ID: 1166608793

View in Genome Browser
Species Human (GRCh38)
Location 19:44170115-44170137
Sequence AAATGGTATTTTTAACAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 338
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 310}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166608793_1166608799 27 Left 1166608793 19:44170115-44170137 CCCAGCTGTTAAAAATACCATTT 0: 1
1: 0
2: 2
3: 25
4: 310
Right 1166608799 19:44170165-44170187 TCTTTTTCAAGTAAGAGTCAAGG 0: 1
1: 0
2: 1
3: 36
4: 394
1166608793_1166608797 0 Left 1166608793 19:44170115-44170137 CCCAGCTGTTAAAAATACCATTT 0: 1
1: 0
2: 2
3: 25
4: 310
Right 1166608797 19:44170138-44170160 TAGTACTCAGAGATGGAACCAGG 0: 1
1: 0
2: 2
3: 8
4: 112
1166608793_1166608795 -7 Left 1166608793 19:44170115-44170137 CCCAGCTGTTAAAAATACCATTT 0: 1
1: 0
2: 2
3: 25
4: 310
Right 1166608795 19:44170131-44170153 ACCATTTTAGTACTCAGAGATGG 0: 1
1: 0
2: 0
3: 8
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166608793 Original CRISPR AAATGGTATTTTTAACAGCT GGG (reversed) Intronic
901566412 1:10119440-10119462 AACTCTTATTTTTAACAGCATGG + Intronic
906996255 1:50797291-50797313 AGATGGTGGTTTTCACAGCTGGG - Intronic
907195846 1:52686374-52686396 GAATGGTATTGTTACCAGCAGGG + Exonic
907771189 1:57466012-57466034 AAATGCTCTCTTTAATAGCTAGG + Intronic
907904293 1:58770201-58770223 AAATGGAATTTAAAACAGCAGGG + Intergenic
908096553 1:60745427-60745449 ATATGGTATTTTTATCAAATGGG + Intergenic
908684653 1:66701976-66701998 AAATGATATTTTCACCAACTAGG - Intronic
909390889 1:75120432-75120454 TAATGTTATTTTTCAGAGCTTGG - Intergenic
911603893 1:99879005-99879027 AAATGTTGTGTTTAACAGTTTGG + Intronic
911947649 1:104132973-104132995 AAATGGTATTCTGAACACCTGGG - Intergenic
911952221 1:104189011-104189033 GAATAATATTTTAAACAGCTGGG - Intergenic
912848765 1:113103211-113103233 AAATTGGATTTTACACAGCTAGG - Intronic
913510393 1:119555945-119555967 CTATGATAGTTTTAACAGCTAGG - Intergenic
915214762 1:154332550-154332572 AAATGTTTTTTTTCACAGATGGG - Intronic
915610344 1:156986851-156986873 AAATGGAATTTTCAAAGGCTTGG - Intronic
916799119 1:168197827-168197849 AAACAGTATTTTTAACATTTAGG - Intronic
917904179 1:179573134-179573156 AAATCTTATTTTTAAGAGATGGG + Intronic
918846647 1:189623770-189623792 AGATGGTATTTTAATCAGGTTGG - Intergenic
919420669 1:197366111-197366133 AAATGATATTTTGAACTTCTTGG - Intronic
922960622 1:229642696-229642718 AGGTGGTATTTTAAACAGATGGG - Intronic
923513235 1:234671830-234671852 TAATTGTAGTTTCAACAGCTTGG + Intergenic
1063360570 10:5452948-5452970 AAATGTAATTTTTAAAAACTAGG - Intronic
1064386839 10:14901936-14901958 AAATGTTCTTTTTAAAAGCCAGG - Intronic
1065721527 10:28632508-28632530 AAATAGTACTTATTACAGCTAGG + Intergenic
1066612766 10:37266923-37266945 AAATAGTAATTTTAAAAGCATGG - Intronic
1067998277 10:51301258-51301280 GAAGGGTATTTTTAATAACTTGG + Intronic
1068676399 10:59774034-59774056 AAATGGGAGTTATAACAACTTGG - Intergenic
1069315425 10:67093732-67093754 ATATGGTATTTTTCACACCAGGG - Intronic
1074102710 10:110366143-110366165 AAAAAGTCTTTTTGACAGCTTGG + Intergenic
1074116709 10:110461608-110461630 TAATGGTTATTTTAACTGCTGGG + Intergenic
1074299875 10:112224236-112224258 AAATTGTATTTTAAATGGCTGGG - Intergenic
1074604011 10:114942373-114942395 AAACGGCATTTTTAAAAGGTGGG - Intronic
1074936789 10:118189991-118190013 ATATTGAATTATTAACAGCTGGG - Intergenic
1077720075 11:4619481-4619503 TAAGGGTATTTTTCACAGATTGG - Intergenic
1078211013 11:9269489-9269511 AAAAGGAATTTTTAAAATCTGGG + Intergenic
1078839160 11:15062046-15062068 AAATGGTAGTCTTAACATTTTGG - Intronic
1080124643 11:28718728-28718750 AAAGGGTCTTTTTAACAGTCTGG + Intergenic
1081037603 11:38168493-38168515 AAATTGAAATTTTAAAAGCTAGG - Intergenic
1081452573 11:43186055-43186077 AACTGGTATTTTTAATTCCTGGG + Intergenic
1082212835 11:49526283-49526305 GAATGTTATTTATAAGAGCTGGG - Intergenic
1086636761 11:89098226-89098248 GAATGTTATTTATAAGAGCTGGG + Intergenic
1087885585 11:103478144-103478166 AAATGGTATTATGAACTGGTGGG - Intronic
1088161449 11:106876569-106876591 AAATGGTATTTATAGGAGGTTGG - Intronic
1089050423 11:115540486-115540508 TAATGGTATTTTGAAAAACTAGG + Intergenic
1091631921 12:2168493-2168515 AAATGGCATTTTTTAAAGCCTGG - Intronic
1092726073 12:11486790-11486812 AAAAGTTACTTTTAACAGCAGGG + Intronic
1093330749 12:17835023-17835045 AAATGATATTTTTAAAAATTTGG + Intergenic
1093751580 12:22806105-22806127 AAATGGTATTCGAAACAGCATGG + Intergenic
1095179234 12:39127832-39127854 AAATGGTATTTTTAAAAAAGAGG - Intergenic
1095321154 12:40828836-40828858 AAATGGTTTGTTTGACAGCAAGG - Intronic
1095369300 12:41447598-41447620 AAATGGTAATTTTTATAGTTAGG + Intronic
1097831581 12:64230157-64230179 AAATTTTATTTTTTAGAGCTAGG + Intergenic
1098772520 12:74571462-74571484 AAATGATATTTTTGAAAGCTAGG + Intergenic
1099199772 12:79661782-79661804 AAATGGTAATATGATCAGCTGGG + Intronic
1100109637 12:91223911-91223933 AAATTATATTTTTAAAATCTAGG - Intergenic
1100371360 12:93971788-93971810 AAATGATCTCTTTAACAGGTAGG - Intergenic
1101126800 12:101643497-101643519 AGATGGCTTTTTTAAAAGCTAGG + Intronic
1103118834 12:118363084-118363106 AAGTGGTATTTTTATCAGATTGG - Intronic
1104469792 12:129020321-129020343 AAAAAGTATTTTAAACAGATGGG + Intergenic
1106088038 13:26560497-26560519 AAATGGTTTTTTTAACATACAGG - Intronic
1106776410 13:33014771-33014793 AAATGCTATATTTAACAGAATGG + Intergenic
1106999873 13:35530413-35530435 AGATGGTGTTTTCTACAGCTGGG + Intronic
1107348731 13:39491298-39491320 AAATAGCATTTCTGACAGCTGGG + Intronic
1107430918 13:40339549-40339571 AAATGGGACTTTTATCAGTTTGG - Intergenic
1108769777 13:53685500-53685522 AAATGGCATTTTTGATTGCTGGG - Intergenic
1109426440 13:62170227-62170249 AAATGTTATTTTAAAAATCTGGG - Intergenic
1109461421 13:62663856-62663878 AAATATTTTTTTTAAGAGCTGGG + Intergenic
1109788872 13:67221248-67221270 AATTGATATTTAGAACAGCTAGG - Intronic
1110028509 13:70573042-70573064 AAATGGTACTTTTAAAAGTATGG + Intergenic
1110480473 13:75968367-75968389 AAATGGTATTTTTTTCACATTGG + Intergenic
1110612725 13:77506915-77506937 AAATGGTATTTTTTTAAACTAGG + Intergenic
1110813335 13:79834812-79834834 GAATGATATATTTAAGAGCTGGG - Intergenic
1111761206 13:92467692-92467714 GAGTCGTATTTTTAACTGCTGGG + Intronic
1112942879 13:104887792-104887814 TAATGCTATTTTTAAAAGATAGG + Intergenic
1113738382 13:112693960-112693982 TAAGAGTATTTTTAACAGCATGG + Intronic
1114489304 14:23087839-23087861 AAATGGTATTTTTAAAGGAGAGG - Intronic
1115074157 14:29365347-29365369 AAATGGTATTTTCACCCTCTGGG - Intergenic
1115331986 14:32207670-32207692 AAATTGTCTTTTTAAAAGTTTGG + Intergenic
1116839554 14:49805842-49805864 AAATAGTGTTTTTAAAAGCATGG - Intronic
1118404459 14:65410189-65410211 AAATGTATTTTTTAAAAGCTGGG + Intergenic
1120390816 14:83905629-83905651 AAATGGTAGTTTGAACATATAGG - Intergenic
1122063554 14:99156066-99156088 CAATGGTATTTTTAGCCACTTGG - Intergenic
1123823663 15:24058900-24058922 ATCTGATATTTTTAATAGCTAGG - Intergenic
1125636665 15:41194315-41194337 AAGTGATTTTTTTAACAGCAAGG + Intronic
1126994724 15:54428043-54428065 AAAAGGTATTATTCACATCTAGG - Intronic
1127361897 15:58251740-58251762 GAATGGTATTTTAATCATCTTGG - Intronic
1128298418 15:66545035-66545057 AAATGGCATTTTTTTCAGCTGGG - Intronic
1131617894 15:94035534-94035556 AAATAGAATTTTTAAAAACTAGG + Intergenic
1132382748 15:101378074-101378096 AAATAGAATATTTAATAGCTGGG + Intronic
1133640442 16:7711848-7711870 TCATGGTATTTTCATCAGCTTGG + Exonic
1133918289 16:10128895-10128917 AAATACTATTGTTAATAGCTGGG - Intronic
1133925597 16:10189690-10189712 AGATGCTATTTTTAAAAGCCTGG - Intergenic
1133990342 16:10701869-10701891 AGATAGTATTTGTAATAGCTTGG - Intergenic
1135681491 16:24461038-24461060 AAAAGGTATTTTTATTGGCTTGG - Intergenic
1135764973 16:25169739-25169761 AAAAGGTTTTTTAAACAACTGGG - Intronic
1137659396 16:50191612-50191634 TAATGATATTTTTAAAGGCTTGG - Intronic
1138828608 16:60351755-60351777 GAATTGTATTTTTAACAAATTGG + Intergenic
1138962481 16:62044273-62044295 AATTGGTATTCTTAACATCGAGG + Intergenic
1140265269 16:73415357-73415379 AAATATAATTTTTAACAGCATGG - Intergenic
1140943990 16:79750103-79750125 AATTGTGAGTTTTAACAGCTAGG - Intergenic
1142490664 17:276788-276810 AAATGGAAAATATAACAGCTTGG - Intronic
1143182901 17:4994908-4994930 AAAAGGTATTTGTAGCGGCTGGG + Intronic
1144766023 17:17732945-17732967 CAATGTTATTTTTAAAAGCCTGG - Intronic
1146046132 17:29509501-29509523 AGATATTATTTTTAATAGCTTGG + Intronic
1146364298 17:32207289-32207311 ATATGTAACTTTTAACAGCTGGG - Intronic
1147033270 17:37659110-37659132 AATGTGTATTTTTAAAAGCTGGG - Intergenic
1147179808 17:38677197-38677219 AAATGGTAATTGCAGCAGCTGGG - Intergenic
1148042655 17:44721163-44721185 ACATAGTATTTTTAAAATCTTGG - Intronic
1149223889 17:54445812-54445834 AAATAATAGTTTTAATAGCTTGG + Intergenic
1149282024 17:55116485-55116507 AATTGGTATTTAAAACAGTTTGG + Intronic
1150019323 17:61594718-61594740 AGATGGTATTTTAAAAAGCCTGG - Intergenic
1150824137 17:68459776-68459798 AAATGATATTTTTGACACATTGG - Intergenic
1150839241 17:68592637-68592659 AGATGAGATTTTTAAAAGCTTGG - Intronic
1150973349 17:70055899-70055921 AAATGTCATTTTTAACAGACTGG + Intronic
1154331869 18:13436677-13436699 AAATGTGATTTCAAACAGCTGGG + Intronic
1155499898 18:26477240-26477262 AAAAAGCATTTTTAACAGCCAGG + Intronic
1155652099 18:28154740-28154762 ACATGGAATATTTAAGAGCTTGG - Intronic
1155924427 18:31639793-31639815 AAATGGTGTTTTTAAGTGTTGGG - Intronic
1156064826 18:33127740-33127762 AGTTGGTATTTTTAACAGTAGGG + Intronic
1156177807 18:34567923-34567945 AAATTGTATTTTTAAAAACCCGG - Intronic
1156941962 18:42778699-42778721 AAATGGAATTTTTAGCAGCTAGG - Intronic
1156949735 18:42880744-42880766 GAATGGTGATTTTAACAGCAAGG + Intronic
1160012210 18:75114646-75114668 AAATGGCATTTTTAATATCACGG + Intergenic
1166608793 19:44170115-44170137 AAATGGTATTTTTAACAGCTGGG - Intronic
1167118983 19:47505548-47505570 AAATGAGATTTTTAACAATTGGG + Intronic
1168558714 19:57364889-57364911 AAATGGAGTTTTTGCCAGCTGGG + Exonic
924991668 2:317797-317819 AAATGGTATTTTTCACTTTTTGG + Intergenic
926990039 2:18669096-18669118 AATTGATATTTTTAATAGCCTGG + Intergenic
928683438 2:33726135-33726157 AAATGTTATTTTTAACACTGAGG + Intergenic
928752896 2:34491647-34491669 AAATGGTAGTTATGACAGCAGGG + Intergenic
928947274 2:36782652-36782674 AAATGGTATATTTATGAACTTGG + Intronic
929180612 2:39034148-39034170 AAAAGGTATTTTTAATCACTAGG - Intronic
929266361 2:39922975-39922997 AAATGTTATTTTCATTAGCTGGG - Intergenic
930436640 2:51352498-51352520 AAAAGGAATTTTTAAAAGCAAGG - Intergenic
930777850 2:55192417-55192439 AAATTGTATTTTTAAAAAGTAGG + Intronic
935071468 2:99698013-99698035 GAATTATATTTTGAACAGCTGGG - Intronic
936620531 2:114092218-114092240 AAATAGTCTTTTTAACAAATAGG - Intergenic
936819357 2:116500060-116500082 AAAGTCTATTTTTAAAAGCTAGG - Intergenic
937497318 2:122434737-122434759 AAATGGTTTTTTTAAGAATTGGG - Intergenic
937515572 2:122651250-122651272 AAATGGTACTTTAAAATGCTAGG - Intergenic
938109196 2:128552803-128552825 AAATGGTGTTTTTAAGAGACAGG - Intergenic
939165377 2:138636093-138636115 AAATGATCTTCTTAACAGCAGGG + Intergenic
939697392 2:145343558-145343580 AAATGGTATCTTTAGCCACTGGG + Intergenic
942079932 2:172390537-172390559 AAATGGTCTTTTTCTCTGCTTGG - Intergenic
942993546 2:182232544-182232566 AAATGGTATTTTTAATCACTTGG + Intronic
944077740 2:195751328-195751350 AAGAGGTATCTTTAACAGGTTGG + Intronic
944299218 2:198103596-198103618 AAATTGTATTTAAAACAGCCAGG - Intronic
945705752 2:213229307-213229329 AAGTGGTATTTTTAAATGGTAGG + Intergenic
945765117 2:213966557-213966579 AAATATTATTTTCAACACCTTGG - Intronic
946505690 2:220298445-220298467 CAATAGTATTTTTCACAGCTTGG + Intergenic
947645456 2:231735704-231735726 TAATAGTTTTTTTAACAGCCAGG - Intronic
947981832 2:234417090-234417112 AAATGGCATCATTAAGAGCTAGG + Intergenic
1170147798 20:13196175-13196197 AAATGGTCAGTTTAATAGCTTGG - Intergenic
1170161798 20:13320814-13320836 AAATGGTATCTTTAACTTCTGGG - Intergenic
1173173409 20:40745535-40745557 AAATGGTATTTATCACAGGCAGG + Intergenic
1173321657 20:41992672-41992694 AAATGATAGTGTTAACAGGTGGG - Intergenic
1174159877 20:48543165-48543187 AAATGCCATTTTTAACATCCAGG + Intergenic
1174584994 20:51601583-51601605 AAATGCTACTTTTAACACCCAGG + Intronic
1174821622 20:53731398-53731420 AAATGATAGTATTAAGAGCTGGG + Intergenic
1177825088 21:26074022-26074044 GGATGGTATCTTTATCAGCTGGG - Intronic
1177972046 21:27802078-27802100 AAATGGTATAATTAACATTTAGG - Intergenic
