ID: 1166602117

View in Genome Browser
Species Human (GRCh38)
Location 19:44105674-44105696
Sequence ATGGAGACTCAAAATGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 603
Summary {0: 1, 1: 2, 2: 18, 3: 105, 4: 477}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166602117 Original CRISPR ATGGAGACTCAAAATGGGGA GGG (reversed) Intronic
900846282 1:5104567-5104589 GTTGAGATTCACAATGGGGATGG + Intergenic
902553940 1:17235682-17235704 ATGCAGACTCAGGAAGGGGAGGG + Intronic
902729071 1:18356923-18356945 ATGGAGATTGAGGATGGGGAGGG + Intronic
903751949 1:25628749-25628771 TTGGAGACTCAGAAGGGGGAGGG - Intronic
904616496 1:31752917-31752939 ATGGAGCCTGATGATGGGGAGGG + Intronic
904990990 1:34592448-34592470 ATGGATACTCAGAGTGGTGAGGG - Intergenic
905124568 1:35707885-35707907 GAGGAGACACAAAAGGGGGAGGG + Intergenic
906736161 1:48130938-48130960 ATGGAGACTCAGAAGGGTGAGGG - Intergenic
906882199 1:49603719-49603741 CTGGAGACTCAGAATGGGGGAGG - Intronic
906953205 1:50350783-50350805 ATGGGGAGTCAGAAGGGGGATGG - Intergenic
907265643 1:53258776-53258798 TTAGAGACTAAAAATGGAGAAGG - Intronic
908554500 1:65244008-65244030 AGGGAGACCTAAAATGGGGGAGG + Intergenic
910433932 1:87186080-87186102 ATGGAGACTAAAAATAGCTAAGG - Intergenic
911061080 1:93748327-93748349 ATGGAGAGTAAAAAGGGAGATGG - Intronic
911946207 1:104112760-104112782 TTGGAGACTCAAAAGGGGGAAGG - Intergenic
912003539 1:104864322-104864344 TTGGAGACTCTGAAGGGGGAAGG - Intergenic
914863228 1:151403878-151403900 ATGAAGACTCAAACTGGGAATGG + Exonic
915478856 1:156171373-156171395 AAGGAGGCTCAGAATGGAGAAGG + Intronic
916598874 1:166273102-166273124 ATGGTGACTCAGAGTGGGGAAGG + Intergenic
916636847 1:166680054-166680076 ATGGAGACTGAGAAGGAGGAGGG - Intergenic
916790199 1:168118442-168118464 ATGGAGACTCACGAGGGTGAGGG + Intronic
917410822 1:174758452-174758474 TTGGAGACTCAGAAGGGGAAAGG - Intronic
917917569 1:179718878-179718900 CTGGAGACTCCAAAAGGGGAGGG - Intergenic
918263935 1:182822580-182822602 ATGGTAACCTAAAATGGGGAAGG + Intronic
918570483 1:185985779-185985801 ATGGAGACACAGAATGATGAAGG - Intronic
918725611 1:187918097-187918119 TTGGAGACTCAGAATGGGGAGGG + Intergenic
918928876 1:190826700-190826722 ATGGAGATTCAGAAGGGTGAGGG + Intergenic
918941779 1:191009198-191009220 CTGGAGACTCCAAAAGGGTAGGG - Intergenic
919211611 1:194494144-194494166 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
919432773 1:197517565-197517587 ATAGAGACTCAATATGGGGTAGG - Intronic
919492261 1:198219540-198219562 TTGGAGACTCAGAATGGGGAAGG + Intronic
919494560 1:198248411-198248433 ATTTAGTCTCAAAATAGGGATGG + Intronic
920019675 1:202945849-202945871 ATGGAGACTTAGAAGCGGGAGGG + Intronic
920271625 1:204769133-204769155 ATGGAGACTCTAAATCAGTAGGG - Intergenic
920611143 1:207438966-207438988 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
922410192 1:225365872-225365894 ATGGAGACTTAAAGTGGAGGTGG - Intronic
922600445 1:226847556-226847578 AGGAGGACTCAAAGTGGGGAAGG - Intergenic
922601279 1:226856504-226856526 AGGAAGACTCAAAGTGGGGAAGG - Intergenic
922647199 1:227300658-227300680 GTGGAGACTCAGAAGGGAGAAGG + Intronic
922860832 1:228814946-228814968 TTAGAGACTCAGAAAGGGGAGGG - Intergenic
923249345 1:232165764-232165786 TTGGAGACTCAGAGTGGGGAGGG + Intergenic
923909148 1:238420200-238420222 ATGGAGACCAAAAATATGGATGG - Intergenic
924108113 1:240669712-240669734 ATGGAGACTCAGAAGGGTGAAGG - Intergenic
1063414813 10:5864691-5864713 CTGGAGATCCATAATGGGGACGG - Intronic
1064921226 10:20521029-20521051 CCGGAGACTCAAAATGTTGAGGG + Intergenic
1064955500 10:20903856-20903878 ATGGAGACTCAGAAGGGAGAAGG + Intronic
1066150779 10:32614649-32614671 ATGGAGACTAAAATGTGGGAGGG - Intronic
1067784394 10:49233229-49233251 TGGGAGACTCAGAATGGGGGAGG + Intergenic
1067935266 10:50605904-50605926 ATGGAGACTCAGAAGGGTGAAGG - Intronic
1068553280 10:58429594-58429616 ATGGAGACTCAGAAGAGTGAAGG - Intergenic
1068640260 10:59396956-59396978 ATGGAGACTCAGAAGGGTGAGGG - Intergenic
1068809052 10:61235175-61235197 AGAAAGACTCAAAATGGGGAGGG - Intergenic
1069356070 10:67586659-67586681 ATATAGACTAAAAATAGGGATGG - Intronic
1070027418 10:72645398-72645420 ATGGAGTCTCACAGTGGGGGAGG + Intergenic
1070103495 10:73411284-73411306 TTAGAGACTCAGAAAGGGGAGGG + Intronic
1070843607 10:79504941-79504963 AAGGAGACTAACAATGAGGATGG - Intergenic
1070930059 10:80254659-80254681 AAGGAGACTAACAATGAGGATGG + Intergenic
1071148294 10:82600948-82600970 CTGGAGACTCCAAAAGGGGTGGG - Intronic
1071299595 10:84246386-84246408 CTGGAGACTCAGAAGGGGAAGGG - Intronic
1071542242 10:86496560-86496582 ATGGATAAACAAAATGTGGAAGG + Intronic
1071575818 10:86725302-86725324 ATTGAGACTCAAAGAGGTGAAGG - Intronic
1072184011 10:93017249-93017271 CCAGAGACTCAAAAGGGGGAGGG + Intronic
1072223104 10:93344405-93344427 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1072875450 10:99168621-99168643 AGGTAGACTCACAAAGGGGAAGG + Intronic
1074518929 10:114198990-114199012 ACGGTGACTCAAAGTGGGAAAGG - Intronic
1074566625 10:114585253-114585275 CTGGAGACTAAAAAAGGGAAAGG - Intronic
1074734847 10:116419596-116419618 TTGGAGACTCAGAAGTGGGAGGG - Intergenic
1075213669 10:120513127-120513149 ATAAAGACTCAATATGGGAATGG + Intronic
1078074621 11:8147140-8147162 AGGAAGACTCAAAGTGGTGAAGG - Intronic
1078417391 11:11177165-11177187 ATGGAAACTGAAATTGAGGAAGG + Intergenic
1079879842 11:25913012-25913034 CTGGAGACTCAAAAGTGGGAAGG + Intergenic
