ID: 1166619714

View in Genome Browser
Species Human (GRCh38)
Location 19:44285273-44285295
Sequence GCTGAGTGAAGGAGTTTAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 1, 2: 2, 3: 14, 4: 199}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166619714_1166619721 15 Left 1166619714 19:44285273-44285295 CCTCTTAAACTCCTTCACTCAGC 0: 1
1: 1
2: 2
3: 14
4: 199
Right 1166619721 19:44285311-44285333 GGTCTTTTAAGGTATGAGCCTGG 0: 1
1: 0
2: 1
3: 5
4: 108
1166619714_1166619717 -6 Left 1166619714 19:44285273-44285295 CCTCTTAAACTCCTTCACTCAGC 0: 1
1: 1
2: 2
3: 14
4: 199
Right 1166619717 19:44285290-44285312 CTCAGCCCAAAAAGTTGGAATGG 0: 2
1: 5
2: 4
3: 30
4: 158
1166619714_1166619720 4 Left 1166619714 19:44285273-44285295 CCTCTTAAACTCCTTCACTCAGC 0: 1
1: 1
2: 2
3: 14
4: 199
Right 1166619720 19:44285300-44285322 AAAGTTGGAATGGTCTTTTAAGG 0: 1
1: 0
2: 4
3: 14
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166619714 Original CRISPR GCTGAGTGAAGGAGTTTAAG AGG (reversed) Intronic
903185430 1:21626310-21626332 GTAGAGTGAAGGAGTATAGGAGG + Exonic
903749438 1:25611652-25611674 CCTCAGTGAAGGAGCTGAAGGGG + Intergenic
905207742 1:36352566-36352588 GCTGAGTGAGTGAGTTGAGGAGG - Intronic
906280258 1:44548447-44548469 GCTGAATGAAGGAGTCTAGGTGG - Intronic
906830927 1:49030928-49030950 GCTGAGTGACGGAGTGTGAATGG + Intronic
908337870 1:63145721-63145743 GCTGAGTAAAGGAGTTTGGGAGG - Intergenic
910181399 1:84486955-84486977 ACTGAGTGAAGGAGATTTAAGGG + Intronic
910451539 1:87351617-87351639 GCTCTGTGAGGGAGTTTAAGGGG + Intergenic
911666832 1:100562854-100562876 GCTGTGTTAAGGGGTTTAATGGG + Intergenic
915463007 1:156081041-156081063 GCTGAGTGTAGGAATGGAAGGGG - Intronic
915750849 1:158208956-158208978 GCTGAGTTAAGGAGATAGAGAGG - Intergenic
916709974 1:167396127-167396149 GCTTAGGGATGGAGTTTATGTGG + Intronic
920448656 1:206039897-206039919 GCTGAGTGCAACAGATTAAGGGG + Intronic
920830120 1:209457014-209457036 GCTGATTGAGGGGGTTAAAGTGG - Intergenic
921372981 1:214444619-214444641 GCAGATTGCAGGAGTCTAAGGGG + Intronic
923001490 1:230009727-230009749 TCTGAGTGAAGTAGTTTATGTGG + Intergenic
1065797851 10:29323524-29323546 GCTGCATGAAGGAGTTTATCTGG + Intergenic
1068298964 10:55113889-55113911 GCTGAATGAGGGAGTTAAAAAGG - Intronic
1068553276 10:58429583-58429605 GAAGAGTGAAGGAGTGGAAGGGG - Intergenic
1069096178 10:64262553-64262575 GCTGAGTGATGGATCTGAAGGGG - Intergenic
1069243588 10:66173006-66173028 CCTGAGAGAGGGAGTTTAAAGGG + Intronic
1069577120 10:69538594-69538616 GCTGAGTGATGCACTTTACGTGG - Intergenic
1069728989 10:70599093-70599115 GCTGGGTGGAGGCGTTGAAGTGG + Exonic
1069910583 10:71756647-71756669 GCTGACTGCAGGAGTTTAGCTGG + Intronic