1178795370 21:35739061-35739083 AAAAGCTATTTTTAACAGGTTGG + Intronic
1179021032 21:37641281-37641303 AAATGAAATTATTACCAGCTGGG - Intronic
1179206349 21:39283698-39283720 AACAGGTATTTTTAACTTCTGGG + Intronic
1180763948 22:18232081-18232103 AAATGTTAAGTTTAACAGTTAGG - Intergenic
1180771697 22:18392461-18392483 AAATGTTAAGTTTAACAGTTAGG + Intergenic
1180803076 22:18642075-18642097 AAATGTTAAGTTTAACAGTTAGG + Intergenic
1180851146 22:19021714-19021736 AAATGGTAAATGTAACAGCCTGG - Intergenic
1181218641 22:21353185-21353207 AAATGTTAAGTTTAACAGTTAGG - Intergenic
1181929536 22:26389330-26389352 AATTTGTGTTTTTAAGAGCTTGG + Intergenic
1203233535 22_KI270731v1_random:133452-133474 AAATGTTAAGTTTAACAGTTAGG + Intergenic
949166414 3:947349-947371 AAGTGGTATGTTTAAAAGTTGGG + Intergenic
949298595 3:2556562-2556584 AAATTATACTGTTAACAGCTCGG + Intronic
951115328 3:18854525-18854547 AAATTGGATTTTTAACAACTGGG - Intergenic
951159235 3:19396426-19396448 AAGAGGTATTTTTAAGAACTTGG - Intronic
951599934 3:24362454-24362476 AAATGCAATTTTAAACAGCTTGG - Intronic
951750507 3:26029359-26029381 AAATATTATTTTTGACAACTGGG - Intergenic
952308195 3:32163798-32163820 AAATGATAGTTTTAAAAGTTGGG + Intronic
953106127 3:39881406-39881428 AACTGGTAATTTTCACAACTGGG - Intronic
953592582 3:44273740-44273762 AAATGGGATTCTTGATAGCTGGG - Intronic
953640701 3:44704726-44704748 AAATGGAATTCTTCACAACTTGG - Intergenic
954986808 3:54801777-54801799 CAATGGTATGTTTAAAAGCAAGG - Intronic
955801609 3:62692681-62692703 AGATGGTATTGTTACCATCTTGG - Intronic
956199736 3:66693930-66693952 AAAGAGTATTTTTAGCCGCTAGG + Intergenic
956321735 3:68005349-68005371 AAACATTATTTTCAACAGCTTGG - Intronic
956612490 3:71138229-71138251 AAATGGGATTTTTAATATTTAGG + Intronic
957163573 3:76641686-76641708 ATATGGTAATTTTAACTTCTTGG + Intronic
959545579 3:107592204-107592226 AAATGGTGTATTAAACAGCTGGG + Intronic
960223394 3:115143743-115143765 AGTTGGTAATTTTAACAGATAGG - Intronic
960355425 3:116646981-116647003 AAATGGTGTTTTAAACAGAAAGG - Intronic
960466458 3:118001794-118001816 AGATGATTTTTTTAACAGATGGG + Intergenic
960923799 3:122776697-122776719 AAATTGAATTTTAAACAGTTTGG + Intronic
960956157 3:123032808-123032830 AATTGGTAATTTTCAGAGCTAGG + Intergenic
961399246 3:126623986-126624008 AAATGGCATTTTTAAATGGTTGG - Intronic
962552291 3:136507189-136507211 ATATGGTGTGTTTAAGAGCTGGG - Intronic
963268095 3:143259077-143259099 AAATGGTATATATAAGAGATCGG - Intergenic
964152188 3:153540165-153540187 TTATGATATTTTTAACATCTGGG - Intergenic
964546301 3:157838303-157838325 AAGTGGAATTTTTAATACCTAGG + Intergenic
965242745 3:166224794-166224816 ATATGGTATTATTGACATCTGGG - Intergenic
965696820 3:171417584-171417606 AAATGGAAATTTAAAAAGCTAGG - Intronic
965852967 3:173053049-173053071 AAATTTCATTTTTAACATCTAGG - Intronic
967247687 3:187504442-187504464 AAATGGTATATCTGACAGGTTGG - Intergenic
968207210 3:196813987-196814009 AAATGTTATTTTAAAAAGCAGGG - Intronic
970385046 4:15547710-15547732 AAATGCTATTTTTAAAAATTAGG - Intronic
971242536 4:24901542-24901564 AACTGCTATTTTTAACTGATGGG - Intronic
972166449 4:36290928-36290950 AAATGTTATTTTTTTCACCTAGG + Intronic
