ID: 1166603327

View in Genome Browser
Species Human (GRCh38)
Location 19:44117656-44117678
Sequence CTCCACCAGAAGTGCAGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166603327_1166603329 2 Left 1166603327 19:44117656-44117678 CCATCACTGCACTTCTGGTGGAG No data
Right 1166603329 19:44117681-44117703 CAGGAAAATCCATCATTATCAGG 0: 1
1: 0
2: 0
3: 9
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166603327 Original CRISPR CTCCACCAGAAGTGCAGTGA TGG (reversed) Intronic
No off target data available for this crispr