ID: 1166637024

View in Genome Browser
Species Human (GRCh38)
Location 19:44459399-44459421
Sequence GAGGGTTGCAAGGATGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 6, 1: 3, 2: 5, 3: 40, 4: 196}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166637024 Original CRISPR GAGGGTTGCAAGGATGCTGC TGG (reversed) Intergenic
901751370 1:11412176-11412198 GAGGGTGGAAAGGATGGTGGGGG - Intergenic
902383688 1:16064625-16064647 TTGGGTTGCCAGGATGCTGACGG - Intronic
902870780 1:19312420-19312442 GAGGGCTGGAAGGATGTGGCAGG - Exonic
903548429 1:24141483-24141505 CTGGGTTGCAAGGAGGCTGGTGG + Intronic
903707178 1:25294897-25294919 GAGGGCTGCAGGGGTGCAGCGGG + Intronic
903720061 1:25398445-25398467 GAGGGCTGCAGGGGTGCAGCGGG - Intronic
904830532 1:33303703-33303725 GAGGGGTTCCAGGAAGCTGCAGG - Intergenic
905664929 1:39757651-39757673 GAGGGTTGGAAGGATGATGGTGG - Exonic
905946249 1:41903824-41903846 TAGGGATGCAAAGATGCTGATGG - Intronic
906274518 1:44506245-44506267 GAGGGTGGCAGGGTTGCTGGTGG + Intronic
908712708 1:67034985-67035007 TAGGGATGCAAGGATGGTTCAGG - Intronic
911039673 1:93582024-93582046 GAGGGATGGCAGGCTGCTGCCGG - Intronic
911530218 1:99035555-99035577 GATGGTTGCCAGGAGGCTGGGGG + Intergenic
913470780 1:119183097-119183119 GAGGGTTGGAAGTCAGCTGCGGG + Intergenic
922621558 1:226992411-226992433 GAGGGAAGAAAGGATCCTGCTGG - Exonic
1062916363 10:1243696-1243718 CATGGGGGCAAGGATGCTGCTGG - Intronic
1062974572 10:1674090-1674112 GAGGGCTGCAAGGAGGCCACTGG + Intronic
1067052495 10:43030080-43030102 GAGGGTTGCAAGTTTCCTTCAGG - Intergenic
1069658251 10:70106193-70106215 GAGGGTGGCAGTGCTGCTGCTGG - Intronic
1070328042 10:75400598-75400620 GAGGGCAGGAAAGATGCTGCTGG - Intronic
1070693623 10:78545491-78545513 AAGGGTTGGCAGGAAGCTGCTGG + Intergenic
1071381585 10:85068591-85068613 GAGGGAGGTGAGGATGCTGCAGG + Intergenic
1071829859 10:89360910-89360932 GAGGCAAGGAAGGATGCTGCGGG - Intronic
1075702921 10:124480956-124480978 GGGGGTTATAAGGAGGCTGCAGG + Intronic
1076456713 10:130604999-130605021 GAGGGTTGCATGGACATTGCAGG + Intergenic
1079351729 11:19697604-19697626 GAGGGAGGCAAGGATGGGGCAGG + Intronic
1080896678 11:36453965-36453987 CAGAGTTGCAAGGAAGCTGATGG + Intronic
1083199269 11:61110012-61110034 GAGGCTAGGAAGGATGGTGCAGG + Intronic
1084400370 11:68939732-68939754 GGGGCGTGCAAGGATGCGGCCGG - Exonic
1089460159 11:118648340-118648362 GTGGGTTGTAAGGATGTGGCAGG + Intronic
1091859350 12:3765448-3765470 GAGGAAAGCAAGGATGCTGCAGG + Intergenic
1092885007 12:12917187-12917209 GGATGTTCCAAGGATGCTGCTGG + Exonic
1092941260 12:13409335-13409357 GATGGTTTCAAGGCTGCTGCTGG + Intergenic
1095194133 12:39292839-39292861 GAGGGTTGGGAGGGTGCTTCTGG - Intergenic
1096968084 12:55644484-55644506 GTGGTTGGCTAGGATGCTGCAGG - Intergenic
1102739821 12:115197202-115197224 CAGGGTTGCAAGGAAGCATCAGG - Intergenic
1104766056 12:131331052-131331074 GATGGATGGATGGATGCTGCTGG - Intergenic
