ID: 1166631354

View in Genome Browser
Species Human (GRCh38)
Location 19:44410457-44410479
Sequence AGGGAGAAGCTGGGTGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166631354_1166631366 7 Left 1166631354 19:44410457-44410479 CCTGCCTCACCCAGCTTCTCCCT No data
Right 1166631366 19:44410487-44410509 CCCAGAAACTCAGACCCAAGGGG No data
1166631354_1166631370 22 Left 1166631354 19:44410457-44410479 CCTGCCTCACCCAGCTTCTCCCT No data
Right 1166631370 19:44410502-44410524 CCAAGGGGCAGCTCCTCGCCAGG No data
1166631354_1166631372 29 Left 1166631354 19:44410457-44410479 CCTGCCTCACCCAGCTTCTCCCT No data
Right 1166631372 19:44410509-44410531 GCAGCTCCTCGCCAGGGATGTGG No data
1166631354_1166631371 23 Left 1166631354 19:44410457-44410479 CCTGCCTCACCCAGCTTCTCCCT No data
Right 1166631371 19:44410503-44410525 CAAGGGGCAGCTCCTCGCCAGGG No data
1166631354_1166631364 6 Left 1166631354 19:44410457-44410479 CCTGCCTCACCCAGCTTCTCCCT No data
Right 1166631364 19:44410486-44410508 TCCCAGAAACTCAGACCCAAGGG No data
1166631354_1166631363 5 Left 1166631354 19:44410457-44410479 CCTGCCTCACCCAGCTTCTCCCT No data
Right 1166631363 19:44410485-44410507 CTCCCAGAAACTCAGACCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166631354 Original CRISPR AGGGAGAAGCTGGGTGAGGC AGG (reversed) Intergenic
No off target data available for this crispr