1080675792 11:34425551-34425573 TTTGAGACTCAGAAGGGGGAGGG + Intergenic
1080694722 11:34592972-34592994 ATGAAGACAAAAAATGGGAAAGG - Intergenic
1080866581 11:36200606-36200628 ATGGAGAGGCAACATGGTGATGG + Intronic
1081017635 11:37903050-37903072 ATGGAGATTCACAATGGACAAGG + Intergenic
1081155908 11:39690144-39690166 TTGGAGACTCAGAAAGGGGAAGG - Intergenic
1082119269 11:48360618-48360640 TTGGAGACTCAGAAGCGGGAAGG + Intergenic
1082255027 11:50024529-50024551 CTGGAGACTCAGAAGCGGGAAGG - Intergenic
1083132662 11:60640300-60640322 CTGGAGACTCAGAAGCGGGAGGG + Intergenic
1083316572 11:61818242-61818264 ATTGAGGTTCGAAATGGGGAAGG + Intronic
1083862755 11:65432846-65432868 CTAGAGACTCAAAGTGGGGAGGG - Intergenic
1084044700 11:66561884-66561906 GTGGAGCCTCCAGATGGGGATGG + Intronic
1084554433 11:69867530-69867552 ATGGAGCATCAGAATGGGGAAGG - Intergenic
1085240499 11:75050161-75050183 AGGAAGACTCAAAGTGGGGAGGG - Intergenic
1085990041 11:81830708-81830730 ATGGTAACTAAATATGGGGAAGG + Intergenic
1086049252 11:82569328-82569350 ATGGAAGCTCAGAAGGGGGATGG - Intergenic
1086287703 11:85268353-85268375 AGGAAGACTCAAAGTGGGGAGGG - Intronic
1087047703 11:93857025-93857047 AGGAAGACTCAAAGTGGGGAGGG + Intergenic
1088553021 11:111033794-111033816 TTGGAGACGCAAAATGGGGAGGG + Intergenic
1088927729 11:114319437-114319459 ATGGAGACTCTAAGGGGGCAAGG + Intergenic
1088990287 11:114947879-114947901 ATAGAGAGTGAAAATGGAGAGGG - Intergenic
1092027761 12:5257380-5257402 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1092915453 12:13185208-13185230 CTGGAGACTCAGAAGGCGGAGGG + Intergenic
1093072129 12:14716544-14716566 AGGAAGACTCAAAGTGGGAAGGG + Intergenic
1093456649 12:19371465-19371487 TTGGAGACTCAGAAGGGAGAGGG - Intronic
1093705501 12:22270640-22270662 ATGGAGACTCAGAAAGGTAAAGG + Intronic
1093955171 12:25208689-25208711 TTGGTTAGTCAAAATGGGGAGGG - Intronic
1093977971 12:25443907-25443929 TTGGAGACTCAGAAGGGGGAAGG - Intronic
1093993628 12:25617584-25617606 CTAGAGAGTGAAAATGGGGAAGG + Intronic
1094143975 12:27209624-27209646 ATGGAGGCTCAGAAGGGGGAGGG + Intergenic
1094166887 12:27452350-27452372 ATGGAGACTCAGGAGGGTGAAGG - Intergenic
1094406473 12:30121538-30121560 ATGGGGAGCCAAAAGGGGGATGG - Intergenic
1094816512 12:34191756-34191778 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1095458169 12:42412250-42412272 ATGGAGACTCACAAGCAGGAGGG - Intronic
1095557914 12:43529640-43529662 TTGGAGACTCAGAAGCGGGAGGG + Intronic
1096612245 12:52810090-52810112 ATGGAGACTTGAAAAAGGGAGGG + Intronic
1097257343 12:57689293-57689315 ATGGAGACTCAGAAGGATGATGG + Intergenic
1097620952 12:61938893-61938915 TTGGAGACTCAGAAGGAGGAGGG + Intronic
1098585126 12:72145133-72145155 ATGGAAACTCAACTTGGGGCAGG - Intronic
1098992733 12:77082433-77082455 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
1099005084 12:77226166-77226188 ATGGATACTAACAATGGTGATGG + Intergenic
1099164156 12:79281519-79281541 CTGGAGACTCAAAAGTGGGAAGG + Intronic
1099582571 12:84469689-84469711 ATGGAGATTCAAAAGGGTGAAGG + Intergenic
1099938035 12:89151387-89151409 ATGAAGACTCAGAATGGGGAGGG + Intergenic
1100027041 12:90142948-90142970 ATGAAGAATCCAAATGGTGATGG - Intergenic
1100715472 12:97301159-97301181 ATGGACAATAAAAATGTGGAAGG - Intergenic
1100893853 12:99157643-99157665 CTGGAGACTCAGAAAGGGGGAGG + Intronic
1101278895 12:103229642-103229664 ATGGAAAATAAAAATGTGGAAGG - Intergenic
1101464474 12:104933906-104933928 CTGGAGACTCAGAAAGGGGGAGG + Intronic
1101520439 12:105477550-105477572 TTAGAGACTCAGAAAGGGGAAGG - Intergenic
1101946738 12:109143129-109143151 TTGGAGACTCAGAGAGGGGAAGG - Intronic
1101958764 12:109232534-109232556 ATGGGGGCTTAAAATGGGCAGGG - Intronic
1102746988 12:115258064-115258086 ATGGAGAGGAAAAATGGGGAAGG - Intergenic
1102930056 12:116855381-116855403 ATGTAGACTGAAAGTGGGGCAGG + Intergenic
1103728023 12:123008511-123008533 CTGAAGCCTCAAAATGGGAATGG - Intronic
1104093826 12:125538049-125538071 ATGGAGACTTGAGATGGGGATGG - Intronic
1105588587 13:21768905-21768927 AACGAGACTTGAAATGGGGAAGG - Intergenic
1105748701 13:23401378-23401400 ATGAAGACTGGAAGTGGGGAGGG - Intronic
1105894715 13:24708235-24708257 ATGGATACTGGAAAAGGGGAAGG - Intronic
1107081957 13:36384279-36384301 ATGGAACCTCAAAATGGAGTTGG + Intergenic
1107212535 13:37874592-37874614 ATGGGGACTAAAAATGCTGATGG + Intergenic
1107966211 13:45600531-45600553 ATGGAGACTCAAAAGAGTAAGGG - Intronic
1108008025 13:45972429-45972451 TTGGAGACTCAGAAGGGGGAGGG + Intronic
1108194818 13:47982661-47982683 CTGCATACTCAAAATGGGTAAGG + Intronic
1108329891 13:49375464-49375486 ATGGAGACCTAAGATGGAGAGGG + Intronic
1108738994 13:53315143-53315165 TTGGAGACTCAGAAGAGGGAGGG + Intergenic
1108807476 13:54176715-54176737 ATGCAGACCCAAAAGGAGGAAGG + Intergenic
1108976642 13:56452319-56452341 TTGGAGACTCAGAATAGGGGAGG - Intergenic
1109940797 13:69361373-69361395 TTGAAGACTCAGAAGGGGGAAGG + Intergenic
1110901031 13:80824859-80824881 CTGGAGACTCAGAGTGGAGAGGG - Intergenic
1110969321 13:81740948-81740970 AGGAAGACTCAAAGTGGGGAGGG - Intergenic
1111945874 13:94665390-94665412 ATAGAGACTTCAAATGGGTAGGG - Intergenic
1112559610 13:100501371-100501393 ATGGAGACTCAGAAGGGTGACGG - Intronic
1114147559 14:19994784-19994806 AAGAAGACTGGAAATGGGGAGGG - Intergenic
1114825773 14:26077085-26077107 ATAGAAAATGAAAATGGGGAGGG + Intergenic
1114952514 14:27773645-27773667 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1115947592 14:38679674-38679696 ATGGAGACTCAGAAGGAGGAGGG - Intergenic
