ID: 1166631704 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 19:44412464-44412486 |
| Sequence | GTGTGACAGTAGCAAGTAGA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1166631704_1166631705 | -5 | Left | 1166631704 | 19:44412464-44412486 | CCATCTACTTGCTACTGTCACAC | No data | ||
| Right | 1166631705 | 19:44412482-44412504 | CACACTCTTGCCAGCAGAAGAGG | No data | ||||
| 1166631704_1166631711 | 25 | Left | 1166631704 | 19:44412464-44412486 | CCATCTACTTGCTACTGTCACAC | No data | ||
| Right | 1166631711 | 19:44412512-44412534 | AATGGCCGATATCACCGCCCAGG | No data | ||||
| 1166631704_1166631707 | 7 | Left | 1166631704 | 19:44412464-44412486 | CCATCTACTTGCTACTGTCACAC | No data | ||
| Right | 1166631707 | 19:44412494-44412516 | AGCAGAAGAGGCCCCTCTAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1166631704 | Original CRISPR | GTGTGACAGTAGCAAGTAGA TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||