ID: 1166636881

View in Genome Browser
Species Human (GRCh38)
Location 19:44458422-44458444
Sequence GGGGAGTAGCTGGGAGACAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166636874_1166636881 0 Left 1166636874 19:44458399-44458421 CCAGCTGAAATCTGGGGTTGTTT No data
Right 1166636881 19:44458422-44458444 GGGGAGTAGCTGGGAGACACGGG No data
1166636870_1166636881 21 Left 1166636870 19:44458378-44458400 CCTGGGTGTGGGGGGCTGACTCC No data
Right 1166636881 19:44458422-44458444 GGGGAGTAGCTGGGAGACACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166636881 Original CRISPR GGGGAGTAGCTGGGAGACAC GGG Intergenic
No off target data available for this crispr