972304376 4:37818066-37818088 AAATCAAATTTTTAACAGCATGG + Intergenic
974108941 4:57503792-57503814 AAATGGTAATTTTAAAACCTGGG - Intergenic
974598870 4:64050173-64050195 AAAAGGCATTTTTAGCAGCCAGG + Intergenic
974922414 4:68258255-68258277 AAATTAAATTTTTAAAAGCTAGG + Intergenic
976370210 4:84279239-84279261 ACATGGTATATTTAAGGGCTTGG - Intergenic
976604667 4:86971303-86971325 ACATGTTATTTTTAATAGCTAGG + Intronic
976842745 4:89451024-89451046 AAATGGCACTTTTATCAGCAAGG - Intergenic
977643847 4:99389057-99389079 AAATGTTATTTGGAACAGTTTGG + Intergenic
978162544 4:105566233-105566255 AAATAGTATATTTAAAGGCTTGG - Intronic
978928668 4:114283653-114283675 AAGAGGTATTTTTAACATCTAGG - Intergenic
979028991 4:115615334-115615356 AAATGGTATTTTTCAAAGATGGG + Intergenic
980639789 4:135562668-135562690 AAACAGTATCTTTAAGAGCTTGG + Intergenic
980943776 4:139299721-139299743 AAATGGCAATTTTAAAGGCTCGG - Intronic
981471775 4:145143578-145143600 ATATGTTATTTTCAACAGGTAGG + Intronic
981544072 4:145876345-145876367 AAATTGTTTTTTTCACAACTGGG - Intronic
982912786 4:161165765-161165787 GAATGGTATTTTTAATGGGTGGG - Intergenic
982969540 4:161965959-161965981 AGATGATATTTAAAACAGCTGGG + Intronic
982989978 4:162261492-162261514 AAATCCTATTTTTAAAAGCCTGG - Intergenic
983144097 4:164190591-164190613 AAATGTTCTATTTAACAACTGGG + Intronic
983320309 4:166188860-166188882 AAATTATATTTTTAACAACCTGG - Intergenic
985352682 4:189083048-189083070 AAATGGTATTTGTAGTGGCTTGG - Intergenic
985795273 5:1957465-1957487 AAATGGCATTTTCAACCGATGGG - Intergenic
986519459 5:8598533-8598555 AAATGTGATGGTTAACAGCTGGG - Intergenic
986901117 5:12434825-12434847 AAATGTTATTTATAATTGCTAGG + Intergenic
990965308 5:61440605-61440627 AAAAGGTATTTTTAAAAGCAAGG - Intronic
991552077 5:67849587-67849609 AATTGGAATTTTAAACAGCTAGG + Intergenic
991623473 5:68571427-68571449 TAATGGTATTTGTAGCAGCCTGG + Intergenic
992513592 5:77468037-77468059 AAGGAGTATTTTTAACAACTTGG - Intronic
992970413 5:82051003-82051025 GAATTGTTTTTTTAACAGATAGG - Intronic
993221252 5:85100320-85100342 AAAGAGTTTTTTTAAAAGCTTGG + Intergenic
994654843 5:102579567-102579589 AAATGATATTTTTAATATATTGG - Intergenic
995337291 5:111014253-111014275 AAGTGGAATTTTTAACGGGTGGG + Intergenic
995445052 5:112233581-112233603 AATTTGTATTTTTAATAGATAGG + Intronic
995449075 5:112280616-112280638 TAATGTTATTTTTAAAAGATGGG - Intronic
995717547 5:115094734-115094756 AAATTGTATTTTAATCAGCTAGG + Intergenic
998282050 5:140821254-140821276 AAAAGTTATTTTTATCAGTTTGG + Intronic
998446315 5:142201139-142201161 AAATGGTATTTAGAAGATCTGGG - Intergenic
999030853 5:148289391-148289413 ATATGATATTTTTAACACCCAGG - Intergenic
999590534 5:153140325-153140347 AAATGGTTTTTTTAAAAGACAGG + Intergenic
999762112 5:154710438-154710460 AAATTTTTTTTTTAACAGATAGG - Intergenic
1000427701 5:161112100-161112122 AAATGCTATTATTAACCGATAGG - Intergenic
1000679471 5:164165080-164165102 AAGTGGTATTTGTCACATCTGGG - Intergenic
1001031141 5:168264246-168264268 AGCTGGTATTTTGAACACCTGGG + Intergenic
1001736916 5:174013101-174013123 AAATTTTTTTTTTAACAACTGGG + Intergenic