1106232045 13:27827991-27828013 GGGGTTTGCAAGGATCCTTCTGG - Intergenic
1106846837 13:33745873-33745895 GAGTGTTTCAAAGATGCTGATGG + Intergenic
1107084067 13:36406629-36406651 TAGGGTTTCCTGGATGCTGCAGG + Intergenic
1110454363 13:75673505-75673527 CAGGGTTGCAAGGTAGCTGTTGG - Intronic
1113435797 13:110290012-110290034 GTTGGCTGAAAGGATGCTGCCGG + Intronic
1113615528 13:111677875-111677897 GAGGGTTGCTAAGGGGCTGCTGG + Intergenic
1113620996 13:111762777-111762799 GAGGGTTGCTAAGGGGCTGCTGG + Intergenic
1114454468 14:22846145-22846167 GAGAGAAGCAAGGAGGCTGCGGG - Exonic
1117327816 14:54684960-54684982 GAGGGTGGCCAGGAAGCTGCAGG + Intronic
1119057583 14:71438837-71438859 GAGGGAGGCAAGTAAGCTGCAGG - Intronic
1119588281 14:75859278-75859300 GGAGGTTGCAGGTATGCTGCAGG + Intronic
1119599112 14:75962895-75962917 GAAGGGTCCAAGGATGCTACTGG - Intronic
1121925773 14:97926061-97926083 CAGGGTTGCAAGGATGAGTCAGG - Exonic
1121931713 14:97978219-97978241 GAGAGTTGCAGGGAAGCAGCAGG + Intergenic
1122150634 14:99724352-99724374 GAGGCTTGGATGGATGCTGGAGG - Intronic
1122274778 14:100585989-100586011 AAGGGTTTGCAGGATGCTGCTGG + Intronic
1123406576 15:20023013-20023035 GAGGCATGCAAGATTGCTGCAGG - Intergenic
1123427883 15:20187671-20187693 GAGTGTTGAAAGGGTGCTGATGG - Intergenic
1123515906 15:21029661-21029683 GAGGCATGCAAGATTGCTGCAGG - Intergenic
1124013567 15:25858963-25858985 GTGCCTTGCAAGGGTGCTGCTGG - Intronic
1127717307 15:61661718-61661740 CAGGTTTGGAAGGATGCTGGAGG - Intergenic
1128705717 15:69836345-69836367 GAGTGTTGGAAGGATGCTGCTGG - Intergenic
1131068704 15:89450488-89450510 GAGGGCTGCAAGCCTGCTCCAGG - Intergenic
1132720427 16:1312977-1312999 GAGGGTGGCATTGAGGCTGCTGG + Intronic
1133242079 16:4420790-4420812 GGGGGTTGGGGGGATGCTGCTGG - Intronic
1136238854 16:28932210-28932232 AAGGGTTGGAAGGACTCTGCCGG + Intronic
1136856412 16:33662090-33662112 GAGTGTTGAAAGGGTGCTGATGG + Intergenic
1138086277 16:54136478-54136500 GAGATTAGCCAGGATGCTGCTGG - Intergenic
1138521842 16:57575610-57575632 GAGGGTGGCAGGCCTGCTGCTGG + Exonic
1139508244 16:67410325-67410347 GAGCCTTGCAAAGATGCAGCTGG - Intronic
1139871782 16:70114121-70114143 GAGGGTGGCAAAGAGGCCGCGGG + Exonic
1140364150 16:74368362-74368384 GAGGGTGGCAAAGAGGCCGCGGG - Intergenic
1141624408 16:85253716-85253738 GAGGGTGGCAAGAGTGCTCCCGG + Intergenic
1142030269 16:87835088-87835110 CAGGGCTGCAAGGAGCCTGCAGG + Intronic
1203117992 16_KI270728v1_random:1510567-1510589 GAGTGTTGAAAGGGTGCTGATGG + Intergenic
1143152277 17:4815076-4815098 GAAGGATGCATGGATGATGCAGG + Intronic
1143873424 17:9974311-9974333 GAGGGTTGCCAGGATCTTGTGGG - Intronic
1144077164 17:11729727-11729749 GAGGGGGACAAGGATGATGCTGG - Intronic
1147215827 17:38898537-38898559 GAGGGCAGCAGGGATGCCGCAGG - Intronic
1147951082 17:44108444-44108466 TAGGGTTCTAAAGATGCTGCTGG + Intronic
1147998812 17:44375838-44375860 GAGGGTTGACAGGAGGCTGTGGG + Exonic
1148485355 17:47987404-47987426 GAGGGCATCAAGGCTGCTGCAGG + Intergenic