1116042001 14:39697407-39697429 TTGGAGACTCAGAAGGGGGGAGG - Intergenic
1116342859 14:43748281-43748303 TTGGATACTCAAAAGGGTGAGGG + Intergenic
1116943824 14:50817133-50817155 AGGGAGACTTAAATTGGTGAAGG - Intronic
1117740135 14:58809526-58809548 ATGGAGTCTCAGAAGGGTGAGGG - Intergenic
1118044657 14:61954037-61954059 ATGGATACTCAAAGATGGGAGGG + Intergenic
1118631673 14:67710043-67710065 AGGAAGACTCTAAGTGGGGAGGG - Intronic
1119112576 14:71988795-71988817 ATGGAGGGTCTAACTGGGGAGGG + Intronic
1119193121 14:72697764-72697786 ATGGAGAGGAAAAATGGGGTGGG + Intronic
1120030406 14:79634608-79634630 ATGGAGACTCAAAGCGGTTAAGG + Intronic
1121295806 14:92821016-92821038 ATGGAGGCACAGAATGGTGATGG + Intronic
1121795274 14:96729326-96729348 AGAGAGACTCAAAAGGGGCACGG + Intergenic
1122294610 14:100698228-100698250 ATGAAGACTCATGGTGGGGAGGG - Intergenic
1124216451 15:27811348-27811370 TTGGAGATTCAGAATGGGAAGGG + Intronic
1126304046 15:47234501-47234523 TTGGAGACTCAGGAAGGGGAAGG - Intronic
1126475250 15:49058954-49058976 ATGGAGACTCAGAAGGAGGAAGG + Intergenic
1126753413 15:51900357-51900379 TTGGCGACTCAGGATGGGGATGG + Intronic
1128255494 15:66193203-66193225 ATGTAGACTCATAATGGGTTTGG - Intronic
1128747346 15:70123824-70123846 ATGGAGAGGCAAGATGGGGACGG + Intergenic
1129673988 15:77622488-77622510 AGGGAGACTCAGAAAGGTGAGGG + Intronic
1130176258 15:81574360-81574382 AGGGAGACTAAAACTGGAGAGGG + Intergenic
1131080837 15:89533476-89533498 ATGGAGACTCAGAATGCTGAGGG - Intergenic
1132411222 15:101579446-101579468 AAGGAAACACAAAGTGGGGAAGG + Intergenic
1133150390 16:3824155-3824177 ATGGAGTTTCAAAAGGGAGAGGG + Intronic
1133361399 16:5176727-5176749 ATGGTGACTCCAGGTGGGGAAGG - Intergenic
1133498842 16:6345947-6345969 AGGAAGACTCAAAGCGGGGAGGG + Intronic
1133696258 16:8265838-8265860 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1134343270 16:13365177-13365199 ATGGAGATTTAAACTGGGAAGGG + Intergenic
1134785913 16:16942996-16943018 AAGATGACTCAAAGTGGGGAGGG + Intergenic
1135218560 16:20593564-20593586 TTGGAGACTCAGAAGGAGGAAGG - Intergenic
1135973013 16:27086005-27086027 CTGGAGACTCAGAAGGTGGAGGG + Intergenic
1137971708 16:52991915-52991937 CTGGAGACTCAGAATGGGGAGGG + Intergenic
1138300809 16:55928404-55928426 CTGGAGACTCAGAAGGTGGAAGG + Intronic
1138966697 16:62093298-62093320 CTGGAGACTCCAAAAGGGGGAGG - Intergenic
1139155605 16:64437982-64438004 ATTGAAACTTAAAGTGGGGAAGG + Intergenic
1140262936 16:73396309-73396331 ATGTAGGCTCAAACTGGAGAAGG + Intergenic
1140705238 16:77622657-77622679 TTGGAGACTGAGAAAGGGGAAGG - Intergenic
1141867696 16:86762059-86762081 ATGGAAAATCAGAATGAGGAAGG + Intergenic
1144528208 17:16009885-16009907 ATGTAGACTAAAAATAGGAATGG + Intronic
1146097659 17:29947401-29947423 ATGGAGACTCAGAAGTGGGAGGG + Intronic
1146614567 17:34344618-34344640 TTGGAGATTCAGAAGGGGGAAGG + Intergenic
1146627709 17:34446784-34446806 AGGAATACTCAAAGTGGGGAAGG - Intergenic
1146789502 17:35743377-35743399 ACAGAGACTCAGAATGGGGGTGG - Exonic
1147504997 17:41007159-41007181 TTAGAGACTCAAAAAGTGGAGGG + Intergenic
1148351094 17:46942799-46942821 AAGGACACAGAAAATGGGGAAGG - Intronic
1148387015 17:47241484-47241506 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1148444591 17:47729803-47729825 ATGAAGACTCAAAATGAGAGAGG - Intergenic
1149275350 17:55027400-55027422 TTGGAGACTCAGAAGGGGGATGG + Intronic
1149598004 17:57875344-57875366 ATGAAGACTCCAAGTGGAGAAGG + Intronic
1150002487 17:61450799-61450821 ATGGAGTCTCAAACCAGGGAGGG - Intergenic
1150221984 17:63500943-63500965 AGGGAGAGGCAACATGGGGAGGG - Intronic
1152208178 17:78987673-78987695 ATGAAGACTAAAAAGGGGCAGGG - Intergenic
1153289020 18:3482135-3482157 ATGGACACCCAAAACGGGGCAGG + Intergenic
1153361463 18:4202340-4202362 CTGGAGCCTCAGAATGAGGAAGG + Intronic
1154083855 18:11282863-11282885 TTGGAGACTCAGAAGGGTGAGGG - Intergenic
1154138898 18:11805513-11805535 CAGGAGACTCAAAAGGGTGAGGG - Intronic
1154214961 18:12408739-12408761 ATGGAGACTCTGAAGGGTGAGGG + Intronic
1154246433 18:12703154-12703176 ATGGAGACTCACCATTAGGAGGG - Exonic
1155315134 18:24563740-24563762 ATGGAGACTCAGAAGGGGGACGG - Intergenic
1155771342 18:29704342-29704364 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1157007184 18:43597112-43597134 AGGAAGACTCCAAGTGGGGAGGG + Intergenic
1158290402 18:55934042-55934064 ATAGATACACAAAATGGGAAAGG + Intergenic
1158369557 18:56784434-56784456 ATGGAGACTCAGAAGGGGAAGGG - Intronic
1159116630 18:64121348-64121370 ATGAAGACTCAAAAAGGTAAGGG - Intergenic
1159227834 18:65563689-65563711 AGGAAGACTCAAAGTTGGGAGGG - Intergenic
1161810858 19:6470450-6470472 ATGGAGACTCAGAGAGGGAAAGG - Intronic
1162756585 19:12864564-12864586 ATGGAGACTCAAAGAAAGGATGG - Intronic
1163229300 19:15989310-15989332 CTGGAGACTCAGAAGAGGGAAGG - Intergenic
1164392933 19:27841389-27841411 GGGAAGACTCAAAGTGGGGAGGG - Intergenic
1164443850 19:28300544-28300566 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1164471785 19:28542228-28542250 TGGGAGACTCAGAAGGGGGAGGG + Intergenic
1164512119 19:28905894-28905916 ATGGAGACTCTATTTGGAGATGG + Intergenic
1164922742 19:32101799-32101821 ATGGAGACTCAGAAGGGGGTGGG - Intergenic
1164944595 19:32282757-32282779 CTGGAGACTCAAAAGGGGAGAGG - Intergenic
1165412104 19:35668356-35668378 GTGGAGGCTCCAAATGGGGAGGG + Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166586997 19:43958235-43958257 AAGAAAACTCAAAATGGAGATGG - Intronic
