ID: 1166604929

View in Genome Browser
Species Human (GRCh38)
Location 19:44132916-44132938
Sequence CTAGTGTTTTACACCACTAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 452
Summary {0: 1, 1: 0, 2: 4, 3: 68, 4: 379}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166604929_1166604934 29 Left 1166604929 19:44132916-44132938 CCTGTAGTGGTGTAAAACACTAG 0: 1
1: 0
2: 4
3: 68
4: 379
Right 1166604934 19:44132968-44132990 TGTATTCATTAACCAACCTTTGG 0: 2
1: 7
2: 18
3: 42
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166604929 Original CRISPR CTAGTGTTTTACACCACTAC AGG (reversed) Exonic