ID: 1166637331

View in Genome Browser
Species Human (GRCh38)
Location 19:44461859-44461881
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 2, 1: 1, 2: 2, 3: 18, 4: 97}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166637331_1166637336 -1 Left 1166637331 19:44461859-44461881 CCCATTATTGGCTCTTCAGTGAG 0: 2
1: 1
2: 2
3: 18
4: 97
Right 1166637336 19:44461881-44461903 GAACAGGTACTGGAAGTAGAGGG 0: 2
1: 2
2: 0
3: 31
4: 273
1166637331_1166637335 -2 Left 1166637331 19:44461859-44461881 CCCATTATTGGCTCTTCAGTGAG 0: 2
1: 1
2: 2
3: 18
4: 97
Right 1166637335 19:44461880-44461902 AGAACAGGTACTGGAAGTAGAGG 0: 2
1: 2
2: 1
3: 10
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166637331 Original CRISPR CTCACTGAAGAGCCAATAAT GGG (reversed) Intergenic
901923715 1:12553073-12553095 CACATTGAAGAGCACATAATGGG - Intergenic
904324652 1:29720460-29720482 ATGATCGAAGAGCCAATAATTGG - Intergenic
907747522 1:57228091-57228113 CAGACTGAAGTGCCTATAATAGG + Intronic
914358480 1:146909355-146909377 CACAATGAAGGGCCAATAAATGG - Intergenic
914494945 1:148187652-148187674 CACAATGAAGGGCCAATAAATGG + Intergenic
914839034 1:151232546-151232568 CTCACTGCAGAGGGAATACTGGG - Exonic
917989092 1:180354170-180354192 CTCACTCAAGAGTCATTGATTGG + Intronic
919131750 1:193459852-193459874 CTCCCTGAATACACAATAATTGG + Intergenic
919475589 1:198029428-198029450 GTCACTGAATACCCAGTAATGGG + Intergenic
919540456 1:198839123-198839145 CTCACTGTAAAGCCAATATTTGG + Intergenic
920157327 1:203964856-203964878 CTCTCAGAAGAGCCAATCTTCGG + Intergenic
921367396 1:214386632-214386654 CTCCCTGAGCAGCCAATACTGGG + Intronic
921769049 1:219012629-219012651 CTCATTGAAGAGAAAACAATGGG - Intergenic
923848184 1:237761256-237761278 CTCATTGAAAACCCAATAAGGGG - Intronic
923858154 1:237866745-237866767 CTCATTGAAGAGCTCATATTGGG - Intergenic
924646622 1:245883766-245883788 CTCCCTGAAAAGCCAAAAATAGG - Intronic
1065696648 10:28386736-28386758 CTCACTGAAGAGCTACTGAGAGG + Intergenic
1066244632 10:33570590-33570612 CTCATTCAGGAGCCAAGAATCGG + Intergenic
1068784627 10:60958045-60958067 CTCATTAAAAAGCCAGTAATTGG + Intronic
1069560614 10:69426781-69426803 CTCACAGTAGGGCCAAGAATGGG + Intergenic
1070361652 10:75696141-75696163 CTAACTGATAAACCAATAATGGG - Intronic
1070456815 10:76625179-76625201 ATCACTGATTTGCCAATAATAGG + Intergenic
1072461306 10:95621248-95621270 CTCCCTGAAAAGCCATTAAGAGG + Exonic
1077455701 11:2678615-2678637 ATTACTTAAGAGCCAATAATGGG + Intronic
1079309720 11:19354445-19354467 CTTTCTGAAGAGCCAACAACAGG + Intronic
1085666917 11:78421938-78421960 CTCTCTGCAGAGCAAATAAAAGG - Intergenic
1088039918 11:105367721-105367743 TTCAATGAAGAGGCAAAAATTGG + Intergenic
1092311000 12:7352633-7352655 CTTAGTGATCAGCCAATAATTGG - Intronic
1092583458 12:9873472-9873494 CTGACAGAGGACCCAATAATGGG + Intergenic
1097483654 12:60164862-60164884 CTCACTGATGAGCCAAAAAATGG + Intergenic
1098201253 12:68058238-68058260 CACACTGAATAGGCAATAGTTGG - Intergenic
1100086857 12:90921591-90921613 CTCACTGAAGAACTAATAATAGG - Intronic
1100818042 12:98404709-98404731 CCCACTGCAGAGCCCATACTGGG - Intergenic