1150917563 17:69451951-69451973 GTGGGTGGCAAGGAGGCTGTTGG + Intronic
1151620755 17:75243409-75243431 GAGGGCTGCCTGGAGGCTGCGGG + Intronic
1152141013 17:78536748-78536770 GGGGGTTGGAAGGATGATGAGGG + Intronic
1152681036 17:81668044-81668066 GAGGCTTGGAAGGAGGCTGTGGG + Intronic
1153174763 18:2358236-2358258 GAGGGTTGCAAGAAAGGTGAGGG - Intergenic
1153889672 18:9501240-9501262 GAGAGGTGCAAGGATGAGGCAGG - Intronic
1153994991 18:10432997-10433019 GAGTGTTGCAAGGCTGCTTGAGG - Intergenic
1153999931 18:10474317-10474339 GCGGGTTGCGGGGATGCTCCTGG - Intronic
1156233997 18:35183401-35183423 GAGGGCTGCATTGCTGCTGCAGG + Intergenic
1157226156 18:45866546-45866568 GAGGGCTGCCAGCAAGCTGCTGG - Intronic
1158746208 18:60202535-60202557 GAGGGTAGCAAGGAGCATGCAGG - Intergenic
1159965179 18:74588016-74588038 GGGGGTTGTAAGGGTGTTGCTGG - Intergenic
1162126072 19:8500079-8500101 GAGGGGGTCAAGGATGCTGGGGG - Intronic
1162475483 19:10896879-10896901 GTGGGTGGCGAGGATGCTGAGGG + Intronic
1163468455 19:17483376-17483398 GAGGGAGGCAATGAGGCTGCTGG + Intronic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1167087453 19:47320100-47320122 GAGGGAGGGCAGGATGCTGCAGG - Exonic
1202649149 1_KI270706v1_random:165142-165164 GATTGTGGCAAGGATGCTGCTGG + Intergenic
925332437 2:3069154-3069176 GGGGGTTGCCAGGAGGCTGGGGG + Intergenic
925750661 2:7088520-7088542 GAGCCTAGCAAGGATGCTACGGG + Intergenic
927210403 2:20635725-20635747 TGCGGTTGCATGGATGCTGCTGG + Intronic
927894846 2:26775136-26775158 GAGGGTTGAAGGGCTGCTGGGGG - Exonic
929306838 2:40372982-40373004 GGGGATTGCAAGGCTGCTGTTGG - Intronic
929799081 2:45084005-45084027 GAGGGTGGCATGGGTGCTGTTGG - Intergenic
929864664 2:45708028-45708050 GAGGAATGCTGGGATGCTGCAGG + Intronic
933215910 2:79629717-79629739 GAGGGAGGAAAGGATGCTGAAGG + Intronic
933666595 2:84970432-84970454 GAGGGAAGCCAGGAGGCTGCCGG - Intergenic
934497837 2:94824922-94824944 CAGTGTTGCAAAGATGCTGCAGG + Intergenic
936344674 2:111666265-111666287 GAGGGTGGTGAGGATGCTGCTGG + Intergenic
936531642 2:113280106-113280128 GAGGGGGGCAAGGAAGGTGCAGG + Intergenic
937958225 2:127435415-127435437 GAGGGCTGCAAGGGTGAAGCTGG - Intergenic
938324638 2:130390456-130390478 GAGGCTGGCACGGTTGCTGCCGG - Intergenic
938406980 2:131038260-131038282 GAGGGCTGCAAGGCTGCAGGAGG - Intronic
938407013 2:131038382-131038404 GAGGGCTGCAAGGCTGCAGGAGG - Intronic
938407034 2:131038473-131038495 GAGGGCTGCAAGGCTGCAGGAGG - Intronic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
938541821 2:132289293-132289315 GTGTGTTGCAAGGATGCTGCTGG - Intergenic
938730543 2:134143625-134143647 GAGGGGTGGAAGGGTGGTGCTGG + Intronic
938981436 2:136530890-136530912 CAGAGTTCCAAGGATGGTGCAGG + Intergenic
940352105 2:152702213-152702235 GAAGGATGCAAGGATCCTCCAGG + Intronic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
942548638 2:177091548-177091570 GAGGGATTGTAGGATGCTGCAGG - Intergenic
945749747 2:213766853-213766875 CAGTGTTGAAAGGAAGCTGCAGG - Intronic
