ID: 1166610607

View in Genome Browser
Species Human (GRCh38)
Location 19:44190673-44190695
Sequence GTCTGAAGTCTGCCTTTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166610607_1166610608 11 Left 1166610607 19:44190673-44190695 CCAAACAAAGGCAGACTTCAGAC No data
Right 1166610608 19:44190707-44190729 TACCAATAAAAATTTAAATATGG No data
1166610607_1166610610 29 Left 1166610607 19:44190673-44190695 CCAAACAAAGGCAGACTTCAGAC No data
Right 1166610610 19:44190725-44190747 TATGGCATTCCAGTTTTAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166610607 Original CRISPR GTCTGAAGTCTGCCTTTGTT TGG (reversed) Intergenic
No off target data available for this crispr