1070023656 10:72610803-72610825 GCTGAGTGGAGGAGGTTAGAGGG + Intronic
1072004532 10:91231581-91231603 AGTGAGTGAAGGAGTGTTAGAGG + Intronic
1072090628 10:92123612-92123634 GCTGACTGAGGGAGTGTAACAGG - Intronic
1079211647 11:18466190-18466212 GTTCAGTGAAGGAGTTTTTGGGG + Intronic
1080439479 11:32278182-32278204 TATAAGTGAAGGAGATTAAGGGG + Intergenic
1081737294 11:45412887-45412909 GCTGGGTGAAGGAGTGGAGGGGG - Intergenic
1084873498 11:72113554-72113576 GGTAAGTGATGGAGTTTAATAGG - Intergenic
1086013441 11:82134220-82134242 GCTGAATGAAGGAGATCAATTGG - Intergenic
1087104792 11:94398680-94398702 GCTGACTGCAGTAGATTAAGTGG + Intronic
1088577155 11:111283408-111283430 GTTGAGTGAAGGAGTCCATGAGG + Intronic
1088735158 11:112722815-112722837 GCTGAGTGAAGGTGGCTAGGGGG + Intergenic
1089042648 11:115467743-115467765 TCTGAGTGAATGAGTTTACAGGG + Intronic
1090806260 11:130204210-130204232 GTTGAGTGAATGAGTTGATGGGG + Intronic
1094390034 12:29939162-29939184 GCTGAGTAATGCAGTTTAGGAGG - Intergenic
1096415599 12:51409887-51409909 GCTGAGTAAAGGGATTTAAGAGG + Intronic
1098299327 12:69037901-69037923 GCTGAGTGAATGTGTTTGGGGGG + Intergenic
1100796046 12:98182850-98182872 GCCCAGTAAAAGAGTTTAAGAGG - Intergenic
1100878944 12:98995006-98995028 TCTGAGTGAATGAGTTAAAGAGG + Intronic
1101153291 12:101904405-101904427 GCTGAGTGATAGAGCTTTAGGGG + Intronic
1101532286 12:105584618-105584640 GATAATTGAATGAGTTTAAGAGG + Intergenic
1102596599 12:113997518-113997540 GGTGAGAGAAGGGGTTTCAGAGG + Intergenic
1102808418 12:115802535-115802557 GCTGAGAGGAGGAATTTGAGGGG - Intergenic
1106997069 13:35497172-35497194 CCTGAGTGAATCACTTTAAGTGG - Intronic
1108921219 13:55676678-55676700 GCTGAGTGTGAGAGTTCAAGAGG + Intergenic
1109368718 13:61393227-61393249 GCTAAATGAAGGAAGTTAAGGGG - Intergenic
1109463189 13:62691589-62691611 GCTGACTGCAGGACTTTATGCGG - Intergenic
1110405514 13:75145959-75145981 ACTGAGTGCAGAAATTTAAGGGG - Intergenic
1111519289 13:89379168-89379190 GCTGAGTGCAGGATTTTGATGGG - Intergenic
1112430147 13:99343729-99343751 GCTGAGTGAAGAAGTTCAGCAGG - Intronic
1113104715 13:106759566-106759588 GCTGAGTGATGGAGTCCCAGAGG - Intergenic
1115766635 14:36629648-36629670 GCTTGGTGAAGGAGTCTAATTGG - Intergenic
1116338454 14:43690550-43690572 GCTAAGTGAAAGATTTTAATAGG - Intergenic
1116702757 14:48261264-48261286 GCAGAGTGAAATATTTTAAGTGG + Intergenic
1117051396 14:51863681-51863703 GCTGAGAGAAGGAGGGAAAGAGG - Intronic
1120057515 14:79942249-79942271 AGGGAGTGAAGGAGTTTGAGTGG + Intergenic
1121249654 14:92490024-92490046 GCTGGGAGGAGGAGTGTAAGGGG + Intronic
1123939887 15:25211712-25211734 GCTCAGTGCAGGAGATCAAGGGG - Intergenic
1124384420 15:29194803-29194825 CATGAGTGAAGGCGTTCAAGGGG + Intronic
