ID: 1166641327

View in Genome Browser
Species Human (GRCh38)
Location 19:44497611-44497633
Sequence GCTTACAGGTAGATGGTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 69}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166641327_1166641331 -3 Left 1166641327 19:44497611-44497633 CCCTGGACCATCTACCTGTAAGC 0: 1
1: 0
2: 0
3: 3
4: 69
Right 1166641331 19:44497631-44497653 AGCCCAGCTTGTGCCCAACATGG 0: 1
1: 0
2: 0
3: 26
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166641327 Original CRISPR GCTTACAGGTAGATGGTCCA GGG (reversed) Intronic
909554403 1:76937477-76937499 GCTTACTGGAAGATGGTGTAAGG + Intronic
911969999 1:104421371-104421393 GGTTACAGGTAAATCGTACATGG + Intergenic
915243063 1:154537564-154537586 GCTTAAAGAGAGATGGCCCAGGG + Intronic
915925162 1:160011964-160011986 GCTTACAGGTGGCTGGTCGTGGG - Intergenic
918728366 1:187955401-187955423 GCTTGCAGTCAGATGGTCAAGGG - Intergenic
923061735 1:230481615-230481637 GCTCACAGGTAATTGGACCATGG + Intergenic
1073176346 10:101559821-101559843 GATTACAGATAGATGGGCCCTGG - Intergenic
1075406610 10:122199719-122199741 GCTAACAGGTACCTGGTCTATGG - Intronic
1082105648 11:48218366-48218388 GCTTATGGTCAGATGGTCCATGG - Intergenic
1084123464 11:67083182-67083204 ACTTTCAGGGAGATGGTCCTGGG - Intergenic
1089144138 11:116312097-116312119 GTTTACAGGGAAAAGGTCCATGG + Intergenic
1094414729 12:30204481-30204503 GCATACAGGTTAATGGTACAGGG + Intergenic
1097179762 12:57165096-57165118 GCCTCCAGGTCCATGGTCCATGG + Intronic
1097677191 12:62615612-62615634 GCTTACAGCTAGATGGTGGCTGG - Intergenic
1102955055 12:117053810-117053832 ACTGACAGGAAGATGGTACAGGG - Intronic
1103904798 12:124321723-124321745 GCTTACCAGTAGCTGGGCCAGGG + Intergenic
1108452270 13:50579037-50579059 GCTTACAGGAAGACAGTACATGG - Intronic
1116959530 14:50955732-50955754 GCTTCTAGGTAGCTGGACCAGGG - Intergenic
1117455057 14:55888639-55888661 TCATACAGGTAAATGGTTCATGG - Intergenic
1120686240 14:87541262-87541284 GGTTACAGGGAAATAGTCCAAGG - Intergenic
1122718399 14:103708507-103708529 CCTTACAGGTAGGTGGGCCCTGG - Exonic
1131273616 15:90961725-90961747 GCATACACGTAGGTGTTCCACGG - Exonic
1133407746 16:5539137-5539159 GCTTCCAGGTGCATGGTTCAGGG + Intergenic
1141322955 16:83028924-83028946 GGTGACAGGCAAATGGTCCAGGG + Intronic
1142179269 16:88659436-88659458 GCTTTCAGGAAGGTGGGCCAGGG + Intronic
1144014286 17:11179114-11179136 CCTTACAGGTGGAGAGTCCAAGG + Intergenic
1145001451 17:19307876-19307898 GCTTTCAGATAGCTGGGCCATGG - Intronic
1147521605 17:41178475-41178497 GCTTACAGGCAGATGTCACATGG - Intergenic
1149030038 17:52072333-52072355 GCATACAAGGAGGTGGTCCAGGG - Exonic
1152314126 17:79570332-79570354 GATTACAGATAGATGGTGGATGG + Intergenic
1152990436 18:358682-358704 CCTAACAGGTAACTGGTCCATGG + Intronic
1153203108 18:2666731-2666753 GCTTACAGGTAGATGATTGGGGG + Intronic
