ID: 1166629904

View in Genome Browser
Species Human (GRCh38)
Location 19:44397397-44397419
Sequence TAGGGAAGTCTTGAGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 3, 1: 1, 2: 1, 3: 15, 4: 166}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166629904 Original CRISPR TAGGGAAGTCTTGAGGAGGT GGG (reversed) Intronic
900186461 1:1335471-1335493 GAGGGAGGTCTTGGGGAGATGGG - Exonic
900199182 1:1395687-1395709 TTGGGAAGGGATGAGGAGGTTGG - Intronic
904069730 1:27784900-27784922 TAGGGAGGGGTTGAGGAAGTGGG - Intronic
904328137 1:29740518-29740540 TAGGTAACTCGGGAGGAGGTTGG - Intergenic
905846711 1:41240375-41240397 TAGGCAAGAGTTTAGGAGGTTGG + Intronic
908649599 1:66317397-66317419 TAAGAAAGTCTTTAGGAGGAAGG + Intronic
908799980 1:67869888-67869910 CAGAGATGTCTTAAGGAGGTAGG + Intergenic
911044594 1:93617915-93617937 TGGGGAAGTCTTGAGAAGCAAGG - Intronic
911666683 1:100560945-100560967 CCGGGAAGTCTTAAGGAGGGAGG + Intergenic
911808146 1:102237376-102237398 TAGGGGAGTCTTGAAGAAGAAGG + Intergenic
915636800 1:157193173-157193195 TAGGGAGGTTTTGAGGAGTTTGG + Intergenic
915657692 1:157375262-157375284 TAGGGAGGTTTTGAGGACTTTGG + Intergenic
915671378 1:157491714-157491736 TAGGGAGGTTTTGAGGACTTTGG - Intergenic
916486926 1:165268024-165268046 TAGAGAAATCTTCAGGATGTAGG + Intronic
916693783 1:167217006-167217028 AAGGGAAGTTTGGAGGAGGGGGG - Intergenic
917786313 1:178461717-178461739 TTGGGAGTTCTTGAAGAGGTTGG - Intronic
917963470 1:180164300-180164322 TGGGGGGGTGTTGAGGAGGTTGG + Intronic
920815778 1:209330254-209330276 TAGGAAAGAGTTCAGGAGGTAGG + Intergenic
921482311 1:215677261-215677283 TAGTGAAGTCTTGGGGAAGGAGG - Intronic
922704078 1:227779845-227779867 TAGGGAAGGCTGGATGGGGTGGG - Intronic
923931715 1:238706968-238706990 AAGGGAAATTTTGAGGAGCTAGG + Intergenic
1064612119 10:17114577-17114599 GATGGAAGGGTTGAGGAGGTGGG - Intronic
1065325797 10:24549775-24549797 TAGGGAAGCCCTGATGGGGTGGG - Intergenic
1067224218 10:44364789-44364811 ACAGGAAGGCTTGAGGAGGTGGG + Intergenic
1067511750 10:46901330-46901352 AAGTGAAGTCTTGAAGAGTTTGG - Intergenic
1067650497 10:48150494-48150516 AAGTGAAGTCTTGAAGAGTTTGG + Intergenic
1068929922 10:62579064-62579086 TGAGCAAGTCTTGAGGAGATTGG - Intronic
1071953060 10:90727298-90727320 TAGGGTTGTCTTGAGTTGGTTGG - Intergenic
1073071337 10:100795453-100795475 TAGGGAAGTGTTTATGAGGGAGG + Intronic
1073121356 10:101124227-101124249 TCTGGAAGTCTTCAGGAGTTGGG + Intronic
1073519627 10:104115288-104115310 GAGGGAAGAATTGAGGAGGTAGG - Intergenic
1079865460 11:25728568-25728590 TAGTGCAGTCTTTTGGAGGTAGG + Intergenic
1080773952 11:35368412-35368434 TTTGAAAGTCTTTAGGAGGTAGG - Intronic