1104003905 12:124878891-124878913 CTGAATGAAGAGCCAACCATGGG + Intronic
1111264874 13:85795863-85795885 CCAACTGAAGATCCAATATTCGG + Exonic
1112097272 13:96148014-96148036 CTCACTGATGACCCAAAAATTGG + Intronic
1113398199 13:109968455-109968477 GTCACTGAAGAGTCAAAAGTAGG + Intergenic
1114793549 14:25686040-25686062 CTCACTGATGCACCAAAAATTGG + Intergenic
1117325743 14:54667537-54667559 CTCATTGAAGAGCCAAGGAGAGG + Intronic
1118788362 14:69065974-69065996 CTGACTGAATCGCTAATAATGGG + Intronic
1118794723 14:69131318-69131340 CTCACTGAAGAGGAATAAATGGG - Intronic
1119740245 14:77009358-77009380 CTCACTGAAGAGCACATCACTGG + Intergenic
1127134102 15:55901349-55901371 CACATTGAATATCCAATAATTGG - Intronic
1129931340 15:79413357-79413379 CTCCTTGATGAGCCAATAATTGG - Intronic
1134693080 16:16203771-16203793 CCCACTTAAGAGGCAATCATGGG + Intronic
1134978768 16:18590924-18590946 CCCACTTAAGAGACAATCATGGG - Intergenic
1138571717 16:57878421-57878443 ATGACCGAAGAGCCAAAAATTGG - Intergenic
1147917436 17:43897079-43897101 TCCACTGAAGAGCCACTAACTGG + Intronic
1152409470 17:80115821-80115843 CTTAGTGGACAGCCAATAATTGG + Intergenic
1155576687 18:27255369-27255391 CTTACTGTAGAGCCCATATTTGG + Intergenic
1155782287 18:29851486-29851508 CTCATGGCAGAGCCAATAACTGG - Intergenic
1156624619 18:38893479-38893501 CTCACTTCAGAGTAAATAATAGG + Intergenic
1160434938 18:78843086-78843108 CTTTTTGAAGAACCAATAATTGG + Intergenic
1166630129 19:44399577-44399599 CTCACTGAAGAGCCAATAATGGG + Intronic
1166637331 19:44461859-44461881 CTCACTGAAGAGCCAATAATGGG - Intergenic
1167732056 19:51265559-51265581 CTAACTGAAGAGCCAGAAATGGG + Exonic
927703785 2:25284760-25284782 CTCACTGAACTGTTAATAATGGG - Intronic
927846972 2:26476758-26476780 CTCAGAGAAGAGCCAAGAATGGG - Intronic
928975534 2:37082940-37082962 CTCTTTGAGGAGTCAATAATAGG - Intronic
933605174 2:84375135-84375157 CCCACAGAGGAGTCAATAATTGG - Intergenic
936098578 2:109554153-109554175 CTCACTGATGCACCAAAAATTGG - Intronic
938543634 2:132306926-132306948 CTCACTTAAGAGCCAATGATGGG - Intergenic
939355156 2:141091935-141091957 CTCACTGAATCACCAAAAATTGG + Intronic
939644805 2:144684670-144684692 CTCACTGAAGACAAAATACTAGG + Intergenic
940284515 2:152020319-152020341 CTCACCCAGGAGCCATTAATGGG - Intronic
941683723 2:168426580-168426602 CTCAGTGCAGAGCCACTAACAGG + Intergenic
943223234 2:185136834-185136856 TTGTCTGAAAAGCCAATAATAGG + Intergenic
947536891 2:230945343-230945365 CTCAATGCACAGCAAATAATTGG - Intronic
1170731492 20:18979562-18979584 CTCACTCAAGAGGCAATGAAAGG + Intergenic
1171872497 20:30539632-30539654 CTCACTTAAGAGCCAATAATGGG - Intergenic
1172346132 20:34201579-34201601 CTTACTGGAGAGACAAGAATTGG + Intronic
1173490511 20:43476193-43476215 CTCACTGATTAACCAAAAATTGG - Intergenic
1178871029 21:36376007-36376029 CTGACTAAACAGCCAAAAATGGG - Exonic
1182358628 22:29734123-29734145 CAAACTGAAGAGCCAACAATGGG + Intronic
1182555973 22:31128461-31128483 CTCACTGCAGTGCCAAGAAACGG + Exonic
1184335726 22:43852023-43852045 CTCACTAAAGTGACAATAAAGGG - Intronic