1153452516 18:5245350-5245372 GCCTACAGGTAGGTAGTCCAGGG - Intergenic
1160005188 18:75063944-75063966 GCCTTCAAGAAGATGGTCCAGGG + Exonic
1166641327 19:44497611-44497633 GCTTACAGGTAGATGGTCCAGGG - Intronic
927232899 2:20842836-20842858 GCTCAGAGGTACATAGTCCAAGG - Intergenic
928292731 2:30053838-30053860 GATTACACGTAGATTGTCCAAGG + Intergenic
930531416 2:52593231-52593253 GAATACAGGTAGTTTGTCCAAGG - Intergenic
944222346 2:197315152-197315174 TCTTAGTGGTAGATGGTACAAGG - Intergenic
948588281 2:239034879-239034901 GGTGACAGGTAGGTGGGCCAGGG - Intergenic
1169778008 20:9277060-9277082 GCTTCCAGGAACCTGGTCCAGGG - Intronic
1171756248 20:29112704-29112726 GCTGGAAGGTAGCTGGTCCATGG - Intergenic
1182891172 22:33819988-33820010 GCTTGCATGTGGATGGTCCAGGG + Intronic
956133444 3:66075771-66075793 GCTTAAAGTCAAATGGTCCAAGG - Intergenic
956209206 3:66786039-66786061 GCTTTCAGGTAGGTGGCCAATGG + Intergenic
958466090 3:94460749-94460771 GCCTACAGATACCTGGTCCATGG + Intergenic
961026896 3:123566218-123566240 GATTACGGGTAGAGAGTCCAGGG - Intronic
962411795 3:135147238-135147260 GATCACAGGTAGTTAGTCCAAGG + Intronic
970681898 4:18518376-18518398 GCTTTCAGATATATGGTCAAAGG - Intergenic
975850476 4:78566764-78566786 TCTTACATGCAGATGGTGCATGG - Intronic
975858815 4:78654321-78654343 GCTTACTGGTAAATGCTCCTGGG - Intergenic
976993263 4:91396920-91396942 GCTTCCAGGTTGAGGGTCAATGG - Intronic
988507205 5:31833883-31833905 GGGTACAGGTTGATGGGCCAAGG - Intronic
992570460 5:78050109-78050131 CCTTCCAGGTAGAGGGTCCCAGG - Intronic
997803822 5:136893117-136893139 GTTCAGAGGTACATGGTCCAGGG + Intergenic
1003956352 6:11168939-11168961 GCTTACAGATGGATGTTGCAGGG + Intergenic
1008268245 6:49459135-49459157 GCATACTGGCGGATGGTCCAGGG + Exonic
1010982514 6:82385220-82385242 GGCTCCAGATAGATGGTCCAGGG + Intergenic
1019701144 7:2475559-2475581 GCTTACAGGTCAGTGGGCCAGGG - Intronic
1029864216 7:103608476-103608498 ACTTAAAGGTAAATGGTCCGGGG + Intronic
1034344979 7:150380421-150380443 GATTCCATGTAGATGGTCCTAGG + Intronic
1047060081 8:121215505-121215527 GTTTACAAGAAGATGGTCAATGG - Intergenic
1047105773 8:121728747-121728769 GATTACAGGTAGATGCTAGAAGG - Intergenic
1049594483 8:143477117-143477139 GCTTGCAGGCAGAGGGACCAAGG - Intronic
1051149594 9:14066087-14066109 GATTAAAGGTAGATGTGCCAGGG + Intergenic
1051180464 9:14406397-14406419 ACTTACAGATAGCTGGGCCATGG + Intergenic
1057876169 9:98756112-98756134 CCTGACAGGTACAGGGTCCAGGG + Intronic
1059303627 9:113336055-113336077 GTTTACAGATAGAGGGTGCAGGG + Intronic
1060212355 9:121718291-121718313 GCGTTCAGGCAGATGGTGCAAGG + Intronic
1187240619 X:17509710-17509732 GCTTAAAGGTAGACAATCCAGGG + Intronic
1190417329 X:50192873-50192895 TTTGACAGGTGGATGGTCCAGGG + Exonic
1194214217 X:91108686-91108708 TTAAACAGGTAGATGGTCCATGG + Intergenic
1197703199 X:129615418-129615440 GGTTACAGGTAGCTTGTCTAAGG - Intergenic