1001835484 5:174827710-174827732 AAATGTTATTTTTAAAGGGTGGG - Intergenic
1001912152 5:175529503-175529525 AAAAGGTATTTCTAAAAGATCGG - Exonic
1002904404 6:1437293-1437315 AAATTGTTTTTTTAAGAGATGGG + Intergenic
1003387429 6:5682162-5682184 TATTGTCATTTTTAACAGCTAGG - Intronic
1003675605 6:8201807-8201829 GAATGATATTTTAAGCAGCTTGG - Intergenic
1004038051 6:11943484-11943506 AATTGGTAATTTTAAAAGGTAGG + Intergenic
1004203650 6:13572675-13572697 AATTGGTATGTGTAGCAGCTTGG + Intergenic
1004426123 6:15508299-15508321 AAAGGGCATTTTTAAAAGCTAGG - Intronic
1004781527 6:18913805-18913827 ACATGGTATTTCTAACATCCTGG - Intergenic
1005638041 6:27769737-27769759 AAATGGCATCTTTTAAAGCTTGG - Intergenic
1006121415 6:31808606-31808628 AAAAAATATTTTTACCAGCTGGG - Intergenic
1008851295 6:56025724-56025746 AAATGTTATCTTTATCTGCTTGG + Intergenic
1009327180 6:62366411-62366433 AAATGATATTTCTGACAGCTTGG - Intergenic
1009737777 6:67700505-67700527 AAATGCTATTTTCTACAGCATGG + Intergenic
1010476243 6:76292039-76292061 AAATGATATTTTTAATATATTGG - Intergenic
1010572826 6:77498667-77498689 AAATGCTATTTTTATATGCTGGG + Intergenic
1011481171 6:87795514-87795536 AAATGGTAATAATAACACCTTGG + Intergenic
1012123186 6:95392405-95392427 AAAGGGTATTTTTCAAATCTGGG - Intergenic
1012832658 6:104225113-104225135 AAAATGTATTTTTAGCTGCTGGG - Intergenic
1013616390 6:111847102-111847124 AAATGCTTTTTTTGACAGCGGGG - Intronic
1014289565 6:119542192-119542214 AAATGGGATTCTTAACAGAGTGG - Intergenic
1014793222 6:125698932-125698954 AAATGGTATATCTAAGAACTAGG - Intergenic
1016395370 6:143618391-143618413 AAATGGTGTTTTTTACAACATGG + Intronic
1018468770 6:164078492-164078514 AAGTGGTATTTTTACCATCATGG + Intergenic
1018973077 6:168542347-168542369 AAATGGTAACAGTAACAGCTGGG + Intronic
1020395287 7:7709034-7709056 AATTGGTATTTTTAATAGTTAGG - Intronic
1021413673 7:20357224-20357246 AAATTGTATTTGTAATAGATTGG + Intronic
1021443651 7:20709582-20709604 CAATGGTATTTTTAAAAACTAGG + Intronic
1021664782 7:22965775-22965797 AAATTTTGTTTTAAACAGCTAGG - Intronic
1021910238 7:25378475-25378497 AAAGGGTCTTTTTTACAGTTTGG + Intergenic
1023204471 7:37733238-37733260 GAATGTTATTATAAACAGCTTGG + Intronic
1025924895 7:65949836-65949858 AAGTGTTATTGTTAACATCTAGG + Intronic
1026918210 7:74135719-74135741 AAATAATTTTTTTAAAAGCTGGG + Intergenic
1027839791 7:83294313-83294335 AATTGGTATTTTTAAGAGTGTGG + Intergenic
1028510344 7:91618584-91618606 AAATGCTATTTATAACAGTTTGG + Intergenic
1028757013 7:94448614-94448636 AATTTGAATTTTTAACATCTGGG + Intergenic
1031653776 7:124325828-124325850 AAATGTTATTTTTAACAACATGG + Intergenic
1034140410 7:148810315-148810337 CAATGGTATGTTTCAGAGCTGGG - Exonic
1034347404 7:150396070-150396092 GAATGGTATGTTTTGCAGCTTGG + Intronic
1034600357 7:152246947-152246969 AAATGATTTTCTTAAAAGCTTGG + Intronic
1037229911 8:16645494-16645516 TAATGATAATTTTAAAAGCTGGG - Intergenic
1037474242 8:19240608-19240630 TAATAGTATATTTAACAGCAAGG - Intergenic
1038919261 8:32064574-32064596 AAAGTCTATTATTAACAGCTTGG + Intronic
1039905331 8:41782030-41782052 AACTGGGATTTTTAAAGGCTAGG + Intronic