946202802 2:218080743-218080765 GAGGGAGGGAAGGATGCTGATGG - Intronic
948602775 2:239116734-239116756 CAGGGTGGCAGGGAGGCTGCAGG - Intronic
948961694 2:241343991-241344013 GAGGGCGGCAATGAAGCTGCTGG - Intronic
1170157767 20:13284319-13284341 CTGGGTTTCAAGGATGCCGCTGG - Intronic
1171869905 20:30516393-30516415 GAGGGTTGCAAGGGTGCTGCTGG - Intergenic
1171870694 20:30522174-30522196 GTGGGTTGCAAGGATGCTGCTGG - Intergenic
1172493984 20:35364928-35364950 GAGGGTTGCAAGAAGGCTAGGGG - Intronic
1172786602 20:37472916-37472938 GAAGGTGGCAGGGATGGTGCTGG + Intergenic
1173869328 20:46331746-46331768 GAGGGTTGCAGGGAGGCCTCGGG + Intergenic
1175396359 20:58665742-58665764 AAGCGTGGCACGGATGCTGCAGG - Intronic
1176602669 21:8807400-8807422 GATTGTGGCAAGGATGCTGCTGG - Intergenic
1179548054 21:42125344-42125366 GAGGGTGGCCAGGAAGCTGAGGG + Intronic
1179908073 21:44434410-44434432 GACGGTGGCAGGGATGCTGTCGG + Intronic
1180344954 22:11698957-11698979 GATTGTGGCAAGGATGCTGCTGG - Intergenic
1180352781 22:11817904-11817926 GATTGTGGCAAGGATGCTGCTGG + Intergenic
1180385466 22:12174453-12174475 GATTGTGGCAGGGATGCTGCTGG - Intergenic
1182578967 22:31292335-31292357 GAAGGAGGCAAGGATGCTGTTGG - Exonic
1182919413 22:34065564-34065586 AGGGGTTGCAAGGATGCTACTGG + Intergenic
1183971643 22:41482032-41482054 AAGGGAAGAAAGGATGCTGCTGG - Intronic
1184525315 22:45019292-45019314 GAGGGAAGCAAGGAGCCTGCAGG - Intergenic
1185418716 22:50723304-50723326 GTGGGCTGCATGGATGCTGGCGG + Intergenic
949756606 3:7418614-7418636 GAGACTTGCCAGGATGCTGCTGG + Intronic
951278957 3:20723716-20723738 GAGGGTTGCAAAAATACTGAAGG - Intergenic
951781530 3:26368635-26368657 GAGGGTTTTAGGGATGCTGGAGG + Intergenic
953885433 3:46712249-46712271 GAGGGCAGCAAGGAGGCTGAGGG + Exonic
954297369 3:49681744-49681766 GAGGGCTGCCAGGCTGCAGCAGG - Exonic
955491586 3:59488380-59488402 GAGGGTTGCATGGATGTGGAAGG + Intergenic
959905161 3:111703212-111703234 GAGGGATGCAGGGATGGTGCTGG + Intronic
961441675 3:126957280-126957302 GAGGGTTAAAAGGATGCTGCTGG + Intronic
962422513 3:135240874-135240896 GTGGGTTCCAATGTTGCTGCAGG - Intronic
963010940 3:140769772-140769794 GAGGAGTGCAGGGATGGTGCAGG - Intergenic
964423891 3:156532259-156532281 GTGGGTTGAAAGGATGTTCCTGG + Intronic
964728447 3:159839684-159839706 GTGGGTAGGAAGGATGATGCCGG + Intronic
966754528 3:183355989-183356011 GAGGTTTGCAAGGCTGCAGATGG - Intronic
968229406 3:196996504-196996526 GAGGGTTTCAGGGATGGGGCAGG - Intronic
968725466 4:2245911-2245933 GAGGGTGGGTAGGAGGCTGCAGG + Intergenic
969119786 4:4899682-4899704 GAGGCATGCAAGGATGCTGCGGG + Intergenic
969676582 4:8617737-8617759 GTGGGGTCCAAGGATGCTGAAGG - Intronic
970410189 4:15798441-15798463 GAGGGTTGAAAGAGGGCTGCTGG - Intronic
971938975 4:33189434-33189456 GAGGGCTGCCAGGATGGGGCTGG - Intergenic
973375318 4:49282285-49282307 GATTGTGGCAAGGATGCTGCTGG - Intergenic
973376219 4:49288298-49288320 GATTGTGGCAAGGATGCTGCTGG - Intergenic