1166602117 19:44105674-44105696 ATGGAGACTCAAAATGGGGAGGG - Intronic
1167359165 19:49020700-49020722 ATGGAGACTCAAAGATAGGAGGG + Intergenic
1167524557 19:49975596-49975618 AGGAAGACTCGAAGTGGGGAGGG - Intergenic
1167646722 19:50710049-50710071 ATGGAGCCTCAAAGAGGGGGAGG + Intronic
1167691752 19:50989258-50989280 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1167723677 19:51196607-51196629 TTGGAGACTCAGAATGAGGAAGG - Intergenic
1167793385 19:51693966-51693988 ATGGAGACTCAGAGAGGGGGAGG + Intergenic
1168304246 19:55426375-55426397 TTGGAGTCTCAAACTGGGGATGG + Intergenic
926613342 2:14969855-14969877 ATGGGAAGTCAAACTGGGGAAGG + Intergenic
926906942 2:17814827-17814849 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
927375186 2:22405241-22405263 ATGTAGACTAAATATGGAGAAGG + Intergenic
928479676 2:31669264-31669286 TTTGAGACTCAGAATGGGGAGGG - Intergenic
928812343 2:35244345-35244367 ATGGAGACTCCAAAGGGTGGAGG - Intergenic
928856171 2:35804971-35804993 ATGGACACTGAAAATGAGCAGGG + Intergenic
930463176 2:51710059-51710081 GTGGAGACTCAGAAGGGTGAGGG + Intergenic
930528325 2:52559784-52559806 TTAGAGACTCAGAAAGGGGAGGG - Intergenic
930539442 2:52686754-52686776 CTGGAGTCTCAGAATGGGGGAGG + Intergenic
930892919 2:56412005-56412027 CTGGAGACTCAGAAGGGTGAGGG + Intergenic
930950131 2:57131332-57131354 TTGGAGACTCAAAAAGGAGGAGG - Intergenic
931952594 2:67381990-67382012 ATGGAGGCTGAAGAAGGGGAAGG + Intergenic
932884416 2:75535766-75535788 TTGGAGACTCAGAATGGGGAAGG + Intronic
933173170 2:79146920-79146942 TTGGAGACTCAGGGTGGGGAGGG - Intergenic
933294827 2:80477515-80477537 ATGGAGACTCAGAATGGGAAAGG - Intronic
933349856 2:81139416-81139438 GTGGAGACTTAGAATGGTGAGGG + Intergenic
933352742 2:81176304-81176326 ATGGAGACTCAAAGGTGTGATGG + Intergenic
933452149 2:82468153-82468175 ATGAAGACTATATATGGGGAGGG + Intergenic
933904903 2:86882292-86882314 TTGGAGACTCAGAAGGAGGAGGG + Intergenic
934058134 2:88269724-88269746 AGGGAAACTCAAAAGGGTGAGGG + Intergenic
934079851 2:88458572-88458594 AGGGAGACTCACAAGGGGAAGGG - Intergenic
934484794 2:94695637-94695659 TTGGAGACTCAGAGCGGGGAGGG + Intergenic
934616763 2:95776165-95776187 ATGGAGAGACAAAATGGGAATGG - Intergenic
934644127 2:96048395-96048417 ATGGAGAGACAAAATGGGAATGG + Intergenic
934837544 2:97604486-97604508 ACGGAGAGACAAAATGGGAATGG + Intergenic
936367325 2:111869870-111869892 TTGGAGACTCAGAAGGAGGAGGG - Intronic
936580027 2:113691493-113691515 ATGGAGACTCAGAAGGGGGAGGG - Intergenic
936853994 2:116935111-116935133 ATGGGGCCTAAAAATGAGGAGGG + Intergenic
938200821 2:129371700-129371722 ATGAAGACTCATAATGGGGAGGG - Intergenic
938758186 2:134399881-134399903 GGGAAGGCTCAAAATGGGGAGGG - Intronic
939918717 2:148081782-148081804 ATGTAGAATAAGAATGGGGAAGG - Intronic
940498750 2:154467595-154467617 ATGGAGAGTCAAATTTGGGTAGG + Intergenic
940545974 2:155085858-155085880 ATGCAGACTCAGAAGGAGGAGGG + Intergenic
940605545 2:155919547-155919569 CTGGAGACTTAAAATGTGAATGG - Intergenic
941180117 2:162249382-162249404 ATAGAGGTTAAAAATGGGGAAGG - Intergenic
941350245 2:164423762-164423784 ATGTAGACTCAAAATAAAGAAGG - Intergenic
941762219 2:169256836-169256858 GTGGAAACTCAAGATGGGGGAGG - Intronic
943912880 2:193591410-193591432 ACGGAGAATGAAAATGGAGAAGG + Intergenic
944493453 2:200282467-200282489 AAGGAGACTCCAATGGGGGATGG + Intergenic
945075774 2:206038066-206038088 ATGAAGACTCAGAAGGGTGACGG + Intronic
945869669 2:215213549-215213571 ATGACTACTCAAAGTGGGGAGGG - Intergenic
946557166 2:220871818-220871840 ATGGAGACTGGAGATGGGAATGG + Intergenic
946759886 2:222982998-222983020 ATGGAGACGGGAAGTGGGGAAGG - Intergenic
946859013 2:223982306-223982328 ATGGAGACTCAGAAGGAGGAGGG + Intronic
947448877 2:230186660-230186682 ATGGAGACTCAGAAAGGAGAGGG - Intronic
948955403 2:241286492-241286514 AGGAAGACTCCAAGTGGGGAGGG - Intronic
949028839 2:241778826-241778848 AGGAAGACTCCAAGTGGGGAGGG + Intronic
949030303 2:241792971-241792993 AGGAAGACTCCAAGTGGGGAGGG - Intronic
1169083255 20:2810604-2810626 TTGGAGACTCAGAAGGAGGAGGG - Intergenic
1169203457 20:3727249-3727271 ATGCAGAATCAAAATGGAGTGGG - Intergenic
1169323214 20:4652615-4652637 ATGGAGACTCAGAAGTGGGGAGG - Intergenic
1169513731 20:6294267-6294289 CTGGAGACTCAGAAAGGGGGAGG - Intergenic
1171211855 20:23323055-23323077 CTGGAGACTCAGAAGGGGTAGGG + Intergenic
1171778495 20:29394603-29394625 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1171822552 20:29867053-29867075 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1173000859 20:39104648-39104670 ATCGAGATGGAAAATGGGGAAGG + Intergenic
1173059618 20:39648747-39648769 TTGGAGATTCAGAATGGGGAGGG + Intergenic
1173865489 20:46309743-46309765 ATGGAGATGGAAATTGGGGAAGG - Intergenic
1175259442 20:57665313-57665335 ATAGGAACTCAAAAGGGGGAAGG + Intronic
1175773518 20:61638551-61638573 ATGGAGACCAACAATGGGAAGGG + Intronic
1176245997 20:64097275-64097297 ATGGAGACCGAAAATGGTGACGG - Intronic
1177267710 21:18805880-18805902 TTCGAGTCTCAGAATGGGGAGGG + Intergenic
1177814510 21:25961188-25961210 AGGAAGACTCGAAGTGGGGAGGG - Intronic
1178604749 21:34025960-34025982 AGGGAGACTCAGACTGGAGAGGG + Intergenic
1178632745 21:34276979-34277001 ATGGAGACACCAGATGGGGCAGG + Intergenic
1179095916 21:38314340-38314362 ATGGGGAGTCAGAAGGGGGATGG - Intergenic
1179130994 21:38636964-38636986 TGGGAGACTTTAAATGGGGATGG + Intronic
1180324268 22:11354597-11354619 ATGGAGACTCAGAAGGGTGAAGG + Intergenic