1040439311 8:47424463-47424485 AAATTTTTTTTTAAACAGCTGGG - Intronic
1040750933 8:50706459-50706481 ACATGGTAATTTTAACATTTTGG + Intronic
1041469098 8:58189276-58189298 AAATGTTTTTTTAAATAGCTGGG - Intronic
1042447018 8:68896830-68896852 AAATGACATTTTTAAAATCTAGG + Intergenic
1043425763 8:80147215-80147237 AAATGGTACTTTTAACTTCCAGG - Intronic
1043988351 8:86720919-86720941 TAATGGCATTTTCAGCAGCTTGG + Intronic
1044028570 8:87205349-87205371 AAATGGTATTTATGACAGCTAGG + Intronic
1048908347 8:139110257-139110279 AAATGTAATTTTTATCAGTTAGG - Intergenic
1049084666 8:140469555-140469577 ATGGGGTATTTTTAACGGCTTGG - Intergenic
1051277911 9:15414919-15414941 AAAAATTATTTTTACCAGCTCGG - Intergenic
1051985579 9:23082820-23082842 AAATGGATTTTTTTGCAGCTGGG - Intergenic
1052610288 9:30763567-30763589 AAATGATATTTTAAAAAGTTAGG - Intergenic
1052701718 9:31945752-31945774 ACATGCAATTTTTAAAAGCTTGG - Intergenic
1052805063 9:33005797-33005819 AAATGATATTGTTAAAATCTGGG - Intronic
1053217064 9:36280480-36280502 AAAGGAGATTTTTAACACCTGGG - Intronic
1053485902 9:38456130-38456152 AAATGGCACTTGTACCAGCTCGG + Intergenic
1055419840 9:76127567-76127589 AAACAGCATTTTTAACACCTTGG - Intronic
1057249970 9:93493189-93493211 AGATCATATTTTTAACAGTTTGG - Intronic
1058220724 9:102297536-102297558 TAATGGTACTTTGAAGAGCTTGG + Intergenic
1058526632 9:105865634-105865656 AAATGATATTTGTCACATCTAGG + Intergenic
1058951880 9:109911648-109911670 AAATGTAATTTTTAAAATCTTGG - Intronic
1059079976 9:111238316-111238338 AAATGTTAATTGTAACATCTAGG + Intergenic
1060640732 9:125236312-125236334 AAATGTTCTATTTAACAACTGGG - Exonic
1060951471 9:127606596-127606618 ATATGGCATTTTTTACATCTTGG - Intergenic
1185933916 X:4234153-4234175 AAATGGTCTTTTCAATACCTTGG + Intergenic
1186732329 X:12422994-12423016 AAAGGGTTTTCTTGACAGCTGGG + Intronic
1186865836 X:13719886-13719908 AAATGGAGTTTTTGCCAGCTGGG - Exonic
1187670324 X:21659649-21659671 AACTCGTATTTCTGACAGCTGGG + Intergenic
1188738443 X:33746909-33746931 AAATAGTATTTTTAATAATTTGG + Intergenic
1190744869 X:53316528-53316550 ACGTGGTATTCTTGACAGCTAGG - Intronic
1190812564 X:53898486-53898508 AGATGGTATTTTTAAAAGACAGG + Intergenic
1191048548 X:56165893-56165915 AAATGGTTTTCTGAACAGATTGG - Intergenic
1191594538 X:62928181-62928203 AAATTTTATTTTTAAAAGATTGG - Intergenic
1193269764 X:79515470-79515492 AAAAGGTTTTTTTGCCAGCTGGG + Intergenic
1193873263 X:86828478-86828500 AAGGGGTATTTTTAGCAGCTTGG - Intronic
1194046337 X:89009459-89009481 AGATGGTATATTGAATAGCTTGG - Intergenic
1197306952 X:124854190-124854212 TAATGGTATTTGCAACAACTTGG + Intronic
1198408536 X:136341164-136341186 ACATGGTATTTTTATCAGAGAGG - Intronic
1199017536 X:142836225-142836247 GAATGGCATTTGTTACAGCTCGG + Intergenic
1199160840 X:144609194-144609216 AAATGGTACTTGTATTAGCTTGG + Intergenic
1199895497 X:152123019-152123041 ATATGATATTTTTAAAAGATAGG + Intergenic
1201714787 Y:17032412-17032434 AAATGGTCTTTTCAATACCTTGG + Intergenic
1201787412 Y:17800619-17800641 AAATGGAGTTTTTGCCAGCTGGG - Intergenic
1201814141 Y:18105369-18105391 AAATGGAGTTTTTGCCAGCTGGG + Intergenic