ID: 1166648280

View in Genome Browser
Species Human (GRCh38)
Location 19:44549159-44549181
Sequence GGGGCTGGTGCAGCTTCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 0, 2: 7, 3: 34, 4: 304}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166648270_1166648280 7 Left 1166648270 19:44549129-44549151 CCAGAGGGGCCAAGTTCTGGGCT 0: 1
1: 0
2: 0
3: 18
4: 149
Right 1166648280 19:44549159-44549181 GGGGCTGGTGCAGCTTCTCTGGG 0: 1
1: 0
2: 7
3: 34
4: 304
1166648272_1166648280 -2 Left 1166648272 19:44549138-44549160 CCAAGTTCTGGGCTTCCACCGGG 0: 1
1: 0
2: 1
3: 5
4: 163
Right 1166648280 19:44549159-44549181 GGGGCTGGTGCAGCTTCTCTGGG 0: 1
1: 0
2: 7
3: 34
4: 304

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166648280 Original CRISPR GGGGCTGGTGCAGCTTCTCT GGG Intergenic
900243756 1:1628563-1628585 GGGGCTGGTGCCGCTACTGGTGG + Exonic
900343431 1:2199378-2199400 TGGGCTGGGGAAGCTTCTCCGGG - Intronic
901058918 1:6462720-6462742 GGTGCTGGTACAGCTCCTCTAGG + Intronic
901082877 1:6593361-6593383 GGGGCTAGTGCAGCTCATCGGGG + Exonic
901153598 1:7121097-7121119 GTGGTTGATGCAGCTTCTCTTGG - Intronic
901738283 1:11326024-11326046 GGGGTTGGTGATCCTTCTCTTGG + Intergenic
902599193 1:17529647-17529669 GGGGCTGGGGCAGGCTATCTGGG + Intergenic
902675399 1:18005210-18005232 GGGGCAGAGGCAGCTTCCCTGGG + Intergenic
903241269 1:21984202-21984224 GGGCCTCCTGCAGCTTGTCTGGG - Exonic
903244775 1:22007386-22007408 GGGCCTGCTGCAGCTTGTCTGGG - Exonic
903276504 1:22225414-22225436 TTGTCTGGTGCAGCTTCTTTTGG - Intergenic
903302490 1:22389434-22389456 GGGGCTGGAGCCGCTTCTCTGGG + Intergenic
903554071 1:24180658-24180680 GGGGCTGGAGGGGCTTCTCTGGG - Intronic
904094529 1:27966720-27966742 GTGGCTGGTACTGCTGCTCTGGG + Exonic
904433294 1:30478954-30478976 GGGGATGGAGGGGCTTCTCTGGG + Intergenic
904797539 1:33068524-33068546 GGTGCTGGTGCAGGTCCTCCTGG + Intronic
905294380 1:36944995-36945017 ATGGCTGGGGCAGCCTCTCTAGG - Intronic
905631043 1:39518719-39518741 GGGGATGGGGGAGCTTCTCCAGG + Intronic
905666717 1:39767457-39767479 GGGGATGGGGGAGCTTCTCCAGG - Intronic
907311001 1:53538958-53538980 GGGGCTGAGTCAGCTTCTCTTGG + Intronic
908483682 1:64569503-64569525 GGGACTGGTACTGCTTCTTTAGG + Intronic
912433177 1:109640463-109640485 TGGGCTGGGGCACCCTCTCTAGG + Intergenic
915247988 1:154569487-154569509 GCGGCTGGTGGAGCATCTCCTGG + Exonic
915592902 1:156880625-156880647 GGGGTGGGGGCAGCTGCTCTGGG - Intronic
915599195 1:156912197-156912219 GGGGCAGGTACAGCTTTTCCTGG - Intronic
915914933 1:159935197-159935219 GGGGCTGCTGCAGCATCTTGAGG - Intronic
916658150 1:166896302-166896324 GGTGCTGGTGCTGCTGCTGTTGG + Intergenic
920187042 1:204166242-204166264 GGGACTGCTGCTGCTGCTCTGGG - Exonic
920653006 1:207852721-207852743 GGTGCTGGGCCTGCTTCTCTTGG - Intergenic
920695331 1:208177738-208177760 GGGGCAGATGCTGCTGCTCTGGG - Intronic
921440705 1:215182553-215182575 GCTGCTGCTGCAGTTTCTCTTGG - Intronic
921505589 1:215965121-215965143 GTGGCTGTTGCTGCTGCTCTGGG + Intronic
922769235 1:228173237-228173259 GGGGCTGGGCCACCTGCTCTTGG + Intronic
922825236 1:228513090-228513112 AGAGCTGCTGCAGCTTCCCTGGG + Intergenic
923145064 1:231191982-231192004 GGAGCTGATGCAGCTTTCCTGGG + Intronic
923808649 1:237288476-237288498 GGTCCTGCTGCAGCTGCTCTCGG + Intronic
924302325 1:242652164-242652186 GGTCCTGCTGCAGCTGCTCTGGG + Intergenic
1063753018 10:8973596-8973618 GTGGCTGGAGCTGCCTCTCTGGG + Intergenic
1064784069 10:18874885-18874907 GAGGCTGTTGCAGTTTCTTTAGG - Intergenic
1065025490 10:21535450-21535472 GGGGCTGCTGCAGCGCCTGTGGG + Intronic
1066502278 10:36005901-36005923 GGGGCTGGTGAAGCATTTCCTGG + Intergenic
1068778542 10:60894261-60894283 TGGTCTGGTGCAGCTTTTCTTGG - Intronic
1069615592 10:69804136-69804158 GGTGGAGGTGCAGCATCTCTGGG + Intronic
1070955282 10:80459612-80459634 GGGGCTAGTGAACCTTCTCTGGG + Intronic
1073292754 10:102421456-102421478 GTCGCTGGTGCAGCTTCACCTGG + Exonic
1073618690 10:105024624-105024646 GGGGCTGTTGGAGCCTCCCTTGG - Intronic
1073739948 10:106394879-106394901 AGGGCTGGTGCTGCTGGTCTGGG + Intergenic
1075779021 10:125005129-125005151 AGGGCTGGTGCAGGTGCTCTGGG - Intronic
1075786669 10:125054443-125054465 GGGGAGGGTTCAGCTTCTCATGG - Intronic
1076603717 10:131676050-131676072 GGGGCAGGAGCAGCTCCTGTTGG + Intergenic
1077046569 11:549307-549329 GGGGCAGGTGCAGGGTCCCTGGG + Intronic
1077370658 11:2180255-2180277 GGGGCTGGTCCAGATGCCCTAGG + Intergenic
1077445614 11:2589261-2589283 GGGCCTGGTGCTGCTCCTCCAGG - Intronic
1077916011 11:6612011-6612033 GGGGCTGGAGCAGCTGCTGGGGG - Exonic
1079501676 11:21107695-21107717 GCTTCTGGAGCAGCTTCTCTTGG - Intronic
1079630314 11:22666822-22666844 TGGGCTCCTGCAGCTTCTCGGGG - Exonic
1079735691 11:23994275-23994297 GGGGCTAGAGCAGCTGCACTAGG - Intergenic
1081649734 11:44815758-44815780 TGGGCAGGGGCAGCTTCTCTTGG + Intronic
1081992732 11:47346491-47346513 GGGGCAGCTGGAGCTGCTCTGGG + Intronic
1082894319 11:58173895-58173917 GGTCCAGGTGCAGCTTCCCTTGG - Intronic
1083121078 11:60512246-60512268 GGCCTTGCTGCAGCTTCTCTGGG - Intergenic
1083752003 11:64766071-64766093 GCGGCTGCCGCAGCTTCTCCAGG - Intronic
1084405568 11:68970919-68970941 GGGGCAAATGCAGCTTCTGTGGG + Intergenic
1084881515 11:72174781-72174803 GGGGCTGGTGTGGCTTTTCCAGG - Intergenic
1088624997 11:111723730-111723752 GGGGCTGAAGCTGCATCTCTTGG - Exonic
1088810335 11:113387723-113387745 GGGGCAGGAGCGGCTCCTCTTGG + Intergenic
1089518435 11:119048352-119048374 CGGGCTGGTACAGCTTGTCCTGG + Exonic
1089735901 11:120550134-120550156 GAGGCTGGTGCAGCGTCACAGGG + Intronic
1091789051 12:3260823-3260845 GGGGCTGATGCCTCTACTCTGGG - Intronic
1093948375 12:25135830-25135852 GGGGTTGCTGCGGCTGCTCTAGG - Intronic
1094107884 12:26833021-26833043 GCGGCGGCTGCGGCTTCTCTGGG - Exonic
1097677851 12:62622374-62622396 GGTGCTGGTGCTGCTGCTCCTGG - Intergenic
1098250319 12:68562377-68562399 TGGACTGGTTCAGCTGCTCTAGG + Intergenic
1098956774 12:76696356-76696378 GGGGGTGGTGCATGTCCTCTAGG + Intergenic
1100374126 12:93996537-93996559 AGGGCTTGTGCACATTCTCTGGG + Intergenic
1103896976 12:124279474-124279496 GGGGCTGGTGCAGCATCCAGCGG + Intronic
1104094798 12:125547224-125547246 GGAAATGGTGCAGCTACTCTGGG - Intronic
1104666342 12:130649883-130649905 GGAGGTGGGGCAGCTTCTCCAGG - Intronic
1106555089 13:30802679-30802701 GGGGTTGGTCCCGCTTCTCAGGG + Intergenic
1107781848 13:43912163-43912185 AGGGCTGGGGCAGGTTCTCTGGG - Intergenic
1108528073 13:51302712-51302734 CGGGCTGGTGTAGCTGCTCAAGG - Intergenic
1108577420 13:51802288-51802310 GATGCTGATGCAGCTTGTCTGGG - Intronic
1109397988 13:61785733-61785755 GGTCCTGCTGCAGCTTCTCATGG - Intergenic
1111151206 13:84255616-84255638 GGGGTTGGTTCCGCCTCTCTGGG - Intergenic
1112206655 13:97330393-97330415 GGGACTGGTGCAGCTTCTGTGGG - Intronic
1113231701 13:108218792-108218814 GGGGCTAGTGCGGCTTCCCCTGG + Intronic
1113531646 13:111031926-111031948 GGGGCTGGTGCCGCATCCCATGG + Intergenic
1113566480 13:111322525-111322547 GAGGCTGGTGCCACTTCTCAGGG + Intronic
1113814354 13:113161257-113161279 GCGGCTGGAGGAGCTGCTCTGGG - Intronic
1113896723 13:113769205-113769227 GGGGATGGTACAGCTGCACTGGG + Intronic
1114182195 14:20376540-20376562 GGGTCTGGAGCAGCTGCTGTGGG - Intronic
1114673517 14:24427295-24427317 GGTGCTGGTTCAGCTTCTGACGG + Exonic
1115801959 14:37004691-37004713 GGAGCAGGTTCAGCGTCTCTGGG + Intronic
1118073777 14:62276274-62276296 GGGGCTTTTGCCGCTTCTCTGGG - Intergenic
1118778356 14:68988731-68988753 GTGGCTGGTCCAGCCTCTCAGGG + Intergenic
1119131114 14:72174046-72174068 GGGGCTGAAGCTGCTTCTCCAGG - Intronic
1120613329 14:86670385-86670407 CTGCCTGGTGCATCTTCTCTGGG + Intergenic
1121080061 14:91100662-91100684 GAGGCTGGTGCTGCTGGTCTGGG - Intronic
1121645543 14:95515492-95515514 GGGCCTGTTTCTGCTTCTCTTGG + Intergenic
1121867069 14:97372475-97372497 GAAGCTGGTGCACCTTCTCCAGG - Intergenic
1122630767 14:103106815-103106837 GGGGCTTCTCCAGCTCCTCTTGG - Exonic
1122858490 14:104571613-104571635 GGGGCTGCTGCAGCCTCTGCTGG - Intronic
1123553296 15:21401790-21401812 GTGGCTGGTCCAACTGCTCTAGG + Intergenic
1123589542 15:21839178-21839200 GTGGCTGGTCCAACTGCTCTAGG + Intergenic
1123933096 15:25181317-25181339 GGGGGTGGTGCTGTTTCCCTAGG + Intergenic
1123944279 15:25231482-25231504 GGGGGTGGTGCAGTTTCAATGGG + Intergenic
1125594906 15:40878587-40878609 TGGGCTGGGGCAGCTTCCCTGGG - Intergenic
1126483710 15:49155741-49155763 GGGGGTGGTGCAGTCTCTTTTGG - Intronic
1127764980 15:62176625-62176647 GGGGCTGGTGTTGCTTCTTTTGG - Intergenic
1128310609 15:66629860-66629882 GGGGGTGGTGGAGCTGCTCCGGG + Intronic
1128522941 15:68387392-68387414 GGTGCTGGTGCTGCTGGTCTGGG - Intronic
1129228705 15:74184647-74184669 CGGGCAGGTGCAGCTTCCCCAGG + Intronic
1129274034 15:74433804-74433826 GCGGCTGCTGCTGCTGCTCTGGG - Exonic
1129697638 15:77749663-77749685 GTGGCGGGAGCAGCTTCACTGGG - Intronic
1130861456 15:87894517-87894539 GGGGTTGGTGAAACTTCCCTTGG + Intronic
1131091861 15:89629540-89629562 GCTGCTGGTGCTGCTCCTCTCGG + Exonic
1202961645 15_KI270727v1_random:129010-129032 GTGGCTGGTCCAACTGCTCTAGG + Intergenic
1132497438 16:270576-270598 GGGGCTGGCGCAGCCCCTCCAGG + Exonic
1132559883 16:588876-588898 GGGGATGGTCCTGCCTCTCTCGG - Intergenic
1132605670 16:792787-792809 GAGGCTGGTGCAGCGGCTCCAGG + Exonic
1132983596 16:2752127-2752149 GGGTCTGAGGCGGCTTCTCTCGG + Intergenic
1133128761 16:3663573-3663595 GGGTCTGATGGAGCTGCTCTTGG - Exonic
1133913415 16:10086566-10086588 TGGTATGGTGCAGCTTCTCCTGG - Intronic
1133942883 16:10325199-10325221 GGGGGTGGTGCAGGGCCTCTGGG + Intergenic
1135509963 16:23073907-23073929 GTGGCTGGTGCAGCCTCCCCTGG - Intronic
1135856961 16:26020595-26020617 GATGCTGGTGCTGCTGCTCTGGG + Intronic
1137706947 16:50542168-50542190 GGGGTTGGAGCAGCTTCTTGGGG - Intergenic
1137767505 16:50989391-50989413 CTGGCTGGGGCAGCTTGTCTTGG + Intergenic
1138657923 16:58501372-58501394 GGGGCTGTGGCGGCTCCTCTCGG - Intronic
1141620912 16:85236046-85236068 GGGGCTGGTGCCGCCCCTCCCGG + Intergenic
1142130012 16:88428102-88428124 GGGGCTGGTGCCCCTGCTCTGGG - Exonic
1142286655 16:89174198-89174220 GCGGCTGGAGCATCTTCCCTGGG - Intronic
1142379690 16:89724231-89724253 TGGGCTGGTGCAGCTGCTCCTGG + Intronic
1142772346 17:2107601-2107623 TGGGCTGGGGCAGCTCCTCTGGG + Intronic
1142929028 17:3266697-3266719 GGGTCTGGTGCAGCTGCAGTTGG - Intergenic
1143767892 17:9149636-9149658 GGGGCTGGTGCAGCCTTCCAGGG - Intronic
1144021368 17:11241821-11241843 GGCGCTGGTCCAGCTTCTCGTGG - Exonic
1144359736 17:14480629-14480651 TGAGCTGGGTCAGCTTCTCTGGG + Intergenic
1145846586 17:28043180-28043202 GGGGCTGCTGCAGCTGGTCCAGG - Exonic
1145909230 17:28533059-28533081 GGACCTGGTGCAGCCTTTCTTGG - Intronic
1147038168 17:37697426-37697448 GGGGCTGGTGCAGCGTCTCAGGG + Intronic
1147133075 17:38420172-38420194 GGGACTGGTCCAGCCTGTCTGGG - Intergenic
1147254889 17:39175564-39175586 GGGGCTGGCCCAGCTCCCCTGGG + Exonic
1147363107 17:39943812-39943834 TGGGCTGGGGCCTCTTCTCTGGG - Intronic
1147675104 17:42199879-42199901 GGTGCTGGTGAAGCATCTCTGGG + Exonic
1147978349 17:44260420-44260442 GGGCCCGGAGCAGCTCCTCTCGG + Exonic
1148048563 17:44758604-44758626 GGGGCTGGGGCAGCCTCTCTGGG + Intergenic
1148211955 17:45813947-45813969 GTGGCCGGTGCAGGTCCTCTAGG + Intronic
1149292420 17:55230182-55230204 GGGGCTGGTGCAGATTAAATAGG - Intergenic
1149450303 17:56744937-56744959 TGGGCTGGTGCAGCATGTCCAGG + Intergenic
1149543937 17:57489270-57489292 GGGTCTGATGGAGCTTCTCAAGG + Intronic
1149948585 17:60959546-60959568 GCTGTTGGTACAGCTTCTCTGGG + Intronic
1150143681 17:62750712-62750734 GATGCTGGTGCCGCTTCCCTTGG - Intronic
1150471062 17:65438213-65438235 GGGGCTGGGGTCGCTTCTCATGG - Intergenic
1152015809 17:77749562-77749584 GGGGCTGGAGCTCCTTCTCCTGG - Intergenic
1153313767 18:3702470-3702492 GGGTCTGTTGCTGCCTCTCTTGG - Intronic
1153778699 18:8476058-8476080 GGGGCTGGAGCATGTTCTCTGGG + Intergenic
1154453983 18:14503907-14503929 GTGGCTGGTCCAACTGCTCTAGG + Intergenic
1157806253 18:50659917-50659939 TGGTGTGGTGCAGCTTCTCAGGG - Intronic
1159021324 18:63145394-63145416 GGGGGTGGGGGGGCTTCTCTGGG + Intronic
1160143494 18:76346834-76346856 GGGGCTGGTGCAGCCACTGGAGG + Intergenic
1160438188 18:78867236-78867258 GGACCAGGTGCAGCTCCTCTTGG - Intergenic
1160505074 18:79422521-79422543 GGGGCCGCTGCATCTTCTCGTGG - Intronic
1160514621 18:79471580-79471602 GGGCCGGGAGCAGCTTCTCCTGG - Intronic
1162030004 19:7913249-7913271 TGGGCTGGGGCTGCTGCTCTGGG + Exonic
1162439999 19:10686963-10686985 GGGGTGGCTGCTGCTTCTCTGGG + Intronic
1163323368 19:16587445-16587467 GGGGCTGGTGCAGGTCCACCAGG + Intronic
1166648280 19:44549159-44549181 GGGGCTGGTGCAGCTTCTCTGGG + Intergenic
1167443625 19:49524745-49524767 GGGGCTGGCGCAGCCCCTCAGGG + Exonic
1167522076 19:49961030-49961052 GGGGCAGCAGCAGCATCTCTGGG + Exonic
1167523306 19:49969695-49969717 GGGGCAGCAGCAGCATCTCTGGG - Intergenic
1167854295 19:52225744-52225766 GGTCCTGGGTCAGCTTCTCTAGG - Exonic
925293023 2:2761128-2761150 GGAGCTGGTGCAGTTTGTCTGGG + Intergenic
925421206 2:3713389-3713411 GGGGCTGGGGGAGCTTCCATAGG + Intronic
925751245 2:7091771-7091793 AGGGCTGGTGAAGGTTCTCGGGG - Intergenic
926599778 2:14830008-14830030 GAGGCTGGTCCAGTTTCACTTGG + Intergenic
927059630 2:19404155-19404177 AGGGGTGGTGCAGGTTCACTAGG + Intergenic
928100667 2:28435706-28435728 GGTGCTGGTGGAGCTTTTCTGGG + Intergenic
928254806 2:29712911-29712933 GGGGCTGGATCAGCTTCTTAGGG + Intronic
928283726 2:29971027-29971049 GGGGCTGTTGCAACTCCACTAGG + Intergenic
929810129 2:45182730-45182752 GGCCCTGGTGCCGCTTCTCCGGG - Intergenic
931386257 2:61800408-61800430 CAGGCTGCTGCAGCTGCTCTAGG + Intergenic
931906553 2:66849381-66849403 GGGGCTGCTGCTCCTTCTCTTGG - Intergenic
932467919 2:71935212-71935234 GTGGCTGCTGCTGCCTCTCTGGG + Intergenic
932749352 2:74361519-74361541 GAAGCTGGTGCAGCTGCTCCTGG + Exonic
933121348 2:78542001-78542023 GGACCTGCTGCAGCTGCTCTCGG - Intergenic
934494748 2:94787649-94787671 GTGGCTGGTCCACCTGCTCTTGG + Intergenic
934843482 2:97646263-97646285 GCGGCTCGTGCAGCTTCTCGAGG + Intronic
935156815 2:100490655-100490677 GGGGCTGGTACATCTCTTCTAGG - Intergenic
935181014 2:100691340-100691362 GGGGCTGCTGCTGCTACTCAAGG + Intergenic
937235411 2:120429066-120429088 GGAGCTGGTGCAACTTCTCTGGG - Intergenic
937439600 2:121904807-121904829 GGGGCTGGTTCAGCTTGGCAAGG + Intergenic
937777167 2:125791816-125791838 GGGGCTGCTGCTGTTACTCTGGG + Intergenic
937941765 2:127291600-127291622 AGGACTCCTGCAGCTTCTCTGGG + Intronic
938061476 2:128258443-128258465 GGGGCTGTGGCAGCTGGTCTTGG + Intronic
938280660 2:130061545-130061567 GTGGCTGGTGCAGCGGCTCCTGG - Intergenic
938281284 2:130065339-130065361 GTGGCTGGTGCAGCGGCTCCTGG - Intergenic
938281389 2:130065979-130066001 GTGGCTGGTGCAGCGGCTCCTGG - Intergenic
938332146 2:130455451-130455473 GTGGCTGGTGCAGCGGCTCCTGG - Intergenic
938357660 2:130665217-130665239 GTGGCTGGTGCAGCGGCTCCTGG + Intergenic
940635412 2:156292780-156292802 AGGGCTGATGCAGCTTGTATAGG + Intergenic
940721299 2:157285335-157285357 GGGGCAGGTCCAGATTCTGTGGG + Intronic
944402575 2:199345117-199345139 GGGGCTGGTGCTGCTGCTGCTGG + Intronic
945260136 2:207835481-207835503 GGGGCCGGGGGAGCTACTCTGGG + Intronic
945622986 2:212165724-212165746 AGGGCTGGTGCAGTTGCTCATGG - Intronic
946435127 2:219646346-219646368 GGAGCTCATGCAGCTTTTCTAGG + Intergenic
947831722 2:233146251-233146273 GGGGCTCCTGCGGCTTCTCTTGG + Intronic
947871317 2:233440466-233440488 GGGGGTGACACAGCTTCTCTGGG + Intronic
948217981 2:236245741-236245763 GGGGCTGCTGCTTCCTCTCTGGG + Intronic
948866359 2:240776829-240776851 TGAGCTGGTGGAGCTTCTCCTGG - Intronic
1168909745 20:1438322-1438344 GTGGCCGGTGCAGATGCTCTGGG + Intergenic
1171178262 20:23071416-23071438 AGGGCTGCTGCAGCTGCTTTCGG - Intergenic
1173533243 20:43787015-43787037 GGGGTTGGTCCATGTTCTCTGGG + Intergenic
1174624272 20:51901376-51901398 GGAGCAGGGGCAGCTTATCTAGG - Intergenic
1175769082 20:61611565-61611587 GGGGCTGGAGCTGCACCTCTGGG + Intronic
1175960614 20:62634608-62634630 AGGGGTGGGTCAGCTTCTCTGGG + Intergenic
1176145885 20:63565287-63565309 GGTGCTGGTGCAGCTCCTTTCGG - Exonic
1176241616 20:64078230-64078252 GGGGCAGGTGCAGCATCCCCTGG + Intronic
1176820188 21:13649389-13649411 GTGGCTGGTCCAACTGCTCTAGG - Intergenic
1179123117 21:38567079-38567101 GGGGATTGTGCAGCATGTCTGGG + Intronic
1180077048 21:45468261-45468283 GGGGCTGCTGCAGCTCCTTGGGG + Exonic
1180157453 21:45984446-45984468 GGGGCTGGAGCAGCTCCTCGTGG + Exonic
1180889156 22:19272962-19272984 GGGGCTCGTGAAGCAGCTCTCGG - Intronic
1181013091 22:20053638-20053660 GGGGCTGTGGCAGCCTCTCCAGG + Intronic
1181996997 22:26891063-26891085 GGGGATGGTGCACCCTCTCCAGG + Intergenic
1182552434 22:31107460-31107482 GGCGCTGCTGCTGCTTCTCGCGG - Exonic
1183807007 22:40220107-40220129 GGTGGGGGTGGAGCTTCTCTAGG + Intronic
1184287604 22:43480401-43480423 TGTGCTGGTGCAGTGTCTCTGGG + Intronic
1184581901 22:45423626-45423648 GTGTCTGGTCCAGCCTCTCTGGG - Intronic
1184681782 22:46076079-46076101 GTGGCTGGTGTGGCTGCTCTGGG - Intronic
1184864938 22:47197128-47197150 GGGGCAGGAGCAGCCTCTCTGGG + Intergenic
1185319720 22:50195010-50195032 CGGCCTGCTGCAGCTTCTCCAGG - Exonic
951466413 3:23004733-23004755 GGGGCTTTTGCATCTACTCTGGG - Intergenic
951844618 3:27072270-27072292 GGTGCTGATGCTGCTTGTCTGGG - Intergenic
953036917 3:39220189-39220211 GAAGATGGTGCAGTTTCTCTAGG + Intergenic
954403210 3:50330323-50330345 AGGCCTGGAGCAGCTTCTCAGGG + Exonic
954684756 3:52364460-52364482 TGGGCAGGTGCACCTTCTTTGGG - Intronic
956167022 3:66404936-66404958 GCGGCTGGTGGAGCTTCTCTTGG - Intronic
957512286 3:81204433-81204455 GATGCTGTTGCAGCTGCTCTGGG + Intergenic
960022390 3:112969808-112969830 GTTGCTGTTGCAGGTTCTCTTGG - Intronic
960516544 3:118608309-118608331 GGGTCTGCTGCAGCTCCTGTGGG - Intergenic
960536973 3:118825534-118825556 GATGCTGGTGCTGCTTGTCTGGG - Intergenic
960672514 3:120166974-120166996 GGCCTTGGTACAGCTTCTCTTGG + Exonic
961026270 3:123560657-123560679 GGGGCTGGCGCAGCTTCTACTGG - Intronic
961365998 3:126399814-126399836 GAGGCTGGTACAGCTGCTCCAGG - Intronic
961437286 3:126928098-126928120 GGAGCTGCTGCAGCCTCCCTGGG - Intronic
961469955 3:127105383-127105405 GGGGCTGGGGCAGCCTCCATTGG - Intergenic
962897566 3:139729994-139730016 GCTGCTGGTGCTGCTTGTCTGGG + Intergenic
968547944 4:1208115-1208137 AGGGCTCATGCAGCTGCTCTTGG + Intronic
968758381 4:2428294-2428316 GGAGCTGCTGGAGCTGCTCTTGG - Intronic
969522405 4:7686344-7686366 GTGGCTGGTGCTGCATCTCCCGG + Intronic
975001043 4:69223687-69223709 GGGGGTGGTGGATGTTCTCTAGG + Intergenic
976005276 4:80422745-80422767 GGGGATGAGGCAGCTTCTCAAGG + Intronic
978741365 4:112141935-112141957 GTGGCTGGTGCAGTTGCTATGGG - Intergenic
981713657 4:147732498-147732520 GCGGCTGGGGGAGCCTCTCTCGG + Intronic
982247942 4:153373351-153373373 GGGGCTGATTCAGCATTTCTTGG + Intronic
983547638 4:168979728-168979750 GGGGGTGGGGCAGCTGCTCTGGG - