ID: 1166639091

View in Genome Browser
Species Human (GRCh38)
Location 19:44479298-44479320
Sequence TGTGATCCTGGAGAACCACA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 218}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166639091_1166639097 4 Left 1166639091 19:44479298-44479320 CCCTGTGGTTCTCCAGGATCACA 0: 1
1: 0
2: 0
3: 14
4: 218
Right 1166639097 19:44479325-44479347 TGTCCAGGGTCCTCTGAGCAGGG 0: 1
1: 2
2: 7
3: 40
4: 269
1166639091_1166639096 3 Left 1166639091 19:44479298-44479320 CCCTGTGGTTCTCCAGGATCACA 0: 1
1: 0
2: 0
3: 14
4: 218
Right 1166639096 19:44479324-44479346 CTGTCCAGGGTCCTCTGAGCAGG 0: 1
1: 2
2: 6
3: 51
4: 249
1166639091_1166639095 -10 Left 1166639091 19:44479298-44479320 CCCTGTGGTTCTCCAGGATCACA 0: 1
1: 0
2: 0
3: 14
4: 218
Right 1166639095 19:44479311-44479333 CAGGATCACATCTCTGTCCAGGG 0: 1
1: 0
2: 1
3: 26
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166639091 Original CRISPR TGTGATCCTGGAGAACCACA GGG (reversed) Exonic
900900049 1:5509977-5509999 TGTGACCCCGCAGAACCGCACGG - Intergenic
901118269 1:6866938-6866960 AGAGATCATGGAGAAGCACACGG - Intronic
902270360 1:15299946-15299968 TGCTAACCTGGGGAACCACAGGG - Intronic
902374914 1:16026145-16026167 TGTGATCTTGGAGGACTACCTGG + Exonic
906276030 1:44516701-44516723 TGAGATCATGTAAAACCACATGG - Intronic
909940490 1:81605411-81605433 TGGTATCCTGGAGATCCACTGGG - Intronic
911973273 1:104463037-104463059 TGAAATCTTGGAGAAGCACACGG + Intergenic
915113263 1:153578379-153578401 TGTGATGATGGAGAACCATGGGG + Intergenic
915404857 1:155652070-155652092 TTTCATACTGGAGAACCAAAAGG + Intergenic
916364862 1:164014608-164014630 TGTGATCATGAAGAGACACATGG - Intergenic
917540486 1:175908244-175908266 GGAGAACCTGGATAACCACATGG - Intergenic
918647098 1:186917657-186917679 TAAGATCTTGGAGAAGCACATGG + Intronic
919944932 1:202312083-202312105 TTAGGTCTTGGAGAACCACAGGG + Intronic
920512624 1:206562190-206562212 AGTGCCCCTGGAGTACCACAGGG - Intronic
922161452 1:223081574-223081596 TGTGGTCCTGCAGCACCACCTGG + Intergenic
924040315 1:239978242-239978264 TGGGTTCCTGGATGACCACAGGG + Intergenic
1062808882 10:447319-447341 TGTGATCCTGAATATCGACAGGG - Intronic
1062809131 10:448668-448690 TGTGATCCTGAATATCGACAGGG - Intronic
1063495010 10:6498958-6498980 TGTAATTCTAGAGAATCACATGG + Intronic
1063778692 10:9295075-9295097 TCTGATCATGGATAACCAGATGG - Intergenic
1065736778 10:28760308-28760330 TGTGTTCCTGGAGGTCTACATGG - Intergenic
1067807131 10:49400560-49400582 TGAGATCCCTGGGAACCACATGG - Intergenic
1071282312 10:84113894-84113916 TAAGATCTTGGAGAAGCACACGG - Intergenic
1071516153 10:86299145-86299167 TGTTGTCCTGCAGTACCACATGG - Intronic
1071988371 10:91075306-91075328 TGTGTCCCTGCAGGACCACATGG + Intergenic
1072047024 10:91667167-91667189 TGATGTCCTGGAGAGCCACATGG + Intergenic
1073715014 10:106094776-106094798 TGTGATCAGGGAAAAACACAAGG + Intergenic
1073866120 10:107806130-107806152 TGTAATCCTAGATAAGCACAGGG + Intergenic
1074045756 10:109837562-109837584 TGTAATCCTGAGAAACCACAAGG + Intergenic
1075470337 10:122684065-122684087 TGTGATAATGGAAAACAACAAGG + Intergenic
1076121515 10:127940383-127940405 TGTGAGCCTGCAGTACCTCAGGG - Intronic
1076480246 10:130780076-130780098 TGTGATCCTGGAGAGCCCTAAGG - Intergenic
1080193296 11:29577369-29577391 AGTGAACATGAAGAACCACAGGG - Intergenic
1084064221 11:66694078-66694100 AGGGAGGCTGGAGAACCACATGG + Intronic
1084463686 11:69309963-69309985 TGTCCTCTTGGAAAACCACAGGG + Intronic
1084640955 11:70425428-70425450 TGTTTTCCTGGGAAACCACACGG - Intronic
1091087687 11:132738644-132738666 TCTGATTCTACAGAACCACAGGG - Intronic
1091307543 11:134546195-134546217 GGGGTTCCTGTAGAACCACAAGG + Intergenic
1091956966 12:4653305-4653327 TGTCATTCTGGAGGAACACAGGG + Intronic
1091987038 12:4918831-4918853 TGTGAACATGTAGAACTACATGG - Intronic
1092143325 12:6198866-6198888 GATGATGCTGCAGAACCACAGGG - Intergenic
1093474777 12:19542875-19542897 TATGATCCTGGACAAACAGATGG + Intronic
1095731501 12:45511320-45511342 TGTGCACCTGGAAAACCAGAAGG - Intergenic
1096071222 12:48776447-48776469 TGTGACCCTGGCCAACCACATGG - Exonic
1096915423 12:55026979-55027001 TGTCCTCCTGGAGAAGCACGAGG + Exonic
1097768248 12:63550356-63550378 TATCATCCTGGATAAGCACATGG - Intergenic
1097784610 12:63745419-63745441 TATCATCCTGGATAAGCACATGG - Intergenic
1105463579 13:20615504-20615526 AGAGATACTGGAGAAACACAAGG - Intronic
1107428245 13:40315700-40315722 TGACATCCTGGAGATCAACAGGG + Intergenic
1107454974 13:40546485-40546507 TTTGATCCGGGGGGACCACATGG - Intergenic
1110013775 13:70373059-70373081 TCTGATCGTGAAAAACCACATGG + Intergenic
1112805993 13:103164396-103164418 TGAGAGCCTGGAGAAGGACAGGG + Intergenic
1113125113 13:106969423-106969445 TGTGACTCTGTAAAACCACAAGG - Intergenic
1120588854 14:86350561-86350583 TGTTGTCCTGGAGAGCAACAGGG + Intergenic
1121534636 14:94682855-94682877 TGTGTTCCTGGACATGCACAAGG - Intergenic
1122012134 14:98759037-98759059 AGTGAGGCTGGAGAACTACAAGG - Intergenic
1126667194 15:51086239-51086261 TGTGATCCAGAAGAAGCCCACGG + Intronic
1126940795 15:53762973-53762995 TGTGATCCTGGAAAACATGAAGG + Intergenic
1129326705 15:74803642-74803664 GGTGAAACTGGAGAACCACCAGG - Intergenic
1131178624 15:90225376-90225398 TCTGCTCCTGGACACCCACAGGG + Exonic
1133002999 16:2860493-2860515 TATGATCCTGGGGGTCCACAGGG - Intergenic
1133994716 16:10739755-10739777 TGTGTCCCTGAGGAACCACAGGG + Intergenic
1136686420 16:31997255-31997277 TGTGCTCCTGGAGAAGCCCCTGG + Intergenic
1136787031 16:32940784-32940806 TGTGCTCCTGGAGAAGCCCCTGG + Intergenic
1138271910 16:55701748-55701770 TTTGATCCTGCAGCCCCACATGG - Intronic
1138443442 16:57048481-57048503 TTTGAACCTGGAGAAGGACATGG - Intronic
1139192700 16:64882928-64882950 TCAGATGCTGTAGAACCACATGG - Intergenic
1139647750 16:68343874-68343896 TGTGCTCTTGGAGTCCCACAGGG + Intronic
1139961225 16:70718636-70718658 GCTGAGCCAGGAGAACCACAGGG - Intronic
1141599380 16:85115961-85115983 TGTGTTTTTGGGGAACCACATGG + Intergenic
1142268470 16:89077165-89077187 TATCCTCCTGGAGAACCCCAGGG - Intergenic
1203089270 16_KI270728v1_random:1202454-1202476 TGTGCTCCTGGAGAAGCCCCTGG + Intergenic
1142582334 17:949802-949824 TGAGACCCTGGAGAGCCACTGGG + Intronic
1144287647 17:13793708-13793730 AGTGCTCCTGGAGAAGTACATGG + Intergenic
1145206626 17:20987885-20987907 TGGGCCCCTGGAGAAACACAGGG - Intergenic
1147497947 17:40936174-40936196 GGTGACCCTGGAGATCCAGATGG - Intronic
1147982429 17:44282736-44282758 TGAGAGCCTGGAGAAGGACAGGG + Intergenic
1149051159 17:52306865-52306887 TGTGATTTGGGAGAACCACAGGG + Intergenic
1149076219 17:52598204-52598226 TGAGATCTCGGAGAAGCACACGG - Intergenic
1150961121 17:69913381-69913403 TGTGATCCAGCACAAACACAGGG - Intergenic
1151511554 17:74564030-74564052 CGTGACCTTGGAGAACCTCACGG - Intergenic
1152473345 17:80502640-80502662 TGTCTTCCTGGGGAAGCACATGG - Intergenic
1152937662 17:83149921-83149943 AGTGAGCCTGGAAAACCACGAGG - Intergenic
1157265642 18:46218416-46218438 GGTAATCCTGGAGAATCAAATGG + Intronic
1158440572 18:57471091-57471113 TGTGAGACTGGAGAACATCATGG - Intronic
1159585835 18:70282974-70282996 TGTGAGCCTGGAGAAGCAGGAGG + Intergenic
1160947136 19:1648882-1648904 TGGGTTCCTGGAGAAGCCCAGGG - Intronic
1162957333 19:14106804-14106826 GGTGATGCTGGTGAAACACAAGG - Exonic
1163669700 19:18620410-18620432 TCTGACCCTGGAGCAGCACAAGG + Exonic
1163793848 19:19324271-19324293 AGGGAGCCTGGAGAACCACTCGG + Intronic
1164481162 19:28611956-28611978 TGAGATCTCGGAGAAGCACACGG - Intergenic
1164799913 19:31067878-31067900 TGTGTTCCGGGAGCACCACTGGG - Intergenic
1165316183 19:35056734-35056756 GGTGATCCTGGAGACACAGATGG - Intronic
1165443107 19:35842125-35842147 TGGGATCTTGGAGATCCAGAGGG + Exonic
1166012037 19:39949793-39949815 TCTGATCTTGGGGAACCAAAAGG + Intergenic
1166639091 19:44479298-44479320 TGTGATCCTGGAGAACCACAGGG - Exonic
1168217740 19:54938916-54938938 GGTGTTCCTGGAGAATTACATGG - Exonic
929320378 2:40536900-40536922 TGTGAGCCTGAAAAACAACAGGG + Intronic
929618349 2:43330194-43330216 TGCGTTCCTGGGTAACCACAAGG - Intronic
929654785 2:43719765-43719787 TGTTAACCTAGAGAGCCACAGGG + Intronic
929654794 2:43719912-43719934 TGTTAACCTAGAGAGCCACATGG + Intronic
932737985 2:74268949-74268971 TGGGATCCTGGGGAATCAGATGG + Intronic
933144008 2:78828763-78828785 TGTGGTCCTGGAGAGCCCGAGGG - Intergenic
933650383 2:84845512-84845534 TCTGGTCCTTGAGGACCACAGGG - Intronic
935953053 2:108348359-108348381 TGTGGTTCTGTAGACCCACAGGG - Intergenic
936863007 2:117040850-117040872 TGTGATGATTCAGAACCACAGGG - Intergenic
937368622 2:121283021-121283043 AGTGTTCCTAGAGAACCACCCGG - Intronic
937590781 2:123610920-123610942 TGTGAACCTGTAGAACAAAATGG + Intergenic
940732448 2:157408288-157408310 TGGTATCCTGGAGAACAACCTGG - Intergenic
942338115 2:174913228-174913250 AGTGATCCTGGAGAAATGCAGGG + Intronic
942832579 2:180254153-180254175 AGTGGTCCTGGAGTCCCACAAGG - Intergenic
944731474 2:202521919-202521941 AGTGATCCTTGAGATCCACTTGG - Intronic
945493235 2:210480100-210480122 TGTGATCCTGAATGGCCACATGG - Intronic
946016944 2:216611565-216611587 TGTGTTCCTGGAAAACTCCAGGG - Intergenic
948145169 2:235703280-235703302 AGTGAGCCTGGAGTAACACATGG - Intronic
948841005 2:240648903-240648925 TGAGATCCTGGGGACCCAAAGGG - Intergenic
1168841956 20:915320-915342 TGTGTGCCTGGAGAACCATGGGG - Intronic
1168874398 20:1160866-1160888 TGTGTTCCTGGAGGAGCACCTGG + Intronic
1169090948 20:2861094-2861116 TATGATCCTGGGGCAACACAGGG + Intronic
1170280083 20:14636534-14636556 AGTGATCCTGGAAAGCCAAATGG + Intronic
1171106515 20:22438617-22438639 TGTGATCTTGGAGAAGCTCGAGG - Intergenic
1171208636 20:23300394-23300416 TCTGTTCCTAGAAAACCACAAGG + Intergenic
1172627236 20:36354201-36354223 TGCGGTCCAGGAGAACCCCAGGG - Intronic
1174100238 20:48121647-48121669 TGTGGAGCTGGAGAACCAGAGGG - Intergenic
1178138710 21:29657494-29657516 TGTGTACCTGGAGGACCCCAGGG - Intronic
1178178528 21:30132642-30132664 TTGTACCCTGGAGAACCACAGGG - Intergenic
1181115410 22:20629958-20629980 TGTGAAGCTGGAGACCCTCATGG - Intergenic
1181485128 22:23225727-23225749 TGGGATGCAGGAGAAGCACAGGG - Intronic
1182999783 22:34845839-34845861 GGTGATCCTGGAGCAGAACAAGG + Intergenic
1183175110 22:36217914-36217936 TGGGACCCAGGAGAGCCACAGGG + Intergenic
1184078270 22:42198227-42198249 TGTGATGATGGAGACTCACAAGG + Intronic
1184158456 22:42684171-42684193 TGTGACCCAGGAGAACTCCAAGG - Intergenic
1184198961 22:42951889-42951911 GGTGCATCTGGAGAACCACATGG - Intronic
1184379968 22:44139104-44139126 AAGGATCCTGGAGAACCACGAGG - Intronic
1184476225 22:44722929-44722951 TGTGATCCTAGTAAACCACGGGG + Intronic
1184599391 22:45533509-45533531 TGTGGTCCTCAAGAACCCCACGG - Intronic
949256126 3:2048625-2048647 TGATATCCTGGAGACACACAGGG - Intergenic
950509755 3:13419375-13419397 TGTGACCCTGTGGAACCACAGGG - Intronic
952966007 3:38621643-38621665 TGTGAACATGGAGAACAACTAGG + Intronic
953433259 3:42856883-42856905 TGTGTTCCAGGAGAAAGACAGGG - Intronic
953443504 3:42941315-42941337 TGTGATGCTGGAGAACTATGAGG + Exonic
954700633 3:52449034-52449056 TGAGATCTGGGGGAACCACAGGG - Intergenic
957022592 3:75141647-75141669 TGAGATCTTGGAGAAGCACATGG - Intergenic
959620910 3:108397816-108397838 TGGGATGCTGGGGAAGCACATGG + Intronic
960804379 3:121568707-121568729 TGTGATCCTCGACAAACACATGG - Intergenic
961052461 3:123758474-123758496 TCTGTCCCTGGAGACCCACATGG - Intronic
961859668 3:129905611-129905633 TTTGGTCCTGGAGAAACACAAGG - Intergenic
962572764 3:136727625-136727647 TGTGTTCCTAGAGACCCAAAAGG - Intronic
963045232 3:141097369-141097391 TGTGAATCTGGAGAAAAACATGG - Intronic
965464643 3:169012780-169012802 TGTGATAGTGAAGAACCACAGGG + Intergenic
966070732 3:175874249-175874271 TATGATGCTGGACAACCTCACGG - Intergenic
967404307 3:189099283-189099305 TGTGACACTGGAGAACCTCCAGG - Intronic
968561621 4:1286172-1286194 TGTGATCCTGAAGCCCCAGAGGG + Intergenic
968665977 4:1822610-1822632 TGTGACCCAAGAGGACCACAGGG + Intronic
969467226 4:7364958-7364980 TGAGATCCTGGAGACACAAAGGG - Intronic
975126582 4:70789034-70789056 TGTGATTCTGGAGGATCAGATGG - Intronic
976835835 4:89372356-89372378 TGTTATCCTTGGAAACCACATGG - Intergenic
979616153 4:122745255-122745277 TGTGAACATGTAGAAACACAGGG - Intergenic
981830430 4:148993744-148993766 TATGATCCTGAAGAAACACAGGG + Intergenic
984379461 4:178971747-178971769 CATGGTCTTGGAGAACCACATGG + Intergenic
986084114 5:4425873-4425895 TGTGTTGCTGGAGAATCAGATGG + Intergenic
986433687 5:7706861-7706883 TGTGACCTTGGCCAACCACATGG + Exonic
986494024 5:8323504-8323526 TGCAATCCTGGAGAACACCAAGG - Intergenic
987346798 5:16985991-16986013 TGTGAGCCTTGTGAATCACAGGG + Intergenic
988066430 5:26232249-26232271 TGTGATGCTGAAGAACCACGTGG - Intergenic
988906490 5:35796021-35796043 TGTGATCCTGGAAAATTCCATGG + Intronic
993573957 5:89578441-89578463 TGTGATCATGGAGAGAGACATGG + Intergenic
994433588 5:99699705-99699727 TGTTCTCCTGGAGAAAAACAAGG + Intergenic
996204388 5:120713900-120713922 TTTGATACAGGAGAACCACTTGG - Intergenic
997596124 5:135108409-135108431 TCTGAGCCAGGAGCACCACAGGG + Intronic
998133226 5:139661471-139661493 TGTGCTTCTGGAGCACCACATGG - Intronic
998153207 5:139769062-139769084 AGTGATGTTGGAGAAGCACAGGG + Intergenic
998506899 5:142679418-142679440 AGTGGTCCTGAAAAACCACATGG - Intronic
998808608 5:145942737-145942759 TGTGAAGCTGGAGAACCATCTGG - Intronic
1002891844 6:1340146-1340168 TGAGATCCTGGAGAACCTTTTGG - Intergenic
1002931834 6:1640279-1640301 TGTGCCCGTGGAGAAGCACATGG + Intronic
1003197131 6:3925394-3925416 TGTGAGGCTGGAGAAGCAGATGG + Intergenic
1004424981 6:15501142-15501164 GGAGATCCTGGAGAAGCGCAAGG + Exonic
1011013171 6:82724822-82724844 TGAGCTCCTGGACAACCTCAAGG + Intergenic
1011659022 6:89578195-89578217 GGTGAGCCAGGAGAACGACATGG + Intronic
1012611594 6:101226444-101226466 TGAGATCTCGGAGAAGCACACGG + Intergenic
1013048124 6:106507851-106507873 TATGATCTTGGATATCCACAGGG + Intergenic
1013473366 6:110485846-110485868 TCTGGTCCTGGAGAGCCACGTGG + Intergenic
1013969754 6:116002721-116002743 TGTGGTACTCCAGAACCACATGG - Intronic
1015973562 6:138767150-138767172 TATTATCATGGAGAACCACAAGG - Intronic
1016440856 6:144081918-144081940 TGTGATCTTGGCTCACCACAAGG + Intergenic
1017723535 6:157261151-157261173 TGTGATGCTGCCTAACCACAGGG - Intergenic
1018831522 6:167447387-167447409 TGTATTCCTGGATATCCACAAGG - Intergenic
1019802366 7:3097563-3097585 TGTGATCCAGGAGAATTCCAGGG - Intergenic
1020376238 7:7490603-7490625 GGAGCTCCTGGAGAACCATAAGG + Exonic
1021691670 7:23236161-23236183 TGTGAGCCGGGAGAATCAAACGG - Intronic
1023673001 7:42599346-42599368 TGTGATAATGGACAAACACACGG + Intergenic
1024249561 7:47495995-47496017 TGTGATCCAGAAGGAGCACACGG + Intronic
1029641776 7:101825430-101825452 GATGAGCCTGGAGGACCACAAGG + Intronic
1029670336 7:102025819-102025841 TGTGATCCTGTAGAAACATTTGG - Intronic
1031479456 7:122260595-122260617 TGTGATCCTTCAGAACCATCTGG - Intergenic
1032614962 7:133458488-133458510 TGTGACTCAGGAGAAACACAAGG - Intronic
1032739441 7:134724132-134724154 TGTGAGCCTGAAGAATCACTGGG + Intergenic
1033283883 7:140024661-140024683 TGTGATCTTTGAGAAACACCAGG - Exonic
1036013698 8:4757427-4757449 TGTGATCCTGGAGAGCAGGAAGG + Intronic
1037604536 8:20426054-20426076 TGTGACCCTGGGGAAGGACAGGG - Intergenic
1037922095 8:22814656-22814678 TGTGGTCATTGTGAACCACAGGG + Intronic
1038397601 8:27258606-27258628 TGTGGAGCTGGAGAACCAGAGGG + Intergenic
1038397996 8:27261284-27261306 GGGCCTCCTGGAGAACCACACGG - Intergenic
1039880203 8:41620962-41620984 GATGATCGTGGGGAACCACAAGG + Exonic
1040468585 8:47717459-47717481 TGTGTACCTGAAGAACCCCAAGG + Intronic
1042370274 8:67983589-67983611 TGGGATCCTGGAGGCCCTCATGG - Intronic
1043969971 8:86518042-86518064 TTTAAACCTTGAGAACCACATGG + Intronic
1044029244 8:87214095-87214117 TGGGATCCTGCAAAGCCACAGGG - Intronic
1045111577 8:98942165-98942187 TCTGAGCCTGGAGAAACACAAGG + Intronic
1045674962 8:104597446-104597468 TGAGATACAGCAGAACCACAGGG + Intronic
1049256373 8:141616051-141616073 TGGGTTCCTGGATGACCACAGGG + Intergenic
1050382274 9:5042573-5042595 TGGGATCCTGGAGGCCCCCAGGG + Intronic
1053300564 9:36946301-36946323 TGTGCACCGGGAGAAACACACGG - Intronic
1053466859 9:38315045-38315067 TGTGATTATGGAGAACGATATGG - Intergenic
1053482749 9:38428157-38428179 TGTGATCCTTGAGAGCGTCAGGG + Intergenic
1056321762 9:85441840-85441862 TGTTATCCTAGAGAAACAGAGGG + Intergenic
1058342707 9:103918433-103918455 TGTCTTCATGGAGACCCACATGG - Intergenic
1058997716 9:110315995-110316017 TGTGAGGCAGGAGAACCACCTGG - Intronic
1059225413 9:112668211-112668233 TTTGAGCATGGAGAAGCACATGG - Intronic
1059391169 9:114000556-114000578 TGTGACCCAGGAAAACCAAAAGG + Intronic
1061420656 9:130471494-130471516 TGGAATCCTGGAGAACCCCAAGG + Exonic
1062368518 9:136224050-136224072 TGACTTCCTGCAGAACCACACGG - Exonic
1186075505 X:5874304-5874326 TGTGGTCCTAGAGAACAACTAGG - Intronic
1187203060 X:17154574-17154596 TGGGTTCCTGAACAACCACAAGG - Intergenic
1188713648 X:33433438-33433460 TGTGATCTTGAAGTACCACCTGG + Intergenic
1189220169 X:39364858-39364880 TGGATTCCTGAAGAACCACATGG + Intergenic
1189585635 X:42458871-42458893 TGTGTTCCAGGACAACCATAGGG - Intergenic
1190314672 X:49142804-49142826 TGAGATCTCGGAGAAGCACATGG + Intergenic
1192469270 X:71382888-71382910 TGTGATAGAGGAGAACCCCATGG + Intronic
1195112578 X:101662174-101662196 TGTGATCTTGGTAGACCACAGGG - Intergenic
1195822138 X:108956876-108956898 TTGCATCCTGCAGAACCACAGGG + Intergenic
1201696985 Y:16836952-16836974 TGAGATCTTGAAGAAGCACATGG - Intergenic