973377139 4:49294453-49294475 GATTGTGGCAAGGATGCTGCTGG - Intergenic
973378058 4:49300589-49300611 GATTGTGGCAAGGATGCTGCTGG - Intergenic
973379006 4:49306887-49306909 GATTGTGGCAAGGATGCTGCTGG - Intergenic
973380087 4:49314763-49314785 GATTGTGGCAAGGATGCTGCTGG + Intergenic
973381003 4:49320918-49320940 GATTGTGGCAAGGATGCTGCTGG + Intergenic
973382093 4:49327956-49327978 GATTGTGGCAAGGATGCTGCTGG + Intergenic
973385623 4:49512571-49512593 GATTGTGGCAAGGATGCTGCTGG + Intergenic
975521438 4:75305844-75305866 GAGAGAAGGAAGGATGCTGCAGG + Intergenic
977787254 4:101051035-101051057 GAGAGCAGCCAGGATGCTGCTGG + Intronic
978372939 4:108047265-108047287 GAGGGTTGCCAGGATTCAGATGG - Intergenic
985962638 5:3314358-3314380 GAGGGCTGCAAGGAGGATGAGGG - Intergenic
988297664 5:29387282-29387304 GAGTGATTCAAGGATGCAGCTGG + Intergenic
988936861 5:36092588-36092610 GAGCATTGCCAGGCTGCTGCTGG - Intergenic
991045423 5:62217989-62218011 GAGTGTTGAAAGGGTGCTGATGG - Intergenic
993413964 5:87602456-87602478 AAGGGTTGCAAAGATCCTGTGGG + Intergenic
994465386 5:100122004-100122026 GAGCGTTTCAAGGATACTACTGG + Intergenic
995410038 5:111846590-111846612 GAGGGCTGCCTGGATACTGCTGG + Intronic
1001749309 5:174116789-174116811 GAGGGCTGCGAGGAGGCTGGAGG - Intronic
1005831755 6:29676706-29676728 GAAGGATGCCAGGATGGTGCGGG + Intronic
1006259245 6:32854217-32854239 GTGCCTTGCAGGGATGCTGCGGG + Exonic
1006521357 6:34572982-34573004 GAGGGTTGAAAGGATGCTTTGGG - Intergenic
1007769339 6:44180521-44180543 GGGGGTTGGAAGGAAGCTCCTGG + Intronic
1011847330 6:91582338-91582360 GAGGATTGGAAGGATGCAGAAGG - Intergenic
1013073469 6:106750310-106750332 GAGTGGTGCAGGGAGGCTGCTGG - Intergenic
1013269046 6:108528670-108528692 GAGAGTTGCAAGGTTGGGGCTGG - Intergenic
1013579390 6:111518163-111518185 GAGGGTGGGAGTGATGCTGCAGG - Intergenic
1018028796 6:159826082-159826104 GGGGGTTACGAGGATGCTGCTGG + Intergenic
1019212845 6:170420471-170420493 GAGGGTTGCCAGGGTGCTGTGGG + Intergenic
1019917634 7:4143893-4143915 AAGCGTTGCAGGGATGCAGCAGG + Intronic
1025799671 7:64774074-64774096 CTGGGTTACAAGGATGCTGCTGG + Intergenic
1025997115 7:66534967-66534989 GTGGGTGGGAAGGAGGCTGCTGG - Intergenic
1028280818 7:88925749-88925771 GAGAGTAGAAAGGATGGTGCAGG + Intronic
1029008398 7:97233232-97233254 GAATGTTGCAAGGATGTGGCAGG + Intergenic
1033599176 7:142876699-142876721 GAGGGGAGCTGGGATGCTGCAGG - Intronic
1034013493 7:147556555-147556577 GAGAGTTGCAGTGATGCAGCAGG + Intronic
1034104810 7:148481381-148481403 GATGGTTGGCAGGATGCTGGAGG - Intergenic
1034140029 7:148806777-148806799 CAGGGTTCCCATGATGCTGCTGG + Intergenic
1035010407 7:155710809-155710831 GGGGGATGCAAGGCTGCTACAGG + Intronic
1035202402 7:157276079-157276101 GAGGGGGGCGAGGGTGCTGCAGG - Intergenic
1036288013 8:7461907-7461929 GAGGTTGGGTAGGATGCTGCAGG + Intronic
1036333463 8:7849621-7849643 GAGGTTGGGTAGGATGCTGCAGG - Intronic
1039192537 8:34993390-34993412 ATTGGTTGCAAGTATGCTGCTGG + Intergenic