1124685406 15:31777763-31777785 GCTGAGTGAGGGAGTTCTGGGGG + Intronic
1127062547 15:55201816-55201838 ACTGAGTAAAGGACTTAAAGAGG - Intergenic
1128655417 15:69457699-69457721 GCTGAGTGAACAAGTGTCAGAGG + Intergenic
1132174851 15:99704108-99704130 GCTAATTAAAGGACTTTAAGGGG + Intronic
1134661760 16:15989519-15989541 GCTGAGAAAAGGAGTGCAAGAGG - Intronic
1135868335 16:26125729-26125751 GATGAGCGAAGGATTTTAGGAGG - Intronic
1136248187 16:28986840-28986862 GCTGAGTGCAGGAGCTGATGGGG - Exonic
1136478059 16:30525539-30525561 CCTGAGTGAAGGAGTCCAGGGGG + Exonic
1136588694 16:31203888-31203910 GCTGAGTGAAGGAATGAATGAGG + Intergenic
1138404152 16:56775407-56775429 GCTGTGTTAAGCACTTTAAGTGG + Intronic
1139235211 16:65330967-65330989 GCTGAGTGGAGGAGGTTAGCAGG + Intergenic
1140870437 16:79101513-79101535 CCTAAGGGAATGAGTTTAAGTGG + Intronic
1140934840 16:79660845-79660867 GCTGAGAGAAGGGGTTCATGAGG + Intergenic
1141463519 16:84192111-84192133 TCTGAGTTAAGGGATTTAAGGGG - Intronic
1142090847 16:88208444-88208466 CTTCAGTGAAGGAGTGTAAGGGG + Intergenic
1143363515 17:6390182-6390204 TCTGGGTGAAGGAGTTTAAGTGG - Intergenic
1143764822 17:9130556-9130578 TCTGAGTGGATGAGTTTAAGGGG - Intronic
1143778079 17:9212592-9212614 CCAGGGTGAAAGAGTTTAAGGGG - Intronic
1145208892 17:20998707-20998729 TCTGAGTGAAGGTGTGAAAGTGG + Intergenic
1145972935 17:28967593-28967615 CCAGAGTGGAGGAGGTTAAGAGG + Intronic
1146663629 17:34682119-34682141 TCTGAGTGGAGGGGTTGAAGTGG + Intergenic
1146835433 17:36106877-36106899 ACTGAGAGAAGGAGGTTAGGGGG + Intergenic
1146850055 17:36214141-36214163 ACTGAGAGAAGGAGGTTAGGGGG + Intronic
1148498292 17:48068720-48068742 GCTAATTAAGGGAGTTTAAGTGG - Intergenic
1149283953 17:55140903-55140925 GCTGAGTGAAAGAATGTAAAGGG + Intronic
1151099500 17:71540453-71540475 GCTGAATGAAGGGGTTTTAGAGG + Intergenic
1151370159 17:73642808-73642830 GCTGAGGGGAGGATTTTACGAGG - Intronic
1154121025 18:11652820-11652842 GCTGAGGTCAGGAGTTCAAGGGG - Intergenic
1155595712 18:27483524-27483546 ATTGAATGAAAGAGTTTAAGAGG - Intergenic
1156645995 18:39162827-39162849 CCTGAGTGCAGGAGCTTTAGTGG + Intergenic
1156876366 18:42018460-42018482 GCTGAGTCCATGAGTTTAATAGG - Intronic
1158883999 18:61807919-61807941 CCTGAGCCAAGGATTTTAAGTGG - Intergenic
1159904861 18:74080420-74080442 TCTGAGAGAAGGAATTTATGGGG + Intronic
1161813073 19:6481789-6481811 GCTGAGAGAGGAAGTTTAACGGG + Exonic
1163549806 19:17959758-17959780 CCCGAGTGAAAGAGTTCAAGAGG + Intronic
1163702409 19:18792671-18792693 ACTGATTGCAGGAGGTTAAGGGG - Intergenic
1164414786 19:28038071-28038093 TCTGGGTGAAGAAGTTTATGCGG - Intergenic
1166619714 19:44285273-44285295 GCTGAGTGAAGGAGTTTAAGAGG - Intronic
1166665915 19:44680408-44680430 TCTGAGTGAGGGAGAATAAGCGG - Intronic
