ID: 1166605881

View in Genome Browser
Species Human (GRCh38)
Location 19:44142099-44142121
Sequence ACCTGTTAGGTCCCCCGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 45}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166605872_1166605881 22 Left 1166605872 19:44142054-44142076 CCCTGTCACTTGGTGAGTGGTGG 0: 1
1: 3
2: 2
3: 11
4: 162
Right 1166605881 19:44142099-44142121 ACCTGTTAGGTCCCCCGGTGGGG 0: 1
1: 0
2: 0
3: 5
4: 45
1166605874_1166605881 21 Left 1166605874 19:44142055-44142077 CCTGTCACTTGGTGAGTGGTGGT 0: 1
1: 3
2: 1
3: 6
4: 106
Right 1166605881 19:44142099-44142121 ACCTGTTAGGTCCCCCGGTGGGG 0: 1
1: 0
2: 0
3: 5
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166605881 Original CRISPR ACCTGTTAGGTCCCCCGGTG GGG Intronic
907390165 1:54152925-54152947 ACCTGTGGGGGCCCCTGGTGAGG - Exonic
1069655550 10:70085264-70085286 ACCTGTGAAGCCCCCAGGTGAGG + Intronic
1079088564 11:17464759-17464781 ACCTGTGAAGTCCCCCTTTGAGG + Intronic
1079340364 11:19606656-19606678 ACCTTTGAGGTCCCCCTCTGTGG - Intronic
1089699141 11:120234031-120234053 ACCTTCTAGGTCCCCAGCTGGGG - Intergenic
1118650198 14:67883107-67883129 ACCTGTTACTTCCCTGGGTGAGG + Intronic
1122211422 14:100176486-100176508 ACCTGTTGGGTACCCTGATGTGG + Intergenic
1126521910 15:49605362-49605384 ACCTCTTGGGTCCACCGGAGTGG + Intronic
1128137246 15:65272987-65273009 ACCTGTGTGGTGGCCCGGTGTGG + Intronic
1128837587 15:70823332-70823354 AACTGTTAAGTTCCCCTGTGAGG + Intergenic
1129303427 15:74640464-74640486 ACCTGTTAGGTCCTCCGAGGAGG + Exonic
1129851617 15:78797019-78797041 CCCTTTGAGGTCCCCCTGTGAGG - Intronic
1133748713 16:8707669-8707691 AGCTTTTAGGTTCCACGGTGTGG - Intronic
1137677021 16:50308788-50308810 ACCTGGTGGGTCCCGTGGTGGGG + Exonic
1141501903 16:84450366-84450388 ACCTGCTAGATCCCCTGGAGTGG + Intronic
1141995685 16:87635201-87635223 ACCTGAGAGGTCCCAGGGTGGGG - Intronic
1146552448 17:33793060-33793082 ACCTGTTAGATAACCCTGTGTGG + Intronic
1151694073 17:75705217-75705239 ACCTATTAGGTCCCACGTTAGGG + Intronic
1161509434 19:4662422-4662444 AGCCGTCAGGCCCCCCGGTGGGG - Intronic
1166059927 19:40319915-40319937 GCCTGTTAGGGTCCCCGCTGGGG - Exonic
1166593696 19:44025837-44025859 GCCTGTCAGGTCCTCTGGTGGGG + Intronic
1166598527 19:44072673-44072695 GCCTGTCAGGTCCCCGGGTGGGG + Intronic
1166602956 19:44113937-44113959 GCCTGTCAGGTCCCCGGGTGGGG + Intronic
1166605881 19:44142099-44142121 ACCTGTTAGGTCCCCCGGTGGGG + Intronic
927519305 2:23689471-23689493 AGCCGTGAAGTCCCCCGGTGGGG - Intronic
930044298 2:47155342-47155364 ACCTGGCGGGTCCCCCGGAGCGG - Exonic
932478213 2:72022291-72022313 AGATGTTAGGTTCCCAGGTGAGG - Intergenic
937526741 2:122779891-122779913 TCCTGTGAGTTCCCCCAGTGAGG - Intergenic
940447880 2:153799071-153799093 ACCTGTTAAGTCACCCAGTGAGG - Intergenic
948196272 2:236099038-236099060 ACCTGCTGGCTCCCCCGCTGGGG - Intronic
1181057544 22:20267366-20267388 GGCTGTGAGGTCCCGCGGTGCGG - Intronic
1181313040 22:21955826-21955848 ACCTGTTAGGTCCCCAGTGCGGG - Intergenic
1181346147 22:22221898-22221920 ACCTGTTAGGTCCCCAGTGCGGG - Intergenic
950629810 3:14274964-14274986 CCCTGGGAAGTCCCCCGGTGTGG + Intergenic
950703674 3:14767132-14767154 GCCTGTTAGGTCCCCAGGATGGG + Intronic
953444845 3:42954500-42954522 TCCTGTCAGGTCCTCAGGTGAGG + Intronic
961118926 3:124356622-124356644 ACCTGTTAAGTGGCCAGGTGCGG - Intronic
967985099 3:195088410-195088432 CCCTGTGAGGTGCCCCGCTGGGG - Intronic
993766516 5:91865235-91865257 CCCTGTTAGGTCCCCTGCAGGGG + Intergenic
999116590 5:149169442-149169464 ACCAGGGAGGTCCCCTGGTGTGG - Intronic
1007194763 6:40050993-40051015 ACTGGTTAGGACCCCCAGTGGGG - Intergenic
1016654972 6:146508173-146508195 ACATGTGGGGTCCCCCTGTGGGG + Intergenic
1018046466 6:159969809-159969831 ACCGGTGAGGCCCCTCGGTGTGG + Intronic
1023128454 7:36978260-36978282 ACAACTTAGGTCCCCTGGTGTGG - Intronic
1044830261 8:96240694-96240716 ACCTGTGAGGTTCCCCGATGAGG + Intronic
1046036088 8:108843316-108843338 AGCTGTTTCTTCCCCCGGTGGGG - Intergenic
1057198115 9:93126392-93126414 CCTTGGTAGGTCCCCAGGTGGGG - Exonic
1062541765 9:137044679-137044701 CCCTGCCAGGTCTCCCGGTGAGG + Intronic
1186463276 X:9765340-9765362 ACCTGCTCGGTCCCCGGCTGAGG - Intronic
1189378015 X:40480830-40480852 TCCTGCTAGGGCCCCCTGTGTGG + Intergenic
1198731519 X:139735440-139735462 TCCTGATAGATCCCCCGATGTGG - Intronic