949748536 3:7324498-7324520 CTCACTGAAAAGGCCATAAGAGG - Intronic
952404899 3:32997133-32997155 GTCACAGATGAGCCAATAACTGG + Exonic
954867483 3:53742350-53742372 CTCACTGAAGCACCCATAATAGG + Intronic
956953644 3:74311985-74312007 CTCCACGAAGAGCCAATCATAGG + Intronic
957587261 3:82148202-82148224 GTCATAGAAGAGCAAATAATTGG + Intergenic
965341207 3:167493396-167493418 CTCACTGCAGAACCAATAAGAGG - Intronic
966985687 3:185178332-185178354 CTCAGAGGAGAGGCAATAATAGG + Intergenic
975546044 4:75561543-75561565 CTCCCTGAAAAGCCAAAAACTGG + Intronic
976860743 4:89663348-89663370 CTTACTGAAGGGCCAAGAATTGG + Intergenic
977056941 4:92204530-92204552 CTCACAGTAGAGTAAATAATGGG - Intergenic
978774778 4:112494694-112494716 CTCACTGAAGAGCCAAGCAAAGG - Intergenic
981812404 4:148790455-148790477 CTCACTGTAGACCCAATGAATGG - Intergenic
982998570 4:162382423-162382445 CTCCCTTAGGAGCCAATACTTGG - Intergenic
984502938 4:180579479-180579501 CTCACTGTAAAGCAAAGAATGGG + Intergenic
987670056 5:20995004-20995026 CACACTGAAGAAGCAAAAATTGG + Intergenic
991959022 5:72023021-72023043 GACACTGAATAGCAAATAATTGG - Intergenic
995919989 5:117300138-117300160 CTCACTGAAGATCCTATCCTGGG - Intergenic
996930971 5:128886693-128886715 CTCACTGAGGAGCTGATATTTGG + Intronic
998632494 5:143915458-143915480 CTCAGAGAATAGCAAATAATGGG - Intergenic
1004331018 6:14721178-14721200 CTCACTTAACAGCCAAATATAGG + Intergenic
1006016442 6:31085068-31085090 ATCACTGGAGAGGCAATAAATGG + Intergenic
1013029270 6:106315365-106315387 TTCACTGAATAGCCCATAATAGG - Intronic
1016113093 6:140250401-140250423 CTCCCTGAAGCTCCAAGAATTGG - Intergenic
1021726589 7:23552974-23552996 CACAGTGCAGAGCAAATAATAGG - Intergenic
1022254904 7:28646231-28646253 CTCACTGAAGAGGAAATTTTAGG - Intronic
1027512983 7:79106998-79107020 CTCTTTGAAGAGCCATTATTTGG - Intronic
1032010274 7:128342197-128342219 CCCACTCAAGACCCACTAATAGG + Intronic
1034215234 7:149400531-149400553 CTTACTGGAGTGCTAATAATTGG + Intergenic
1040368691 8:46746826-46746848 CTCCCTGGAGACCCAAGAATTGG - Intergenic
1041088265 8:54277886-54277908 CTCACTGATTCACCAATAATTGG - Intergenic
1041094725 8:54338801-54338823 CTCACAGGAGAGTCAATAATGGG - Intergenic
1042551814 8:70000861-70000883 CTCACTGCAGATCCAATATAAGG - Intergenic
1042751017 8:72157778-72157800 CTCACAGAAGAGGCAAGAAGAGG - Intergenic
1047290782 8:123528232-123528254 CTCACTGCAGAGCCATTACATGG + Intronic
1047452712 8:124980080-124980102 GTCACACAAAAGCCAATAATGGG - Intergenic
1048026904 8:130595646-130595668 CTCACTGAATTGTCAATAATTGG + Intergenic
1050692607 9:8244769-8244791 CTCACTGAAAAGCAATTCATGGG - Intergenic
1056399680 9:86214468-86214490 CTCAGTTAAAAGCCAAAAATTGG + Intergenic
1057862699 9:98654363-98654385 CTCCTTTAAGAGCCCATAATGGG + Intronic
1188411305 X:29875179-29875201 ATCTCTGAGGAGCCAATAAAAGG - Intronic
1189412303 X:40783472-40783494 CTCACTGATGTGCCAAAAATTGG - Intergenic
1190567742 X:51748024-51748046 CTCACTGAAATGCAAATAATTGG - Intergenic
1191035121 X:56017202-56017224 CTGACTGAAGAGCTAGTATTAGG + Intergenic
1195113598 X:101672580-101672602 GTCACTCAAGAGGCAGTAATTGG - Intergenic