1182530507 22:30952196-30952218 AAGGAGACTCAAACTGGGTCAGG + Intronic
1182973840 22:34603732-34603754 ACAGCCACTCAAAATGGGGAAGG + Intergenic
1183343878 22:37296324-37296346 ATGGAGGCCCAGAGTGGGGAAGG - Intronic
1184306275 22:43604574-43604596 AGGGAGCCTCAAGATGGGAAAGG - Intronic
949160998 3:881790-881812 ATGGAGACCCACAAGGGTGAGGG - Intergenic
949229495 3:1734062-1734084 AGGAAGGCTCAAAATGGGGCAGG + Intergenic
950128621 3:10526799-10526821 ATAGAGACTCAGAGAGGGGAAGG - Intronic
951438519 3:22693951-22693973 TTGGAGACTCGGAAAGGGGATGG - Intergenic
951575887 3:24113655-24113677 ATGGAGGCTGGAAGTGGGGAGGG - Intergenic
951995940 3:28728970-28728992 ATGGCAACTCAAAAATGGGATGG - Intergenic
952199010 3:31106130-31106152 CTGGAGACTCAGAAGGGTGAAGG - Intergenic
952641651 3:35603800-35603822 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
952643374 3:35625390-35625412 TTGGAGACTCAGAAGTGGGATGG - Intergenic
952657890 3:35808242-35808264 ATGTACACCCACAATGGGGAGGG - Intergenic
953174331 3:40535726-40535748 AAGAAGTCTGAAAATGGGGAAGG + Exonic
953277297 3:41514762-41514784 ATGGAGACTCAGAAGGGTGAGGG + Intronic
953380464 3:42467520-42467542 ATGGAGACTCAGAAGGGTGAAGG + Intergenic
953804287 3:46054529-46054551 ATGGACACTCAAAAGGACGAGGG + Intergenic
954245046 3:49324732-49324754 ATTGAGCCTCAAAATGAAGATGG - Exonic
954517205 3:51189418-51189440 TTAGAGACTCAGAAAGGGGAGGG - Intronic
955019541 3:55105979-55106001 ATGGAGAGTCAGCCTGGGGAGGG + Intergenic
955032548 3:55234811-55234833 TTGGAGACTCAGGAGGGGGATGG - Intergenic
955133495 3:56193004-56193026 AAGGAGAGTCAAAATCGGGTAGG - Intronic
955204870 3:56886805-56886827 ATGAAGGCTCAAAAAGGGGCAGG + Intronic
955534662 3:59910233-59910255 AAGAAGACTCTAAGTGGGGAGGG + Intronic
955603856 3:60677315-60677337 CTGGAGACTCAGAATGATGATGG - Intronic
956031075 3:65038772-65038794 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
956390830 3:68771106-68771128 ATGGGGAGTCAGAAGGGGGATGG - Intronic
956695328 3:71914038-71914060 TTAGAGACTCAGAATGAGGAGGG - Intergenic
956995463 3:74822453-74822475 ATGGAGACCAAAAATGAGAAGGG - Intergenic
958953578 3:100442521-100442543 AGGAAGACTCAAAGTGGGGAGGG + Intronic
960076204 3:113488586-113488608 TTGGAGACTCAGAAGGGGGAGGG + Intronic
960717647 3:120593581-120593603 CTGGAGATTCAAAATTGGTATGG - Intergenic
962002389 3:131312095-131312117 ATGTAAAGCCAAAATGGGGAAGG + Intronic
962220831 3:133563454-133563476 GTAAAGACTCAAAAAGGGGATGG - Intergenic
962442483 3:135435208-135435230 TCGGAGACTCGAAATGGTGAGGG + Intergenic
962448472 3:135491164-135491186 ATGCAGATCCAATATGGGGAAGG - Intergenic
963008749 3:140750141-140750163 ATAGGGACTCAAAAGGGTGAAGG + Intergenic
964285581 3:155114166-155114188 TATGAGACTCAAAGTGGGGAGGG + Intronic
964773477 3:160249849-160249871 CTGGAGACTCAGGAAGGGGAGGG - Intronic
964859078 3:161180495-161180517 GGGAAGACTCAAAGTGGGGAGGG + Intronic
967188817 3:186967764-186967786 ATGGAGGCCCAGAAAGGGGAAGG + Intronic
968857548 4:3138394-3138416 TTGGAGACTCACAAGGCGGAAGG - Intronic
969273287 4:6117392-6117414 AGGGAGTTTCAAAAAGGGGAGGG + Intronic
970221422 4:13815836-13815858 ATGGAGACTCAGAAGGGTGTGGG - Intergenic
970273164 4:14368493-14368515 ATGGAGAGCCAGAAGGGGGATGG + Intergenic
971542844 4:27842825-27842847 ATGGAGAAACATAATGTGGAGGG + Intergenic
971975679 4:33683311-33683333 TTGGAGACTCAGAATGGGGGAGG - Intergenic
972187999 4:36555529-36555551 AGGAAGACTCGAAGTGGGGAGGG - Intergenic
972195190 4:36645818-36645840 AGGAAGACTCGAAACGGGGAGGG - Intergenic
972390251 4:38607010-38607032 ATGGGGAGTCAGAAGGGGGATGG + Intergenic
972408675 4:38769966-38769988 ATGGAGACAAAGCATGGGGAAGG - Intergenic
972871386 4:43303947-43303969 ATGGAGGGTCAAGATGGGGAAGG - Intergenic
973712855 4:53646358-53646380 ATAGAGACTGAGAATGGGGTGGG - Intronic
973996225 4:56462124-56462146 ATGAAGAATCAAAATGAGGACGG + Intergenic
974032797 4:56790990-56791012 ATGGAGACTCAGAAGAGGGAGGG - Intergenic
974574957 4:63706743-63706765 AAAGAGAATCAAAATGGGAAAGG + Intergenic
975290482 4:72672115-72672137 TTGGAGACTCAGAAGTGGGAGGG - Intergenic
975696711 4:77021234-77021256 GTGGAGACGCAAAATGTGAAGGG + Intronic
976171927 4:82313263-82313285 TTGGAGACTCAGAAGGGGAAGGG + Intergenic
976366110 4:84234139-84234161 ATGGAGAATAAAAATGATGAAGG + Intergenic
976526041 4:86090097-86090119 AGGGAGGGGCAAAATGGGGAAGG + Intronic
977509533 4:97945214-97945236 TTGGAGACTTAGAAAGGGGAGGG - Intronic
977608358 4:99005905-99005927 TTGGAGACTCAGAAAGGGGGAGG + Intronic
977707636 4:100088998-100089020 CTGGAGACTCAGAACGGGAAGGG - Intergenic
977910285 4:102526325-102526347 ATGGAGATTCAGAAAGGTGAGGG + Intronic
978913685 4:114097081-114097103 TTGGAGACTCAGAATGGGGAAGG - Intergenic
979023981 4:115544284-115544306 AGGAAGACTCGAAGTGGGGAGGG + Intergenic
979281463 4:118872827-118872849 ATGGAGACTCAAAAGGGGGAGGG - Intronic
979947512 4:126851688-126851710 ATGGAAACAGAAAAAGGGGATGG - Intergenic
980747638 4:137040303-137040325 TTGGAAACTCAGAATGGGGGAGG - Intergenic
981361589 4:143852065-143852087 TTGGAGACTCAGAAGGGGGAGGG - Intergenic
981372326 4:143973046-143973068 TTGGAGACTCAGAAGCGGGAGGG - Intergenic
981423800 4:144581083-144581105 ATGGGGAGCCAAAAGGGGGATGG - Intergenic
981523295 4:145687246-145687268 AGGAAGACTCAAAGAGGGGAGGG - Intronic
981665877 4:147225691-147225713 ATGTAGACTCCAAGTGGGAATGG - Intergenic
981738491 4:147977815-147977837 CTGGAGACTCCAAAAGGGGAGGG - Intronic
981891575 4:149744707-149744729 CTGGAGACTTAAAGTGGAGAGGG - Intergenic