1166867772 19:45851168-45851190 GCTGAGTGCAAGAGTGGAAGCGG + Intronic
1166924426 19:46256981-46257003 GCTGAGAGAAGGAGAAAAAGAGG + Intergenic
1167762190 19:51456974-51456996 GGTGTGTGGAGGAGTCTAAGGGG + Intronic
1168462098 19:56567790-56567812 AATGAGTGAAGCACTTTAAGTGG + Exonic
928852295 2:35763554-35763576 GTTGAGTGAAATAGTTAAAGAGG + Intergenic
929309117 2:40401332-40401354 GTTGGGTAAAGAAGTTTAAGGGG - Intronic
932860570 2:75287088-75287110 GCTGAGTGAAGGAAGTCAATAGG + Intergenic
933557918 2:83853403-83853425 GCTGAGTGAATGATTTTTAGTGG - Intergenic
939304710 2:140396204-140396226 GCTGGTTGAAGGAGCTTAAGTGG - Intronic
941125490 2:161579106-161579128 GCTGAGGTTAGGAGTTTTAGTGG + Intronic
946912312 2:224476480-224476502 ACTGGGTTGAGGAGTTTAAGGGG - Intronic
948493018 2:238326055-238326077 GTTTAGGGAAGGAGTTTCAGTGG + Intronic
1168956245 20:1836461-1836483 GCAGAGTGAAGGAGGTGGAGAGG - Intergenic
1170207246 20:13811594-13811616 GCAGGGTGAAGGTGTTTAATAGG + Intronic
1170552953 20:17492733-17492755 GCTGAGTAAATGTGTTTAAATGG - Intergenic
1171116540 20:22529710-22529732 GTTGTGTGAAGCAGTTTAGGTGG - Intergenic
1172175182 20:32967900-32967922 GCTGGGTGATGGAGTTCAGGTGG - Intergenic
1174934228 20:54850057-54850079 ACTGAGTGAATGAATTTCAGAGG + Intergenic
1178425294 21:32474252-32474274 GCAGAGTGGAGGGCTTTAAGCGG - Intronic
1178899128 21:36584795-36584817 GCTGTAGAAAGGAGTTTAAGTGG + Intergenic
1180253422 21:46605462-46605484 GCTGAGCATAGGAGATTAAGTGG + Intergenic
1181795854 22:25309907-25309929 CCTGAGGGAAAGAGTTAAAGAGG + Intergenic
1181836384 22:25613436-25613458 CCTGAGGGAAAGAGTTAAAGAGG + Intronic
1182438206 22:30344953-30344975 GCTTCGTGAAGTAGTTGAAGAGG + Exonic
1184183371 22:42846618-42846640 CCTGAGTGAATGATTTTTAGTGG - Intronic
952847357 3:37699614-37699636 TCTGAGCAAAGGAGTGTAAGAGG - Intronic
952960312 3:38585238-38585260 GATGAGTGAATGAGTAAAAGTGG + Intronic
953536858 3:43783213-43783235 GCTGAGTCAAGGAGTGGGAGGGG + Intergenic
954161689 3:48727366-48727388 CCAGAGTGGGGGAGTTTAAGGGG + Intronic
955901061 3:63755469-63755491 GCTGATGGAAGTATTTTAAGAGG + Intergenic
956977000 3:74592313-74592335 GTGGAGTAAAGGAGTTTAACAGG + Intergenic
957503578 3:81090693-81090715 GCTTAGTCAAGGACATTAAGTGG - Intergenic
957895724 3:86419209-86419231 GCTGAGTGATGGTGTTTAAAAGG - Intergenic
959327698 3:104957490-104957512 GCTTAGTCCAGGAGTTTAATGGG + Intergenic
960463258 3:117963459-117963481 GCTCAGTGTAGGAGGTTAATAGG - Intergenic
961465860 3:127081241-127081263 GCTGACTGAGGGGGTTTAAATGG - Intergenic
964835229 3:160930671-160930693 GCGGAGTGAAGGAGTTTAAGAGG + Intronic
967787681 3:193514960-193514982 GCAGAGTGAAGGAGTTGAGGAGG + Intronic
969796038 4:9529164-9529186 GCTTACTGAAGGGGTTTGAGGGG + Intergenic