1081027875 11:38037756-38037778 TAGGTAAGTCTGGTGCAGGTAGG + Intergenic
1082007730 11:47429191-47429213 TAGGAATGTCTTGGGGAGATGGG + Intergenic
1084190623 11:67497155-67497177 GAGGGAAGGCCAGAGGAGGTGGG + Intronic
1085004237 11:73070345-73070367 TAGGGATGTCAAGAGAAGGTTGG - Intronic
1085948234 11:81298061-81298083 TAGGGAAGTCTTGCTGAGAGGGG - Intergenic
1086231930 11:84579730-84579752 TAGGGAAGTATGCAGGAAGTAGG + Intronic
1087652644 11:100885953-100885975 TAAGCAATTCTTGATGAGGTAGG + Intronic
1089455162 11:118621604-118621626 GAGGGGCGTCTTGAGGAGGGTGG + Intronic
1091432386 12:447538-447560 TAGGGAAGAGTTAAGGAGGTGGG + Intergenic
1095400172 12:41805257-41805279 TGGGGAATACTAGAGGAGGTAGG - Intergenic
1098511322 12:71317181-71317203 TTGGCAAGTCTTGTGGAGGTGGG + Intronic
1100903465 12:99270391-99270413 TAGGAATGACTGGAGGAGGTAGG - Intronic
1101749250 12:107569957-107569979 GAGGGAAGACTAGAGAAGGTTGG + Intronic
1102969962 12:117158392-117158414 TAGGGCACTCTGGATGAGGTGGG + Intronic
1103286274 12:119804158-119804180 GAGTGAAGCCCTGAGGAGGTAGG - Intronic
1103302329 12:119937629-119937651 TAGGAAAGTGTTGAGGAGGAGGG + Intergenic
1104276492 12:127333384-127333406 TAGGGAGGTCTTTTGGAAGTAGG - Intergenic
1106835508 13:33630361-33630383 TAGGAAAGTGGTGAAGAGGTAGG - Intergenic
1108617597 13:52149369-52149391 TAGAAAAGTCTGGAGGAGCTGGG - Intronic
1109730533 13:66407483-66407505 TGGGGGAGTCCTGAGGAGGGGGG + Intronic
1111322126 13:86645285-86645307 TGAGGAAGAATTGAGGAGGTGGG - Intergenic
1112481157 13:99776676-99776698 CAGGGAAATTTTGAAGAGGTTGG + Intronic
1112585573 13:100715977-100715999 TAGGGAAGGCTTGTGGATGCTGG + Intergenic
1112818240 13:103299261-103299283 TAGGGAAGTCTGCAGTAGGCTGG + Intergenic
1113078026 13:106487506-106487528 TGGAGAATTCTTGAGGGGGTTGG + Intergenic
1113797457 13:113066729-113066751 TTGGGGAGTCTTGGGGAGGATGG - Intronic
1114641673 14:24227125-24227147 TATGAAACTCTTGAGGGGGTAGG + Intronic
1119220219 14:72900470-72900492 TAGGGAAGTGTTGGGGATGGAGG - Intergenic
1121721900 14:96115139-96115161 TAGGGCAGTCTGGAGGGGCTGGG + Intergenic
1126210451 15:46095233-46095255 AAGGGAAGTGTTGAAGAGGAAGG + Intergenic
1127647249 15:60971215-60971237 TAGGGGAGTCCAGAGGAGGGCGG - Intronic
1127796663 15:62444174-62444196 CAGGGAAATATTGAGGAGGAGGG + Intronic
1129051457 15:72784760-72784782 TGGGGAAGTTCTGATGAGGTGGG - Intronic
1130383351 15:83390979-83391001 TAGCAAAGGCTTGAGGAGGCCGG + Intergenic
1131074368 15:89486090-89486112 TAGAGAAGTCATGAGAAGGATGG + Intronic
1132385310 15:101396305-101396327 TATGGGAGGCTTGGGGAGGTTGG - Intronic
1132803765 16:1766437-1766459 GAGGGAAGGCTTGCAGAGGTGGG + Intronic
1135590725 16:23703296-23703318 CAGGGAACACTAGAGGAGGTGGG - Intronic
1139719550 16:68841545-68841567 TGGGGAAGGCTTGAGGGGTTTGG - Intergenic
1144793196 17:17873371-17873393 TTTGGGAGTCTTGAGGAGGGTGG - Intronic
1148201385 17:45752193-45752215 TAAGGATGTGTTGAGGAGCTGGG + Intergenic
1152818778 17:82425022-82425044 TAGAGAAGGCTGGAGGAGGCTGG + Intronic
1152818811 17:82425157-82425179 TAGAGAAGGCTGGAGGAGGCTGG + Intronic
1153746219 18:8182366-8182388 TACGAGAGTCTTGAGGAGGGAGG - Intronic
1157171619 18:45412118-45412140 CAGGCAAGTCTTGAGGCAGTGGG - Intronic
1160725164 19:614619-614641 CAGGGAGGCCTGGAGGAGGTTGG + Intronic
1162182340 19:8878589-8878611 ACGGGAAGGCTGGAGGAGGTTGG + Intronic
1163177171 19:15572466-15572488 TGGGGAAGGCATGAGGAGGATGG + Intergenic
1166629904 19:44397397-44397419 TAGGGAAGTCTTGAGGAGGTGGG - Intronic
1166637551 19:44464020-44464042 GAGGGAAGTCTTGAGGAGGTGGG + Intergenic
1168559049 19:57367942-57367964 TAGGGAAGGGCTGAGCAGGTAGG - Intronic
1168567742 19:57439063-57439085 TAGGGAAGGTTTGAGGAGGGGGG + Intronic
925759989 2:7175439-7175461 TTGGGAAGTCATGGGGAAGTTGG - Intergenic
928587079 2:32770853-32770875 GTGGGAAGACTTGAGGATGTTGG + Intronic
931461831 2:62456727-62456749 GAAGGAAGTCTTCTGGAGGTAGG + Intergenic
931866628 2:66419128-66419150 CTGGGAAGGCTAGAGGAGGTGGG - Intergenic
932497698 2:72154624-72154646 TAGGGGAGTCTCTAGGAGCTGGG + Intergenic
932543923 2:72687433-72687455 TAGTCAAGTTTTGAGGAGGGAGG - Intronic
935437397 2:103049609-103049631 TAGGGTAGTAGTGGGGAGGTGGG - Intergenic
935548275 2:104423865-104423887 CAGGGAAGACTTGGGGAGGTTGG - Intergenic
936233850 2:110726366-110726388 TGGGGAAGGATTCAGGAGGTGGG + Intergenic
937621447 2:123992394-123992416 TTAGGAAGTGTTGAGGAGATAGG - Intergenic
938543854 2:132309103-132309125 TAGGGAAGTCTTGAGGAGGTGGG + Intergenic
943016080 2:182512095-182512117 TAGGGTAGTGGTGAGGTGGTGGG - Intronic
943113849 2:183642009-183642031 TAGGATACTCTTGTGGAGGTAGG - Intergenic
944518175 2:200533451-200533473 ATGGGTAGCCTTGAGGAGGTGGG + Intronic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
947536167 2:230941553-230941575 TAGGAAAGTCACGAGGTGGTAGG - Intronic
1171065824 20:22014112-22014134 TAGGGTTGACTTGAGGATGTAGG - Intergenic
1171461561 20:25300865-25300887 TAGGGAATTCCTGGGGAAGTCGG - Intronic
1171872718 20:30541834-30541856 TAGGGAAGTCTTGAGGAGGTGGG + Intergenic
1172496981 20:35394490-35394512 TGGGGATGCCTTGAGGAGTTGGG - Intronic
1172897593 20:38311503-38311525 TAGGGAGGTGTTGGGGAGGGGGG + Intronic
1178144241 21:29720019-29720041 TAATGAAGTCTTGAGCAGCTTGG - Intronic
1178262873 21:31116269-31116291 AAGGGAGGTGTTGAGCAGGTTGG - Intergenic
1180993145 22:19950715-19950737 TAGGGAAGTATGGAGGTGATAGG + Intronic
1182457594 22:30461812-30461834 CATAGAAGGCTTGAGGAGGTGGG - Intronic
1184438166 22:44492934-44492956 TAGGGTAGACTCCAGGAGGTGGG - Exonic
1184915458 22:47565797-47565819 TAGGAGAGGCTTGAAGAGGTAGG + Intergenic
949179708 3:1114072-1114094 CAGGGAAGTCTTTAAGAAGTAGG + Intronic
949559825 3:5190661-5190683 TTTAGAAGTATTGAGGAGGTGGG + Intronic
951288309 3:20843075-20843097 TAGGGAAGTCTAGATGAGACTGG + Intergenic
951925906 3:27908589-27908611 TAGGGAGGTCTTGGGGAGCAGGG - Intergenic
952851353 3:37732444-37732466 TAGGGCAGTCCTGGTGAGGTGGG - Intronic
954323207 3:49846005-49846027 CAGAGAACTCTTGAGGAAGTTGG - Intronic
954454902 3:50592560-50592582 TAGGGAAGTAAACAGGAGGTGGG - Intergenic
955529521 3:59858577-59858599 GAGGGGTGTCTTGTGGAGGTGGG + Intronic
958841806 3:99214366-99214388 TAGGGAAGTTTTGAGAAGGGAGG + Intergenic
959536018 3:107485620-107485642 CAGGGAAGAATAGAGGAGGTGGG - Intergenic
960947383 3:122975943-122975965 TTGGGATGTGTTGAGGAGGTTGG - Intronic
962487035 3:135853730-135853752 TAGGAAGATCTTGAGGAGGTAGG + Intergenic
964585549 3:158295220-158295242 TAGGGAAGATTAGAGGAGGCTGG + Intronic
968581376 4:1396941-1396963 CAGGGCAGTCGGGAGGAGGTGGG + Intergenic
973770489 4:54201906-54201928 TAGGGAAAACTAGGGGAGGTGGG + Intronic
976056542 4:81075577-81075599 TAGAGAAATATTGAGAAGGTAGG + Intergenic
977274480 4:94959021-94959043 TGTGGAAGTCTTGAGAAGGTAGG + Intronic
979304971 4:119131895-119131917 TAGGGGAGGATTGGGGAGGTAGG - Intergenic
982773314 4:159418013-159418035 TTGGGAGGTCTTGGGGAGGTTGG + Intergenic
983697026 4:170545120-170545142 TAGGGAAGCCATGAGGAAGAGGG + Intergenic
983793520 4:171828928-171828950 TAAGAAAGTCATGAGGGGGTGGG - Intronic
984709289 4:182871766-182871788 TGGGGAAGTGGTGGGGAGGTGGG - Intergenic
985440728 4:189980971-189980993 TGGGGAAGTGTGGGGGAGGTTGG + Intergenic
985721735 5:1493141-1493163 TGGGGAAGCCTGGAGGAGGCTGG - Intronic
986324664 5:6663327-6663349 TGAGGAAGTCCTGAAGAGGTAGG + Intronic
986968418 5:13303219-13303241 CAGGGAAGTCTTAAGGAGGTAGG + Intergenic
987067501 5:14303817-14303839 TAGGAAAGGCTTAAGGAGGCAGG - Intronic
993031691 5:82713789-82713811 TGGGGATGCCTTGAGGAGGAAGG - Intergenic
993522245 5:88917051-88917073 CATGGAAGTCTTAAGGAAGTAGG - Intergenic
995584536 5:113634311-113634333 AAGGGCACTCTTGAGGGGGTGGG - Intergenic
995637921 5:114216673-114216695 TGGGGAAGTTTTGAGTATGTTGG - Intergenic
997161721 5:131615916-131615938 GAGGGAAGTCATGAGAAGGGTGG + Intronic
997167869 5:131681066-131681088 TGGGGAAGTGGAGAGGAGGTAGG - Intronic
999266598 5:150270726-150270748 TAGGTGAGTGTTGAGGGGGTGGG - Intronic
1000474863 5:161693889-161693911 TAGGGAATTCTTGGGAAGGGTGG - Intronic
1000790948 5:165606564-165606586 TAGAGAAGTCTTAAGGTGGCAGG - Intergenic
1002126484 5:177049271-177049293 TGGGGAAGTTTTGAGGATTTTGG - Intronic
1006188166 6:32192038-32192060 AAGGGGAGTCTGGAGGAGGTGGG + Intronic
1006893500 6:37450173-37450195 TGGGGAAGTCCTGATGAGTTGGG + Intronic
1006902579 6:37512694-37512716 TAGGGAAGTTGTGTGGAGGTGGG + Intergenic
1008497158 6:52145139-52145161 GAGGGAAGCCTTGAGCAGGAGGG + Intergenic
1009320392 6:62280925-62280947 TATGGAAGTTTTTAGGTGGTAGG + Intronic
1010950889 6:82035680-82035702 TTGGGCAGCTTTGAGGAGGTTGG + Intergenic
1013630269 6:111979769-111979791 AAGGGCTGTCTTGAAGAGGTTGG + Intergenic
1015771659 6:136774158-136774180 GAAGGAAGTGTGGAGGAGGTTGG - Intronic
1018378953 6:163240405-163240427 TATGGAAGTCTTCACGAGGACGG - Intronic
1020611852 7:10407694-10407716 CAGGGAAGTCTTGAGGGTTTTGG - Intergenic
1024221661 7:47293436-47293458 CAGGTAAGTCCTGAGAAGGTTGG - Intronic
1026093592 7:67322275-67322297 CATGGAAGTCTTAAGGAAGTAGG + Intergenic
1026552216 7:71378389-71378411 TAGGGAAGCCTTGATGAGGAGGG + Intronic
1027640767 7:80731156-80731178 GACGGAAGTCTGGAGGTGGTAGG + Intergenic
1031313293 7:120226925-120226947 TAGGGGAGCCTAGAGGAGGAAGG - Intergenic
1031541012 7:122994517-122994539 TGGGGCAGTCTTGAGCAAGTTGG + Intergenic
1037287600 8:17317938-17317960 GTGGGAAGTCAGGAGGAGGTGGG + Intronic
1041876767 8:62697235-62697257 TAGGGAGGTAGTGGGGAGGTGGG - Intronic
1042298823 8:67252843-67252865 TAGGGATGATTGGAGGAGGTGGG - Intronic
1046653807 8:116871757-116871779 TAGGACAGTCATGAAGAGGTTGG - Intronic
1051685775 9:19656911-19656933 TAGTGAATCCCTGAGGAGGTGGG - Intronic
1057174367 9:92985221-92985243 TAGGGAAACCTGGAGGAGGCTGG + Intronic
1057768099 9:97941306-97941328 GAGGGGAGTGTTAAGGAGGTGGG + Intronic
1058698709 9:107583222-107583244 TTGGGAATTCTTGAGGAGTCAGG - Intergenic
1059426828 9:114226516-114226538 CACAGAAGTCTTGAGGAGCTGGG - Intronic
1060200762 9:121650735-121650757 TAGGGAAGGGTGGAGGAGCTGGG + Intronic
1194206777 X:91019614-91019636 TAGGAATGTAATGAGGAGGTGGG - Intergenic
1194815560 X:98437205-98437227 TAGGGAGCTCTGGGGGAGGTGGG - Intergenic
1197255519 X:124258715-124258737 TAGAGAAGACTTGAGGAGTGTGG - Intronic
1197760448 X:130024319-130024341 TTGGCAAGTCGGGAGGAGGTGGG + Intronic
1197943683 X:131815738-131815760 TAGGGATATTTTGAAGAGGTGGG + Intergenic
1198303145 X:135350821-135350843 GAGGGAAGTCTGGAGGAAGGAGG + Intronic
1198410831 X:136365953-136365975 TGGGGAAGTCTGCAGGTGGTTGG - Intronic
1198652352 X:138876523-138876545 TTGGGAAGTCTCTAGGAGCTCGG + Intronic
1200056341 X:153463384-153463406 CAGGGAGGACTTGAGGATGTGGG - Intronic
1200372985 X:155747355-155747377 AAAGGAAGTTTTAAGGAGGTGGG - Intergenic
1200552526 Y:4594403-4594425 TAGGAATGTAATGAGGAGGTGGG - Intergenic