CAGCACATTCAGTAGGAAGGCGG + Intergenic
1031786608 7:126041069-126041091 CAGGACAACCAGCTGAAGAGAGG + Intergenic
1032434503 7:131889061-131889083 CAGCACAACAGACAGGAAGGGGG - Intergenic
1032503288 7:132416198-132416220 CAGGATAACCAGCTGGAGGAAGG + Intronic
1033039472 7:137905082-137905104 CAGGCCTACCAGGAGGGAGGGGG - Intronic
1033767575 7:144510917-144510939 CAGAAATATCAGCAGGAAGGTGG + Intronic
1034405865 7:150902105-150902127 CAGGACACACAGAAGGAAGGAGG + Intergenic
1034456863 7:151175379-151175401 CAGGAGAGCCACCCGGAAGGAGG - Intergenic
1034548490 7:151805021-151805043 CAGGACAGCCACTAGGAATGTGG + Intronic
1035289009 7:157825257-157825279 CATTTCAGCCAGCAGGAAGGGGG - Intronic
1036765674 8:11547977-11547999 CAGGCCCACAAGCGGGAAGGTGG - Intronic
1037595029 8:20347841-20347863 CAGGAGAGACAGCAAGAAGGGGG + Intergenic
1037893205 8:22635040-22635062 CAGGAGAGGCAGCAGGAGGGTGG - Intronic
1038149351 8:24928404-24928426 CAGGACAACCAGCTGCAAAGAGG + Intergenic
1038432509 8:27511510-27511532 CTGGACACCCAGCTGGAAGATGG + Intronic
1039816809 8:41101463-41101485 CAGAACAACCAGCGGTAAGCAGG - Intergenic
1040530538 8:48263159-48263181 CAGGCCAATCCGCAGGAAGGTGG + Intergenic
1042347072 8:67738329-67738351 CAGTCCAGCCAGCAGGAAAGTGG - Intronic
1042880244 8:73479928-73479950 CAGGGAAACCAGTAGGAAGACGG - Intronic
1043180751 8:77083689-77083711 CAGCAGGACCAGCAGGAAGTGGG - Intergenic
1043913805 8:85896642-85896664 CAGGACACACACCAGAAAGGAGG + Intergenic
1047248559 8:123165046-123165068 AAGGAGACCCAGGAGGAAGGCGG + Intergenic
1047937472 8:129797012-129797034 CTTGACCACCAGCAGGGAGGTGG + Intergenic
1048491265 8:134895978-134896000 CTGAACAACCAGAAGGATGGTGG - Intergenic
1048498709 8:134956920-134956942 CAGGGCAAACAGAAGGGAGGTGG + Intergenic
1049325266 8:142018249-142018271 GAGGACAAGCAGCGGGAGGGGGG - Intergenic
1049617129 8:143580509-143580531 CTTGACATCCAGCAGGATGGAGG + Exonic
1049824024 8:144655335-144655357 CAGGACAACCAGCTGAAGAGAGG + Intergenic
1052777035 9:32742606-32742628 CAGGACAATCAGCAGGAGGCAGG + Intergenic
1053274414 9:36772387-36772409 CAGGACAATCCACTGGAAGGAGG + Intergenic
1053696841 9:40647385-40647407 CAGGACAGCCCGAAGGAGGGGGG + Intergenic
1054308092 9:63446618-63446640 CAGGACAGCCCGAAGGAGGGGGG + Intergenic
1054406825 9:64770609-64770631 CAGGACAGCCCGAAGGAGGGGGG + Intergenic
1054440450 9:65256075-65256097 CAGGACAGCCCGAAGGAGGGGGG + Intergenic
1054489957 9:65765849-65765871 CAGGACAGCCCGAAGGAGGGGGG - Intergenic
1055119185 9:72638509-72638531 CAAAATAAGCAGCAGGAAGGGGG - Intronic
1056192002 9:84194233-84194255 CAGGACAACCAGTAGCAGGGAGG - Intergenic
1057203552 9:93156944-93156966 CATCCCAGCCAGCAGGAAGGAGG + Intergenic
1057220367 9:93254443-93254465 CAGGGCAGCCAGCAGGACAGAGG - Intronic
1057269643 9:93643622-93643644 CAGGACAGGAAGCAGGCAGGTGG - Intronic
1057423490 9:94930033-94930055 CAGGACCTTCAGCAGGAAGGTGG + Intronic
1058560966 9:106228852-106228874 CAGGGGAGCCAGCAGAAAGGAGG - Intergenic
1059937486 9:119325638-119325660 CAAGACGACCAGTAGGAAGATGG - Intronic
1060279773 9:122208032-122208054 GAGGACACCCAGTAGGAAGCAGG - Intronic
1061846131 9:133389436-133389458 CAGAGCAGCCAGCAGGATGGTGG - Intronic
1061870519 9:133517889-133517911 CAGGACACCCAGCAAGACAGAGG - Intronic
1062196056 9:135274834-135274856 CAGACCAGCCAGCAGGCAGGAGG - Intergenic
1062473021 9:136714496-136714518 GAGGACAGCCAGGAGGAGGGAGG - Intronic
1062725189 9:138069015-138069037 CTGGACACCCAGCAGGTTGGGGG + Intronic
1202779293 9_KI270717v1_random:21044-21066 CAGGACAGCCCGAAGGAGGGGGG + Intergenic
1203441894 Un_GL000219v1:16440-16462 CAGGACAGCCAGGAGGAGAGAGG - Intergenic
1203512702 Un_KI270741v1:135349-135371 CAGGACAGCCAGGAGGAGAGAGG - Intergenic
1203617107 Un_KI270749v1:75774-75796 CAGGACAGCCCGAAGGAGGGGGG - Intergenic
1185501522 X:600248-600270 CAGGGCAATGAGCAGGCAGGGGG - Intergenic
1185659878 X:1719354-1719376 CAAGGCCACCAGCATGAAGGAGG - Intergenic
1185975118 X:4711488-4711510 CAGGACAACCTGAAGCAAGGCGG + Intergenic
1187369012 X:18688806-18688828 CAGGACAACTCGAAGCAAGGGGG + Intronic
1187607076 X:20896748-20896770 CAGGAAAGCCAACAGGAAGGTGG - Intergenic
1188859849 X:35243966-35243988 CAGGACAACCAGCTGCAGAGAGG - Intergenic
1189172831 X:38925986-38926008 CAGCACACACAGCAGGAAGTGGG - Intergenic
1189239501 X:39514792-39514814 CAGCACAAACAGCAGGGAGGGGG - Intergenic
1191846315 X:65550415-65550437 GAGCACTACCAGGAGGAAGGCGG + Intergenic
1192219983 X:69191295-69191317 AAGGTCAAACAGCAGGAAAGTGG - Intergenic
1199606337 X:149582565-149582587 CAGGACAATGATCAGGAGGGCGG + Exonic
1199632785 X:149786803-149786825 CAGGACAATGATCAGGAGGGCGG - Exonic
1199640274 X:149853914-149853936 CAGGGCAACAATCAGGTAGGTGG + Intergenic
1199862322 X:151812403-151812425 CAAGACAGCCCCCAGGAAGGTGG + Intergenic
1200125519 X:153812340-153812362 CAGGACAGCAAGCAGGCAGTGGG + Intronic
1200210534 X:154344989-154345011 GAGGACAGCCAGCAGGCAGGTGG - Intergenic
1200220318 X:154387103-154387125 GAGGACAGCCAGCAGGCAGGTGG + Intergenic
1201194569 Y:11479325-11479347 CAGGACAGCCCGAAGGAGGGGGG + Intergenic