982267369 4:153550853-153550875 TTGGAGACTCAAGATGGGGAAGG + Intronic
982422447 4:155213116-155213138 TTGGAGACTCATAAAGGAGAGGG + Intronic
982765029 4:159336328-159336350 TTGGAGACTCAGAAGGGGAAGGG - Intronic
982887672 4:160802469-160802491 TTGGAGACTCAGAATGGGGATGG + Intergenic
983111642 4:163757465-163757487 TTACAGACTCAAAATAGGGATGG - Intronic
983335997 4:166393238-166393260 ATGGAGAGGAAAAATGGGGTTGG - Intergenic
983400527 4:167259000-167259022 CTGGAGACTTAGAAGGGGGAGGG + Intergenic
984321770 4:178206677-178206699 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
985141736 4:186846922-186846944 GTGGAAACTCTGAATGGGGAAGG + Intergenic
986227897 5:5834049-5834071 ATGGAGACTCATAATAGGAAGGG + Intergenic
986435845 5:7730038-7730060 ATGGAGACTCCAAAGGGGGAAGG - Intronic
986450277 5:7856617-7856639 ATTTAGACTCCAAATGGGGGTGG + Intronic
986539946 5:8834415-8834437 CTGGAGACTCAGAACAGGGAAGG + Intergenic
986687498 5:10287474-10287496 ATGGAGACTCAGAAGGGGGAGGG + Intronic
987042078 5:14072388-14072410 ATGGAGATAGAAGATGGGGAAGG - Intergenic
987190883 5:15477198-15477220 AGGGAGAAGGAAAATGGGGAGGG - Intergenic
987460162 5:18199062-18199084 GGGAAGACTCAAAGTGGGGAGGG - Intergenic
988205339 5:28126516-28126538 ATGGAGAGCCAGAAGGGGGATGG - Intergenic
988554768 5:32226507-32226529 CACGGGACTCAAAATGGGGAGGG - Intergenic
988889025 5:35594338-35594360 TTAGAGACTCAGAATGGGGAGGG - Intergenic
989443432 5:41500411-41500433 ATGGATACTCAGAAGGGTGAGGG + Intronic
991325173 5:65423154-65423176 CTGGAGATTCAGAAGGGGGAAGG + Intronic
992232566 5:74677857-74677879 GTGGAGACTCAGAAAGGGGAGGG - Intronic
992403615 5:76434347-76434369 TTGGAGACTCAGAAAGAGGAGGG - Intronic
993165064 5:84342401-84342423 ATGGAGACTCAGAAAGGTGGGGG + Intronic
993195709 5:84742544-84742566 TTGGAGACTCAAAAGTGGGGAGG - Intergenic
993540051 5:89138136-89138158 TTGGAGACTCTGAAGGGGGAAGG - Intergenic
994228350 5:97281788-97281810 ATGGAGACTCAGATGGGGGCAGG - Intergenic
994388675 5:99163524-99163546 TTGGAGACTCAGAAATGGGAAGG + Intergenic
996277825 5:121689043-121689065 ATGAAGAGCAAAAATGGGGAAGG + Intergenic
997806838 5:136926501-136926523 ATGGCCACTCAAAAGTGGGATGG + Intergenic
998228587 5:140345270-140345292 GAGGAGACTCCAAATGGGGAGGG - Intronic
998425268 5:142021309-142021331 ATGGATAATCAAAATGTGGTAGG - Intergenic
999037853 5:148373609-148373631 ATAGGGACTGAGAATGGGGAGGG - Intergenic
999981211 5:156959622-156959644 TTTGAGACTCAGATTGGGGAAGG - Intronic
1000491413 5:161918864-161918886 ATGGGGACTCCAGAGGGGGAAGG + Intergenic
1000821004 5:165983167-165983189 TTGGAGACTCTGAATGGGGGAGG + Intergenic
1000839020 5:166193129-166193151 ATGCAGATTAAGAATGGGGAAGG + Intergenic
1001214917 5:169846855-169846877 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1001760882 5:174207150-174207172 TTGGAAACTCAAAAGGGGGAGGG + Intronic
1002485718 5:179534904-179534926 ATGGATACCCAAAAAGGGAAGGG + Intergenic
1002905736 6:1447590-1447612 CTGGAGACTCAGAAGGGGGGAGG - Intergenic
1002996931 6:2295278-2295300 TTGGAGACTGACAAGGGGGAGGG + Intergenic
1003012621 6:2439835-2439857 GTGGAGGATCAAAAAGGGGAGGG + Intergenic
1004170671 6:13293323-13293345 TTGGGGACTCAGAAGGGGGAGGG + Intronic
1004984079 6:21059917-21059939 GTGAAGACTCAGAAGGGGGAGGG - Intronic
1005325048 6:24691984-24692006 ATTGAGACTAAACATGGGGATGG + Intronic
1005812587 6:29528815-29528837 CTGGAGGCTCAAAATGAGCAGGG - Intergenic
1008258908 6:49340936-49340958 AGGAAGACTCGAAGTGGGGATGG - Intergenic
1008891845 6:56502900-56502922 ATGGAGAGTTAAAATTGGGAAGG + Intronic
1009271374 6:61619262-61619284 TTAGAGACTCAGAAGGGGGAGGG - Intergenic
1009327327 6:62369152-62369174 ATGTAGACTCAAAATAGCAAAGG + Intergenic
1010568991 6:77455002-77455024 TTGGAGATTTAAAATGAGGAGGG + Intergenic
1010815465 6:80353062-80353084 ATGGAGACTCAGAGAGGAGAGGG - Intergenic
1011490296 6:87884582-87884604 ATGAAGGCTCAGGATGGGGAAGG + Intergenic
1012729698 6:102866682-102866704 TTGGAGACTCAAAAGGGGAAAGG + Intergenic
1012823142 6:104114154-104114176 ATGGAAACTCAGAATGATGAGGG - Intergenic
1012902344 6:105020708-105020730 ATAGAGACTCAGAAGGGTGAGGG - Intronic
1013286948 6:108689913-108689935 AAGGAGACTCAACTTGGGAATGG + Intergenic
1013508649 6:110824407-110824429 CTGGAGACTCAGAAAAGGGAGGG + Intronic
1013806796 6:114005381-114005403 ATGGAGTCTCAGAGTTGGGAGGG + Intronic
1014092627 6:117421414-117421436 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1014235671 6:118951569-118951591 GGGAAGACTCAAAGTGGGGAGGG - Intergenic
1014393648 6:120896133-120896155 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
1015240078 6:131012189-131012211 AGGGAGACTCTAGATGGGGGCGG + Intronic
1015265904 6:131292324-131292346 ATGGAAACTCAAAGTGGGGGAGG - Intergenic
1015365920 6:132398052-132398074 ATAGAGACTCAAAAGGGTGAAGG - Intronic
1015483941 6:133746765-133746787 ATGAAGACTCAGAATTGGGAGGG - Intergenic
1015636266 6:135277801-135277823 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
1015916506 6:138222872-138222894 CTGGAGACTCAGAATGGGGGAGG - Intronic
1016150628 6:140737554-140737576 TTGGAGACTCAGAAAGGAGAGGG - Intergenic
1016385971 6:143531243-143531265 TTGGAGACTCAGAAAGGGGAGGG + Intergenic
1016469082 6:144356074-144356096 CTGGAACCTCAAAAGGGGGAAGG + Intronic
1016647180 6:146423989-146424011 GTGCAGTCACAAAATGGGGATGG - Intronic
1017332349 6:153214604-153214626 ATGGAGACACAAACTTGGGCTGG - Intergenic
1017938360 6:159027334-159027356 TTGGAGACTCAGAATGGGGGAGG + Intergenic