1040510111 8:48085699-48085721 GAGGGTTACAAGGATGCTGCTGG - Intergenic
1041784859 8:61620731-61620753 GAGGGTTGCAGTGTTCCTGCAGG - Intronic
1043147990 8:76680465-76680487 GACGGTTGCAAGAATGATGGGGG - Intergenic
1043172719 8:76985726-76985748 GAGGGAGGCATGGATCCTGCTGG + Intronic
1044225956 8:89718324-89718346 AAGGGTTCTAAGGATGCTGTTGG + Intergenic
1047571058 8:126099093-126099115 GAGGGCTCCAAGGAGACTGCTGG + Intergenic
1048344688 8:133567805-133567827 GAGGGTTTTGAGGATGATGCTGG + Intronic
1049332744 8:142063833-142063855 GGGGGTTCCCAGGCTGCTGCCGG - Intergenic
1049386725 8:142346670-142346692 GTAGGTCACAAGGATGCTGCTGG + Intronic
1049583241 8:143422040-143422062 GACGGGAGCAAGGGTGCTGCAGG + Intronic
1049864465 8:144925024-144925046 GATGGTTTCAAGGATGCAGGAGG - Intergenic
1053351187 9:37414405-37414427 GTGGGGTGCAAGGCTGCAGCAGG + Intergenic
1053659314 9:40255568-40255590 CAGTGTTGCAAAGATGATGCAGG - Intronic
1053909685 9:42884932-42884954 CAGTGTTGCAAAGATGATGCAGG - Intergenic
1054371441 9:64401870-64401892 CAGTGTTGCAAAGATGATGCAGG - Intronic
1054525284 9:66120648-66120670 CAGTGTTGCAAAGATGATGCAGG + Intronic
1054679062 9:67891585-67891607 CAGTGTTGCAAAGATGATGCAGG - Intronic
1055216800 9:73873285-73873307 GAGGGGTGCAGGTGTGCTGCAGG - Intergenic
1056167865 9:83956392-83956414 GAGGGTGGCAGAGCTGCTGCTGG - Exonic
1057064721 9:92038117-92038139 GAGGGTAGAAAGGAAGATGCTGG - Intronic
1061481493 9:130899556-130899578 GAGGGATGCACCGATGCCGCAGG + Intergenic
1061781549 9:132999268-132999290 GGGGGCTGCAGGGATGCTGCGGG + Intergenic
1062039244 9:134396538-134396560 TAGGGTTGCAGGGACGTTGCAGG + Intronic
1203699032 Un_GL000214v1:120521-120543 GACTGTGGCAAGGATGCTGCTGG - Intergenic
1203699990 Un_GL000214v1:126831-126853 GACTGTGGCAAGGATGCTGCTGG - Intergenic
1203700895 Un_GL000214v1:132815-132837 GACTGTGGCAAGGATGCTGCTGG - Intergenic
1203479730 Un_GL000224v1:1395-1417 GATTGTGGCAAGGATGCTGCTGG - Intergenic
1203480698 Un_GL000224v1:7691-7713 GATTGTGGCAAGGATGCTGCTGG - Intergenic
1203481659 Un_GL000224v1:14021-14043 GATTGTGGCAAGGATGCTGCTGG - Intergenic
1203549237 Un_KI270743v1:154335-154357 GATGGTGGCAAGGATGCTGCTGG + Intergenic
1203550191 Un_KI270743v1:160649-160671 GATTGTGGCAAGGATGCTGCTGG + Intergenic
1203567692 Un_KI270744v1:105532-105554 GATTGTGGCAAGGATGCTGCTGG - Intergenic
1203568753 Un_KI270744v1:112517-112539 GATTGTGGCAAGGATGCTGCTGG - Intergenic
1203569331 Un_KI270744v1:116769-116791 GACTGTGGCAAGGATGCTGCTGG - Intergenic
1203570280 Un_KI270744v1:123050-123072 GACTGTGGCAAGGATGCTGCTGG - Intergenic
1188505166 X:30874610-30874632 GTGAGTAGCAAGGATGTTGCTGG + Intronic
1189011362 X:37048816-37048838 GAAGTCTGCAAGGCTGCTGCAGG + Intergenic
1192639296 X:72847252-72847274 GTGGGTTGCAAGGCTGGTGCAGG - Exonic
1192642415 X:72873553-72873575 GTGGGTTGCAAGGCTGGTGCAGG + Exonic
1197784479 X:130186794-130186816 GAGGGCTGCAAGGATGAGCCAGG - Intergenic
1200163104 X:154019258-154019280 GGCGGGTGCAGGGATGCTGCTGG + Exonic