ID: 1166641663

View in Genome Browser
Species Human (GRCh38)
Location 19:44499381-44499403
Sequence TGCCAGCATCGTTATGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 78}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166641663_1166641665 12 Left 1166641663 19:44499381-44499403 CCTGCTTCATAACGATGCTGGCA 0: 1
1: 0
2: 1
3: 3
4: 78
Right 1166641665 19:44499416-44499438 CTCCCCAGCTACCAATTTGATGG 0: 1
1: 0
2: 1
3: 8
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166641663 Original CRISPR TGCCAGCATCGTTATGAAGC AGG (reversed) Intronic
901069313 1:6509335-6509357 TGCCAGGAACGGGATGAAGCGGG - Intronic
902714188 1:18261165-18261187 TGCAAGCATCTTCCTGAAGCAGG - Intronic
906501624 1:46345319-46345341 TGTCAGCAGCCTTATGAAGTAGG + Intronic
913362701 1:118000055-118000077 TCCCAGCATCATTATTAAACAGG + Intronic
923532996 1:234826372-234826394 TTCCACCATCCTTATGAGGCAGG - Intergenic
924606227 1:245537988-245538010 GGCCTCCATCGTTAAGAAGCTGG + Intronic
1064231779 10:13535634-13535656 TGCCAGCATCCTGCAGAAGCTGG - Intergenic
1065874850 10:29988588-29988610 GGCTGGCACCGTTATGAAGCAGG - Intergenic
1069593138 10:69654216-69654238 TGCCAGCTTGGTCATGGAGCAGG - Intergenic
1072786878 10:98289748-98289770 TGCCTGCATAGTTATGAAATGGG + Intergenic
1073150279 10:101306626-101306648 CACCAGCATCTTTTTGAAGCTGG - Intergenic
1073534592 10:104264878-104264900 TGCCAGCATCTTTTGGATGCAGG - Intronic
1078931369 11:15914309-15914331 AGCCAGCATCATGAAGAAGCAGG - Intergenic
1087910292 11:103744644-103744666 TGCCAGCAAGGTTCTGAAGAGGG - Intergenic
1088504836 11:110517521-110517543 TCCCAGCATGGATTTGAAGCTGG + Intergenic
1089192957 11:116667868-116667890 TGCCAGCAACGGAATAAAGCTGG + Intergenic
1092506412 12:9105848-9105870 TGTTAGCATCGTAATGAAACTGG + Intronic
1096155414 12:49338986-49339008 TCCCAGCATCATTATGAGGCGGG - Intergenic
1099394583 12:82121638-82121660 TGGCAGCATGGTTGTGGAGCAGG - Intergenic
1100808393 12:98311864-98311886 TGCCAGCAACGTAACAAAGCTGG + Intergenic
1102815616 12:115863298-115863320 TGCCTGCGTCTTTATGAAGGTGG - Intergenic
1103263350 12:119608581-119608603 TGCCGCCATGGTTAAGAAGCTGG + Intronic
1112846395 13:103648456-103648478 TGCCAGCATGGTGTTGAAGGAGG - Intergenic
1112886160 13:104174799-104174821 TGGCAGCATCATTATGAAGCTGG + Intergenic
1117625356 14:57631552-57631574 TGCCTGCCTCGTTATGAGGGAGG + Intronic
1118888721 14:69888942-69888964 TGGCATCATCGTTTTTAAGCAGG - Intronic
1121789412 14:96687638-96687660 TGCCTGCATCGTTATACAGAAGG - Intergenic
1128829089 15:70750129-70750151 TTCCAGCATTGTAATGATGCAGG + Intronic
1133921994 16:10161780-10161802 TGCCAGCATCCTCCAGAAGCTGG - Intronic
1134679606 16:16114995-16115017 TGCCTGCATCGTTATCCTGCTGG + Exonic
1142364923 16:89645187-89645209 AGGCAGCATCGTCATGAAGCAGG + Exonic
1148828078 17:50409079-50409101 TGCAAGAATTGCTATGAAGCTGG + Intergenic
1149931950 17:60766213-60766235 TGCCAGCAACGTAACAAAGCAGG - Intronic
1150607586 17:66707433-66707455 AGCCAACATCTTTATGAGGCTGG + Intronic
1152127148 17:78454076-78454098 TTCCAGCACCGCTAGGAAGCAGG + Intronic
1159143572 18:64425378-64425400 TGCCAGCAACGGAATAAAGCTGG + Intergenic
1162086326 19:8251500-8251522 TGCCAGCATCTTCATAAAACAGG + Intronic