1019098861 6:169610880-169610902 TTGGAGACTCACAAGGGGGCAGG + Intronic
1019391927 7:793180-793202 GTGGAGACTCAGAAGGGTGAAGG + Intergenic
1019755756 7:2768158-2768180 ATGGAGACTATAAATGGCCACGG + Intronic
1020133729 7:5574493-5574515 GTGGACAGTCAAAATGGGGGAGG - Intergenic
1020966944 7:14882596-14882618 ATAGAGACTCAGAAGGGAGAAGG - Intronic
1021498594 7:21304314-21304336 TCAGAGACCCAAAATGGGGAGGG + Intergenic
1021873132 7:25023194-25023216 TTGGAGACTCTGAAGGGGGAGGG - Intergenic
1022721888 7:32948824-32948846 ATGTAGACTGACAGTGGGGAAGG + Intergenic
1022849329 7:34244154-34244176 TTGGGGACTGAAACTGGGGAAGG - Intergenic
1023795658 7:43789799-43789821 ATGGAGACTCAGGGTGGGAAAGG - Intronic
1026142549 7:67718629-67718651 AGAAAGACTCAAAGTGGGGAGGG - Intergenic
1026167955 7:67927781-67927803 ATAGAAACTCAAAACCGGGATGG - Intergenic
1026253838 7:68693703-68693725 ATGGGGCCTCCAAATGGGGGAGG - Intergenic
1027408103 7:77884388-77884410 ATGGAGACTCAGAAGGGGTAGGG - Intronic
1027609709 7:80345459-80345481 ATGGAGACTCAGAAGGTGGAGGG + Intergenic
1027836344 7:83248789-83248811 GTGGTTACTCAAAATGGGTATGG - Intergenic
1028123910 7:87089354-87089376 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
1028449486 7:90965163-90965185 ATGCAGAGACAAAGTGGGGATGG - Intronic
1028527009 7:91797646-91797668 ATGGAGACTAAAAGTGGGAAAGG + Intronic
1028607593 7:92671969-92671991 TTGGAGACTCAGAAAGGGGGAGG + Intronic
1030301312 7:107977126-107977148 ATGGATACTTAACATGGAGAAGG - Intronic
1030900024 7:115111873-115111895 ATGGGGACCCACAATTGGGAAGG + Intergenic
1030991544 7:116307143-116307165 ATGGAGACTTAGAAGGGTGATGG + Intronic
1031003674 7:116447250-116447272 TTGGAGACTCAGAAGAGGGAGGG + Intronic
1031656608 7:124363917-124363939 TTAGAGACTCATAAGGGGGAGGG - Intergenic
1031735369 7:125352980-125353002 CTGGGAACTCAAAAAGGGGAAGG + Intergenic
1031783451 7:125998470-125998492 ATGGGGACTGACAGTGGGGATGG + Intergenic
1035138666 7:156734479-156734501 ATGGAGAGTCAGAAGGGAGAGGG + Intronic
1035343219 7:158178354-158178376 TTGGAGACTCAGAAGCGGGAGGG - Intronic
1035543755 8:462732-462754 TTGGAGACTCAGAAGAGGGAAGG + Intronic
1035672143 8:1426287-1426309 TTGGAGACCTAAAATTGGGAAGG + Intergenic
1036576805 8:10035152-10035174 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1037032739 8:14128915-14128937 ATAGAGACTCCAAAAGTGGACGG + Intronic
1038333249 8:26626431-26626453 ATGGAGACACAGAATGGTAAAGG - Intronic
1038516562 8:28192499-28192521 ATGGTAGCTCAAAACGGGGAGGG - Intergenic
1039098347 8:33911922-33911944 ATGAAGACTCAGAAGGGTGAGGG + Intergenic
1039208294 8:35182250-35182272 TTGCAGACTCAGAATGGGGGAGG + Intergenic
1040719859 8:50306051-50306073 TTAGAGACTCAGAAGGGGGAGGG - Intronic
1041329593 8:56710460-56710482 TTGGGGACTCGACATGGGGAAGG + Intergenic
1041918302 8:63157864-63157886 ATGGGGAGTCAGAAAGGGGATGG + Intergenic
1042179067 8:66066709-66066731 TCGGAGACTCAGAAGGGGGAGGG + Intronic
1042784496 8:72533329-72533351 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1042890274 8:73602219-73602241 ATGGAGATTATAAATTGGGAGGG + Intronic
1043367596 8:79553275-79553297 TTGGAGACTCAGAAGGGGAAGGG + Intergenic
1043887576 8:85619951-85619973 ATGGTGACCAAAAATGGGTAAGG + Intergenic
1045090187 8:98733982-98734004 ATGGAGACTCACAATCATGACGG + Intronic
1046232951 8:111381475-111381497 TTGGAGACTCAGAAGGGGGCAGG - Intergenic
1046238964 8:111465187-111465209 TTAGAGACTCAGAATGTGGAGGG + Intergenic
1046317010 8:112517162-112517184 AATGGGACTCGAAATGGGGATGG - Exonic
1046905405 8:119567052-119567074 AGGGAGTCTCAAAATAGGAATGG - Intronic
1046956286 8:120066046-120066068 ATTGTGAGTAAAAATGGGGAAGG - Intronic
1046975836 8:120276345-120276367 TTGGAGACTCAGAGTGGGGAGGG + Intronic
1048039210 8:130709173-130709195 ATGGAGAATTAGAATGAGGAGGG + Intergenic
1048876486 8:138840364-138840386 AGGGAGACTCCAAAGAGGGAGGG + Intronic
1050101459 9:2124279-2124301 ACTGAGAATCAAAATGTGGAAGG + Intronic
1050195411 9:3078037-3078059 TTGGATACTCAAAACGGGGAAGG - Intergenic
1052512807 9:29442952-29442974 ATGGAGACTAAAATTAGAGAAGG - Intergenic
1052551488 9:29955834-29955856 ATGGAGACTCAGAATGGGGAGGG - Intergenic
1052654294 9:31335305-31335327 ATAGATACCCAAAATCGGGAGGG + Intergenic
1052768674 9:32667751-32667773 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1053107380 9:35422982-35423004 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1053361023 9:37486592-37486614 AGGGAGTGTCAGAATGGGGATGG - Intronic
1053487411 9:38470431-38470453 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1053524852 9:38818032-38818054 CTGGAGACTCAGAAGCGGGAGGG - Intergenic
1053525064 9:38820818-38820840 TTGGAGACTCAGAAGGGGAAGGG - Intergenic
1053594054 9:39542201-39542223 ATTGTGACTCCTAATGGGGATGG - Intergenic
1053672999 9:40388733-40388755 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1053750139 9:41245072-41245094 ATGGAGACTCAGCAGGGTGAGGG - Intergenic
1053851838 9:42297247-42297269 ATTGTGACTCCTAATGGGGATGG - Intergenic
1053922809 9:43015102-43015124 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1054197086 9:62042448-62042470 CTGGAGACTCAGAAGCGGGAGGG - Intergenic
1054197295 9:62045240-62045262 TTGGAGACTCAGAAGGGGAAGGG - Intergenic
1054255638 9:62809411-62809433 ATGGAGACTCAGCAGGGTGAGGG - Intergenic
1054335673 9:63806196-63806218 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1054384108 9:64528799-64528821 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1054511626 9:65987550-65987572 TTGGAGACTCAGAGCGGGGAGGG + Intergenic
1054572199 9:66822756-66822778 ATTGTGACTCCTAATGGGGATGG + Intergenic
1054641114 9:67543442-67543464 TTGGAGACTCAGAAGGGGAAGGG + Intergenic
1054641322 9:67546246-67546268 CTGGAGACTCAGAAGCGGGAGGG + Intergenic
1055340091 9:75272403-75272425 TTGGAAACTCAGAAGGGGGAAGG - Intergenic
1055662925 9:78524232-78524254 AGGAAGACTCAAAGCGGGGAGGG - Intergenic
1056813448 9:89782211-89782233 ATGGAAATGCAAAATGGGGTTGG - Intergenic
1057730112 9:97601161-97601183 AAGGAGAAGCCAAATGGGGATGG - Exonic
1058030011 9:100185707-100185729 TTGGGGACTCAGAAAGGGGAAGG - Intronic
1058463933 9:105209617-105209639 ATGGAGACTCAGAAGGAGAAGGG - Intergenic
1058587462 9:106525602-106525624 CTGGAGACTCAGAAGGGGGTGGG + Intergenic
1060343124 9:122794032-122794054 ATGGATACTAAATATGTGGAAGG - Intergenic
1060658278 9:125387832-125387854 ATGCAGATTCATTATGGGGATGG + Intergenic
1060855247 9:126909841-126909863 ATGGAGAGCCAAACTTGGGAAGG - Intergenic
1061074805 9:128334607-128334629 ATGGGGACTCAGAGAGGGGAAGG - Intergenic
1062652107 9:137583266-137583288 AAGGAGACTCAAACTCGGGCTGG - Intronic
1203371924 Un_KI270442v1:315169-315191 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1185926441 X:4152321-4152343 TTGGACACTCAGAAGGGGGAGGG - Intergenic
1186835861 X:13437159-13437181 TTGGAGACTCAGAAGGGTGAGGG + Intergenic
1187080287 X:15979042-15979064 CTGGAGACTCAGAAAGGGGGAGG + Intergenic
1187586657 X:20669993-20670015 TTGGATACTCAGAAGGGGGAAGG - Intergenic
1188137585 X:26508634-26508656 AGGGAGGCTCAAAAGGGAGAAGG - Intergenic
1188158741 X:26774966-26774988 ATGGAGACTCAGAAAGGGGAAGG + Intergenic
1188188771 X:27148250-27148272 TTGGAGACTCAAAAAGTGGGAGG + Intergenic
1188319461 X:28717709-28717731 ATTGAGATTCGAAGTGGGGAGGG + Intronic
1188372532 X:29386409-29386431 ATTGAGAGGCAAACTGGGGAAGG - Intronic
1189167478 X:38874955-38874977 TTGAAGACTCAGAATGGGGGAGG - Intergenic
1189817645 X:44839988-44840010 TTGGAGACTCATAATGGGCGAGG + Intergenic
1190056340 X:47183215-47183237 ATGGAGACTCAAAAGGTGGAGGG + Intronic
1190371906 X:49750761-49750783 AGGACAACTCAAAATGGGGAAGG + Intergenic
1190381071 X:49840239-49840261 GTGGAGACACTAAATGTGGAGGG - Intergenic
1191673177 X:63768135-63768157 TTGGAGACTCAGAAGGGGAAGGG - Intronic
1192058408 X:67797531-67797553 TTGGAGACTAAGAAGGGGGAGGG + Intergenic
1192063365 X:67854430-67854452 AGGAAGACTCCAAGTGGGGAGGG - Intergenic
1193187515 X:78530448-78530470 TTAGAGACTCAGAAGGGGGAGGG - Intergenic
1193470943 X:81902571-81902593 TTGGAGACTCAGAAGGGGGAGGG - Intergenic
1193532216 X:82669506-82669528 AGAAAGACTCAAAGTGGGGAGGG + Intergenic
1193979184 X:88159897-88159919 ATGGAGACTCAGAATGATGGTGG - Intergenic
1194088515 X:89558244-89558266 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
1194120141 X:89951717-89951739 AGGAAGACTTGAAATGGGGAGGG - Intergenic
1194285393 X:92004699-92004721 ATGGAAACCCAAAATGAGCAAGG - Intronic
1194695109 X:97038013-97038035 CTGGAGACTCAGAAGGGGGTAGG - Intronic
1194989294 X:100528206-100528228 ATTTAGAATCAAAATGGGGAAGG - Intergenic
1195010283 X:100726931-100726953 ATGGAGACTCAGAAGGGTGAGGG - Intronic
1196335846 X:114532918-114532940 ATGGAGAATCAAAATGTGTCAGG + Intergenic
1196395906 X:115261479-115261501 ATGGGGAGTTAAAAAGGGGATGG + Intergenic
1196421962 X:115531907-115531929 ATCCAGACTCTAAATGGGGGAGG + Intergenic
1196737720 X:118994357-118994379 ATGGACACCCAAAATGAGCAGGG + Intronic
1196796847 X:119508749-119508771 CTAGAGACTCAGAAAGGGGAGGG - Intergenic
1197163299 X:123347612-123347634 ATGGAGCCTCCGAGTGGGGAGGG - Intronic
1197618410 X:128719967-128719989 ATGGAGACTCAGAAGGAGGATGG - Intergenic
1197645952 X:129016681-129016703 TTGGAGACTCAGAAGGGGGTAGG - Intergenic
1198417189 X:136432612-136432634 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1198661753 X:138976533-138976555 ATAAAGACTCAGAAGGGGGATGG + Intronic
1198676451 X:139136354-139136376 TTAGAGACTCAGAACGGGGAGGG - Intronic
1198958859 X:142162284-142162306 ATGGAGATTGAAAAAGTGGAAGG - Intergenic
1198961361 X:142186688-142186710 ATGGAGATTGAAAAAGTGGAAGG - Intergenic
1199078096 X:143546956-143546978 TTAGAGACTCAGAAGGGGGAAGG + Intergenic
1199372921 X:147072782-147072804 ATGGAGAAGGAATATGGGGAAGG + Intergenic
1200211871 X:154350293-154350315 ATGGACCGGCAAAATGGGGAGGG - Intronic
1200408229 Y:2836437-2836459 AGGGCAACTCAAAGTGGGGAGGG + Intergenic
1200441191 Y:3214291-3214313 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
1200473002 Y:3609238-3609260 AGGAAGACTTGAAATGGGGAGGG - Intergenic
1200491400 Y:3827990-3828012 TTGGAGATTCAGAAGGGGGAAGG + Intergenic
1200602964 Y:5229238-5229260 ATGGAAACCCAAAATGAGCAAGG - Intronic
1201066423 Y:10099957-10099979 ATGGAGACTCAGGAGGGTGAGGG - Intergenic
1201288725 Y:12401621-12401643 GGGGAGACTCGAAGTGGGGAGGG + Intergenic
1201398708 Y:13578624-13578646 TTGGAAACTCAGAATAGGGAAGG + Intergenic
1201761461 Y:17543930-17543952 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1201794596 Y:17881470-17881492 ATGGAGTCTGAAAAGGGGCAAGG - Intergenic
1201806959 Y:18024515-18024537 ATGGAGTCTGAAAAGGGGCAAGG + Intergenic
1201840091 Y:18362060-18362082 ATGGAGACTCAGCAGGGTGAGGG - Intergenic
1201865630 Y:18650820-18650842 ATGTAGAATAAAAATAGGGAAGG - Intergenic
1202355970 Y:24049250-24049272 ATGGAGTCTGAAAAGGGGCAAGG - Intergenic
1202514808 Y:25620859-25620881 ATGGAGTCTGAAAAGGGGCAAGG + Intergenic