975373693 4:73617591-73617613 GCCTAGTAAAGGAGCTTAAGAGG - Intronic
976455791 4:85245910-85245932 GTGGAGAGAAGGAGTTTAACAGG - Intergenic
978018563 4:103779482-103779504 GAAGAGTGAAGGAGTTTCTGTGG - Intergenic
978875650 4:113637441-113637463 GTTGAGTGAGTGAGTCTAAGAGG + Intronic
980621783 4:135316694-135316716 GCAAAGTGATGGAGTTTAAATGG - Intergenic
982269598 4:153572845-153572867 GCTGAGGGAAGGTGTTTAATGGG - Intronic
986027780 5:3866538-3866560 GGTGAGTGAAGGAGTGTGGGTGG - Intergenic
988411142 5:30887295-30887317 ACTGAGCCAAGGAGTGTAAGAGG - Intergenic
988718611 5:33853611-33853633 GATGGGTGAAGGAGTGGAAGAGG - Intronic
988986480 5:36624301-36624323 ACTGACTGAAGGAGTCTAAATGG - Intronic
990280871 5:54249604-54249626 TCTAAGTGAAGGAGTTCATGAGG + Intronic
993143702 5:84067765-84067787 GTTGAGGGAAGGATTTTATGAGG - Intronic
994770334 5:103973567-103973589 CCTCAGTGAAGGAGTTTCAGTGG + Intergenic
996411223 5:123161664-123161686 GCTGAGTGAGTGAGGTGAAGAGG + Intronic
996932206 5:128903690-128903712 TATGTGTGAAGGAGTTTAACTGG + Intronic
1000069710 5:157728747-157728769 GCTATGTGAAGGAATTTAACAGG - Intergenic
1002092427 5:176813172-176813194 GCTGCGTGACGGGGTTTGAGAGG - Intronic
1003138633 6:3453859-3453881 GGTGAGTGCAGGAGTTCCAGGGG - Intronic
1003359766 6:5413643-5413665 AAGGAGTGAAGGAGTTAAAGTGG - Intronic
1004238044 6:13892432-13892454 GGTAAGGGAAGGAGTTTGAGTGG + Intergenic
1006163747 6:32052832-32052854 GCACAGTGAAGGAGTCGAAGCGG + Intronic
1006299842 6:33187870-33187892 GCTGGATGGAGGAGTTGAAGAGG + Intronic
1006959138 6:37909494-37909516 CCTGAGGTAAGGAGTTCAAGAGG - Intronic
1007251783 6:40500215-40500237 GCTGGGTGAAGGAGTCTCTGAGG - Intronic
1007909890 6:45503027-45503049 GATGAGTAAGGGAGGTTAAGAGG - Intronic
1009314915 6:62206003-62206025 GCTTGCTGAAGGAGCTTAAGAGG + Intronic
1010083579 6:71889230-71889252 GGAGAGTGAGGGATTTTAAGTGG + Intronic
1010568696 6:77451365-77451387 GCTGGGAGAGGGAGTTGAAGTGG + Intergenic
1011113757 6:83867106-83867128 GCAGAGTGAAGCACCTTAAGAGG + Intronic
1014494743 6:122107351-122107373 GCTGAGTGAAGCAGGATAAAAGG + Intergenic
1014613117 6:123568561-123568583 GCAGAGTGCAAGAGTTAAAGAGG - Intronic
1023196830 7:37649982-37650004 CCTGAGTCCAGGAGTTCAAGAGG - Intergenic
1023422092 7:39991833-39991855 GCTGAATCCAGGAGTTTGAGAGG + Intronic
1023621903 7:42082032-42082054 GATGATTGAATGAGTTTGAGGGG - Intronic
1027219536 7:76205056-76205078 GCTCAGTGAAGGAGTTGCGGAGG - Intronic
1027744786 7:82059585-82059607 TCTGAGTGAAGGAGGATATGTGG + Intronic
1028379891 7:90188351-90188373 GCTAAGTGAAGGAGTTTACGAGG + Intronic
1028862973 7:95675402-95675424 GCAGAGTCAAGGAGCTTGAGTGG - Intergenic
1037196588 8:16198358-16198380 TCTCAGTGCAGGTGTTTAAGTGG - Intronic
1038267718 8:26049196-26049218 GCATAGTGAAGGAGATTCAGCGG + Intergenic
1038284244 8:26192717-26192739 GATGAGTTGAGGAGTTGAAGTGG - Intergenic
1039050267 8:33486202-33486224 GCTGTGTGAAGGACTTTTGGAGG + Intronic
1039607311 8:38892055-38892077 GCTAAATGAAGGAGTTAAACTGG + Intergenic
1042851806 8:73224396-73224418 GCTGAGTGAATGAGTATGACTGG + Intergenic
1043734218 8:83724081-83724103 GCTGAGTGCAGGGGTTTTATGGG + Intergenic
1044001552 8:86888140-86888162 GATGAGTGAAGGAAGGTAAGAGG - Intronic
1044347233 8:91119703-91119725 GCTGAGAGGAGGAGATTAGGAGG - Intronic
1045978846 8:108160612-108160634 GTTGTGTGAAGGAGGTTTAGTGG - Intergenic
1047429684 8:124780521-124780543 GCTAAGAGAAGGAGGTGAAGCGG + Intergenic
1048615509 8:136070431-136070453 GCTGAGTCAAGGAGTCCAACTGG - Intergenic
1051164822 9:14250196-14250218 GCTGAGTCAAGGAAGATAAGAGG + Intronic
1051688976 9:19689156-19689178 GCTGAGTGAAGTGAATTAAGTGG + Intronic
1052502303 9:29307156-29307178 TCTGAGTGTAGGACTTTAATGGG - Intergenic
1053042254 9:34884813-34884835 GCTGAGTGCAGAAGTGAAAGTGG - Intergenic
1053511505 9:38691631-38691653 GCTGAGAGAATGAATTTGAGGGG - Intergenic
1055467089 9:76576642-76576664 GCTGAGCTAAGGAGTGCAAGGGG + Intergenic
1055507893 9:76966555-76966577 AATGAGTGAAGTACTTTAAGTGG - Intergenic
1058619490 9:106867733-106867755 TCTGTGTGATGGAGTTTAATAGG + Intronic
1059243005 9:112824438-112824460 ACTGAGTGATGGAGTTTCAACGG - Intronic
1059522058 9:114951994-114952016 GCTGAGTGTTGGAGTTGAGGAGG - Intergenic
1060004810 9:119990462-119990484 GCTGAGGGCAGGAGCTGAAGTGG - Intergenic
1061280164 9:129593429-129593451 ACTGGGTGAGGGAGTTTAAAAGG + Intergenic
1185728582 X:2443247-2443269 CTTGAGTCCAGGAGTTTAAGAGG - Intronic
1186958644 X:14710797-14710819 GCTAAGTTAAGAAGTCTAAGAGG - Intronic
1187387566 X:18862393-18862415 GCAAAATGGAGGAGTTTAAGTGG + Intergenic
1188316313 X:28678143-28678165 GCCGGATGAAGGAGTTTGAGAGG + Intronic
1188379938 X:29478987-29479009 AGTCAATGAAGGAGTTTAAGGGG - Intronic
1190143913 X:47873394-47873416 GCAGATTGAGGGAGTTTCAGGGG - Intronic
1190224413 X:48534292-48534314 GCTGAGTGATGGAATATATGTGG - Intergenic
1190761670 X:53442316-53442338 GCTGACTGAAGGACTCCAAGGGG - Intergenic
1195324590 X:103747874-103747896 GCTGATTGAAGGAGATTTTGTGG - Intergenic
1196830609 X:119772778-119772800 GCAGAGTGAGGGAGGGTAAGTGG - Intergenic
1197119516 X:122873761-122873783 GCAGAGGGAAGGCCTTTAAGAGG - Intergenic
1199602766 X:149552439-149552461 GCTGAGTGAAGGAGGGTTAAGGG - Intergenic
1199647623 X:149927036-149927058 GCTGAGTGAAGGAGGGTTAAGGG + Intergenic
1200205644 X:154313850-154313872 CCTGAGTCCAGGAGTTTGAGGGG + Intronic
1201918078 Y:19204137-19204159 CCTGAGGCCAGGAGTTTAAGAGG + Intergenic