1162784080 19:13023368-13023390 TGCCAGCAACGGTCTGCAGCCGG + Intronic
1162882056 19:13667042-13667064 TGCCAGTTTAGTTATGCAGCAGG + Intergenic
1165294239 19:34913377-34913399 TGACAGCATTGTTCTGTAGCTGG + Intergenic
1166641663 19:44499381-44499403 TGCCAGCATCGTTATGAAGCAGG - Intronic
925195485 2:1920733-1920755 TGCCATCATCGTTAACAAGATGG - Intronic
935114319 2:100121383-100121405 TGCCACCATCTTTGTGAAGCAGG - Intronic
938063562 2:128269549-128269571 TGCCAGGCTCGCTATGACGCTGG + Intronic
946915333 2:224514162-224514184 TGCAATCATTGTTATGAAGGGGG + Intronic
947619321 2:231578548-231578570 TTCCAGCATCTTCATGAGGCAGG - Intergenic
1172966741 20:38840857-38840879 CCCCAACAACGTTATGAAGCGGG - Intronic
1173803809 20:45911414-45911436 TGCCAGCAGCGCTAGGAAGAGGG + Exonic
1183607485 22:38874362-38874384 TGCCAGCAACATTTGGAAGCTGG - Intergenic
949242336 3:1887855-1887877 TGCAAGCATTGTTAAGAATCTGG - Intergenic
950025736 3:9818841-9818863 TGCCCGCAACGTTCTCAAGCTGG + Exonic
951559197 3:23948664-23948686 TGCCACCATCTTAATGATGCGGG + Intronic
951793065 3:26507764-26507786 TGCCAGCATTACTATGGAGCAGG + Intergenic
954241042 3:49293798-49293820 TTCCACTATCGTTCTGAAGCTGG - Intronic
955953351 3:64263956-64263978 TGCCAGCATCCTAGAGAAGCAGG + Intronic
957368061 3:79252440-79252462 TGCCAGCATCCCTAAGAAACTGG + Intronic
962675282 3:137751812-137751834 TGCCAGCAACGGAATAAAGCTGG + Intergenic
966486504 3:180476828-180476850 TTCCAGCATGCTTATGGAGCAGG - Intergenic
967455891 3:189686298-189686320 TGCCAGCTTCAGTATGAAGGAGG - Intronic
970145120 4:13028023-13028045 TGTCACCATCTTAATGAAGCAGG + Intergenic
970275041 4:14390230-14390252 TGACAGCATCACTGTGAAGCAGG - Intergenic
975169376 4:71215513-71215535 TGCCACCCTCCTTATGAACCTGG - Intronic
977171649 4:93769383-93769405 CTCCAGCATGGCTATGAAGCAGG - Exonic
984827600 4:183940565-183940587 TGACAACATCTTTGTGAAGCTGG - Intronic
988857572 5:35244308-35244330 TGCCAGCATGGTTATGTTGTAGG + Intergenic
997002666 5:129781035-129781057 TGCCAGCCTCCCTATGTAGCTGG + Intergenic
1002117491 5:176974717-176974739 TGGGAGAATCGTTATGAACCCGG + Intronic
1003567300 6:7231633-7231655 TGCCAGCATCGAGAAGATGCTGG + Exonic
1007093993 6:39202256-39202278 TTCCAGCATCGTTCTGCAGTTGG + Intronic
1008122423 6:47633739-47633761 TGCCAGCAGCCTAAAGAAGCTGG - Intergenic
1009037881 6:58140087-58140109 TGGAAGCATAGTTATGTAGCAGG - Intergenic
1011165463 6:84441208-84441230 AGCCAGCATAGGTGTGAAGCTGG - Intergenic
1016872206 6:148829418-148829440 TGTGAGCATCATTGTGAAGCGGG + Intronic
1020379353 7:7526137-7526159 TGGCAGCCTCGTGATAAAGCAGG - Intronic
1020607082 7:10352982-10353004 TGCCAGCATCTAGATGATGCTGG + Intergenic
1021824424 7:24534100-24534122 TGCCAGTATCGGAATGATGCTGG + Intergenic
1026661341 7:72305257-72305279 CGCCGGCATCCTTGTGAAGCTGG - Intronic
1032937407 7:136748873-136748895 TTCCAGCAACCTTATGAAGTAGG - Intergenic
1034236830 7:149578823-149578845 TGCCAGCAACGGAACGAAGCTGG - Intergenic
1041634649 8:60129690-60129712 TGCCAGCAATGGAATGAAGCTGG - Intergenic
1047701469 8:127453229-127453251 TGAGGGCATCGTTATGGAGCAGG - Intergenic
1058742553 9:107958397-107958419 TTACAGCAGCGTTATGAAACAGG - Intergenic
1197143275 X:123140548-123140570 TTCCAGCATCATTATGCTGCCGG - Intergenic