ID: 1166631704

View in Genome Browser
Species Human (GRCh38)
Location 19:44412464-44412486
Sequence GTGTGACAGTAGCAAGTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166631704_1166631705 -5 Left 1166631704 19:44412464-44412486 CCATCTACTTGCTACTGTCACAC No data
Right 1166631705 19:44412482-44412504 CACACTCTTGCCAGCAGAAGAGG No data
1166631704_1166631711 25 Left 1166631704 19:44412464-44412486 CCATCTACTTGCTACTGTCACAC No data
Right 1166631711 19:44412512-44412534 AATGGCCGATATCACCGCCCAGG No data
1166631704_1166631707 7 Left 1166631704 19:44412464-44412486 CCATCTACTTGCTACTGTCACAC No data
Right 1166631707 19:44412494-44412516 AGCAGAAGAGGCCCCTCTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166631704 Original CRISPR GTGTGACAGTAGCAAGTAGA TGG (reversed) Intergenic
No off target data available for this crispr