ID: 1166627352

View in Genome Browser
Species Human (GRCh38)
Location 19:44370886-44370908
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 3, 1: 0, 2: 3, 3: 14, 4: 123}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166627347_1166627352 22 Left 1166627347 19:44370841-44370863 CCATAGGAAGATCTGGCAAGAGA 0: 1
1: 2
2: 2
3: 20
4: 184
Right 1166627352 19:44370886-44370908 CCTTAAATGGAGACTATGGAGGG 0: 3
1: 0
2: 3
3: 14
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901453876 1:9352368-9352390 TCTTAAGTGGAGACGATGCAGGG + Intronic
903968463 1:27103818-27103840 TGTTAAATAGAGACAATGGAAGG - Intronic
906782382 1:48584236-48584258 TCTTGAATGTAGACAATGGAAGG - Intronic
909915177 1:81309045-81309067 TCTTAAAAGGATGCTATGGAAGG + Intronic
912389179 1:109290116-109290138 CCTTCAATGCAGAATATGGCTGG + Intergenic
913256977 1:116962690-116962712 CTTGAAATTGAGACTGTGGAGGG - Intronic
920243029 1:204567683-204567705 CCTTAAACGTAGACTATAGATGG + Intergenic
1065071849 10:22032861-22032883 CCTTAAATAGAGTCTATGTGTGG - Intergenic
1065607384 10:27432160-27432182 CTTTATATGGAGATTATGTATGG + Intergenic
1067180189 10:43979547-43979569 CCTGAAATGGTGACTGTGGTAGG + Intergenic
1067902148 10:50253248-50253270 CCTCAAATGTAGACTAGGAAAGG - Intergenic
1074818919 10:117164898-117164920 CCTTAAAAGGGGGCTATTGATGG + Intergenic
1076032669 10:127172765-127172787 CCTTAAATCAAGACAAAGGATGG - Intronic
1076509216 10:131000127-131000149 CCTCAAAGAGAGACAATGGAAGG - Intergenic
1078152738 11:8773179-8773201 CCTTAAATGGAGAATGTGCCTGG + Intronic
1080569555 11:33543442-33543464 GCTTGTATGGAGAGTATGGAAGG - Exonic
1084746919 11:71176953-71176975 TCTTAAAAGCAGACTAGGGAAGG + Intronic
1084769063 11:71330998-71331020 CCTCAGATGGAGAGAATGGAGGG + Intergenic
1085318342 11:75559542-75559564 CCATCACTGGAGACTTTGGAAGG - Intergenic
1088270023 11:108024862-108024884 CTTGAAATTGAGATTATGGAAGG - Intronic
1088658181 11:112021672-112021694 CCTTAAATGAAGATTTTGTAAGG - Intronic
1096770428 12:53932909-53932931 CCTAAAAGGGAGATAATGGAAGG - Intergenic
1100754924 12:97740817-97740839 CCTTAAAGTGAGAAGATGGATGG + Intergenic
1102729354 12:115094391-115094413 CCTTCAAGGGAGGCCATGGAAGG + Intergenic
1104709938 12:130978517-130978539 CCTTAAAAGGCTAATATGGAAGG + Intronic
1104922053 12:132295660-132295682 CCTCCCCTGGAGACTATGGAGGG + Intronic
1105476888 13:20735758-20735780 GAGTAAATAGAGACTATGGAGGG + Intronic
1107062518 13:36174979-36175001 TCTGAAATGGAGACTATATAGGG - Intronic
1113081861 13:106528745-106528767 GCTGAAATGGAAAGTATGGAAGG + Intronic
1113283187 13:108813052-108813074 CCATAAAAGGAGACTGAGGAGGG + Intronic
1113337878 13:109394159-109394181 CCCTAAATGGTGAGTCTGGATGG + Intergenic
1116276288 14:42837415-42837437 CATTAAGTGGAGACTATGAAAGG - Intergenic
1119189116 14:72667861-72667883 CCTTAATTATAGACTATGCAAGG + Intronic
1122801975 14:104235603-104235625 CCTTAAGTGGAGACATTGAATGG + Intergenic
1128225084 15:65995930-65995952 CTATAAATGGAGATGATGGAAGG - Intronic
1128726758 15:69993735-69993757 CATTAACTGGAGATTAGGGAAGG - Intergenic
1135947291 16:26876399-26876421 CCCTAAATGGAGACACAGGAAGG + Intergenic
1137926937 16:52548531-52548553 CGTTAAATGGAGACTAGGGAGGG - Intergenic
1141149495 16:81554053-81554075 CCTTAAATGGAAAGTACAGAGGG - Intronic
1141300642 16:82812433-82812455 CCTAAAAATGAGACTTTGGAGGG + Intronic
1141875466 16:86821082-86821104 CCTCAAATGTAAACTAAGGATGG + Intergenic
1144687820 17:17237644-17237666 CCCTACATTGAGAGTATGGAAGG + Intergenic
1145846440 17:28042360-28042382 CCCTAAATGGAGAAGATGGGGGG - Exonic
1146053438 17:29569159-29569181 CCTCAGATGGTGACTGTGGAGGG - Intronic
1149278229 17:55069774-55069796 AATTAAATGAAGACTCTGGATGG - Intronic
1156581591 18:38382916-38382938 CCACAGATGGAGACTATGCATGG - Intergenic
1156984034 18:43327866-43327888 TATTAAATGGAGATTATGTATGG - Intergenic
1157826924 18:50820667-50820689 CTTAAAATGGAGACTATAGTAGG - Intronic
1159059188 18:63496923-63496945 TCTTAAAGGGAGCCCATGGAAGG - Intronic
1162130539 19:8523452-8523474 CCTTAAAAGGAGGCTAAGGAGGG - Intronic
1166627352 19:44370886-44370908 CCTTAAATGGAGACTATGGAGGG + Intronic
1167970386 19:53185666-53185688 CCCTAAATGTGGACTATGCACGG - Intronic
925675135 2:6354300-6354322 TATTAAATGGAAACTATCGAAGG - Intergenic
929457056 2:42073451-42073473 CCCAGAATGGAGTCTATGGAGGG - Intergenic
931182395 2:59915891-59915913 CTCTAAAAGGAGACTGTGGAGGG - Intergenic
932746500 2:74337983-74338005 CCTGACATGGAGCCTCTGGAGGG + Intronic
934583809 2:95470743-95470765 CTTTAAAAGGAGACTGTGGATGG - Intergenic
934595643 2:95605971-95605993 CTTTAAAAGGAGACTGTGGATGG + Intergenic
934787133 2:97019509-97019531 TTTTAAAAGGAGACTGTGGATGG - Intergenic
935808375 2:106771348-106771370 CCTTGAAGGGAGACTTTAGATGG - Intergenic
938546146 2:132333671-132333693 CCTTAAATGGAGACTATGGAGGG - Intergenic
940596158 2:155795606-155795628 CCCCAAATGGGGACTATGTATGG + Intergenic
941142321 2:161800508-161800530 CATAAAATTGAGATTATGGAGGG + Intronic
941468334 2:165856115-165856137 CCTTAAAGGGAGGCCATGGGAGG + Intergenic
942899976 2:181103732-181103754 CTTTAAATGGAAAATTTGGAGGG + Intergenic
943171169 2:184402396-184402418 CCATAAAATGAGAATATGGAAGG + Intergenic
946232262 2:218298975-218298997 CCTGAAATTGAGATTATGGAGGG - Intronic
1169780592 20:9306077-9306099 CCTTATATGGAGACAATGGAGGG - Intronic
1170354299 20:15475504-15475526 CATTTAATGCAGCCTATGGAGGG + Intronic
1171875010 20:30566404-30566426 CCTTAAATGGAGACTATGGAGGG - Intergenic
1172223257 20:33287898-33287920 CTTTCAGTGGAGACTCTGGAGGG - Intronic
1177960018 21:27652279-27652301 TGTTAAATGGAGACTAGGAAGGG + Intergenic
1178095644 21:29212306-29212328 GGTTAAATGGAGACTATGGAAGG - Intronic
1178709500 21:34902359-34902381 CCTTAAATGTGGACAATGGTGGG + Intronic
1184744470 22:46448225-46448247 CATTACATGGAGACTCTGGCAGG + Intronic
949779722 3:7672480-7672502 GCTTTAATGGAGTCTATGGATGG - Intronic
951258568 3:20480299-20480321 CCACAAATGGTGACTATGGGTGG + Intergenic
956264618 3:67382922-67382944 ACTTGAAAGGAGACTAAGGAAGG - Intronic
957445699 3:80310894-80310916 CCTTAAAAGGACAATTTGGAAGG + Intergenic
958531410 3:95336633-95336655 CCCTATAAAGAGACTATGGAAGG + Intergenic
959380557 3:105636328-105636350 CATGAAATTGAGACTATAGAGGG + Intergenic
961121108 3:124371233-124371255 ACTTAAAAGGAAACTATGCATGG - Intronic
962337651 3:134550803-134550825 CCTTAAATGGAGAATAAGCAGGG + Intronic
963745321 3:149119240-149119262 CCAAAAATTGAGACTTTGGATGG + Intergenic
964578959 3:158209060-158209082 CCTTAAAAGGGGAATTTGGATGG + Intronic
967900979 3:194452062-194452084 CCTTCAATGGTGGCTATGCATGG + Intronic
969595150 4:8144529-8144551 CATTTAATGCAGATTATGGAGGG + Intronic
975384600 4:73741438-73741460 GATTATTTGGAGACTATGGAAGG - Intronic
975794983 4:77997674-77997696 TCCTAAATGGAAACTAGGGAAGG - Intergenic
975890492 4:79021427-79021449 CCTGAAATAGAGACTATGGGAGG + Intergenic
976501940 4:85801050-85801072 CCTCAAATGTGAACTATGGATGG + Intronic
976660457 4:87535243-87535265 TCTGAAATGGAGAAAATGGAAGG + Intergenic
977944441 4:102895692-102895714 GTTTAAATGGGGACTAAGGATGG + Intronic
978942944 4:114459358-114459380 CCTTAAGTGGAGATCAGGGATGG - Intergenic
979981239 4:127257948-127257970 TCTTAAATGGAGATAATGGGAGG + Intergenic
980802414 4:137769403-137769425 CCTTAGAAGAAGACTATCGAAGG + Intergenic
983771051 4:171549471-171549493 CCGTAATTGGAGACTGTGGTGGG - Intergenic
985368879 4:189263855-189263877 ACTTCCATGGAAACTATGGAGGG + Intergenic
989985220 5:50689479-50689501 CCTGAAATGGAGATTAAAGAGGG - Intronic
992040210 5:72823457-72823479 CATGAAATGGCAACTATGGAGGG - Intronic
992975369 5:82111745-82111767 CCTCAAATAGAAACTATGAAGGG + Intronic
993135587 5:83957552-83957574 CCTTCAATGCAGACCATGGCTGG + Intronic
993328664 5:86570097-86570119 GATTTAATGGAGACTATGTATGG - Intergenic
995925322 5:117366828-117366850 ACTTAAATGGTAACTATGGGTGG - Intergenic
997216282 5:132113865-132113887 CCTGAAATAGAGACTATGTTTGG - Intergenic
998552172 5:143088108-143088130 ACTTAACTGAAGACTAGGGAAGG - Intronic
1003835823 6:10071456-10071478 CCTTATGTGGAGACTTTGTAAGG + Intronic
1005970537 6:30757628-30757650 TCTTAAATTGAGACTCTGAATGG + Intergenic
1007995373 6:46302236-46302258 CCTGAAATGGAGAAAATGGCAGG + Intronic
1009930817 6:70174907-70174929 CATGAAATTGAGATTATGGATGG + Intronic
1010438371 6:75862738-75862760 TCTGAAATTGAGACTATGGTGGG + Intronic
1013744408 6:113327859-113327881 AGGTAAATGGAGACTTTGGATGG + Intergenic
1017507870 6:155085020-155085042 CTGTAAATGGAGACTCTGGAGGG + Intronic
1019064793 6:169288003-169288025 CCTTCCATGGAGTCTCTGGAGGG - Intergenic
1019268765 7:134198-134220 CCCAAAGTGGAGACGATGGAGGG + Intergenic
1026485825 7:70819685-70819707 CCATTAATGGCAACTATGGATGG + Intergenic
1026538680 7:71261608-71261630 CGTGAAATGGAGACCCTGGAAGG + Intronic
1027458994 7:78428768-78428790 CCTACAATTGAGCCTATGGAGGG - Intronic
1030498359 7:110328373-110328395 CTTAAAATTGAGATTATGGATGG + Intergenic
1033139025 7:138808719-138808741 CCTTAAATGTAGACAATTAAGGG - Intronic
1034869273 7:154669237-154669259 CTTGAAATGGATACCATGGAAGG + Intronic
1035532289 8:362431-362453 CTTTAAATGGTGACTCTGTAAGG - Intergenic
1036273452 8:7329568-7329590 GCTTACATTGTGACTATGGAAGG - Intergenic
1036347897 8:7980784-7980806 GCTTACATTGTGACTATGGAAGG + Intergenic
1037750956 8:21682098-21682120 CCTTAAATGGAGGCTGTATAGGG + Intergenic
1040917996 8:52583700-52583722 CCCAAATTGGAGACTAAGGAGGG - Intergenic
1041098338 8:54372120-54372142 CCTTTAATGGAGGCTAAGGCAGG - Intergenic
1044318209 8:90773820-90773842 TCAAAAATGGAGACTATGCATGG - Intronic
1048831850 8:138485348-138485370 CCTTGAATGGAAACTCTGGATGG - Intronic
1051710896 9:19929312-19929334 CCCTAAATGAAGACTGTGAATGG - Intergenic
1053069639 9:35093496-35093518 CCACAAATGGAGACCATGGAGGG - Exonic
1060935003 9:127509620-127509642 CCCAAGATGGAGACTGTGGAAGG + Intronic
1186167860 X:6845877-6845899 CCTAAAGTGGAGTCTGTGGATGG + Intergenic
1187474745 X:19601085-19601107 CCATATATGAAGACTATGGAAGG - Intronic
1188948118 X:36333716-36333738 CTTGAAATGGAGATTATGGAGGG - Intronic
1189120971 X:38394639-38394661 CATTAAAGGGAGGCCATGGAGGG - Intronic
1190700079 X:52981299-52981321 CCTGAAATGGAGACTTGGGCTGG - Intronic
1193061737 X:77214603-77214625 CCTTCACTGGTGACTAGGGACGG - Intergenic
1196987677 X:121292892-121292914 CCTCAAATGGTGATTCTGGAGGG - Intergenic
1201245953 Y:12003925-12003947 AATTAAATGGTGACAATGGATGG - Intergenic
1202106637 Y:21376269-21376291 CCTGAAATCCAGAATATGGAGGG - Intergenic
1202365721 Y:24162323-24162345 CCTTAAATACAAACTATGAATGG + Intergenic
1202505061 Y:25507799-25507821 CCTTAAATACAAACTATGAATGG - Intergenic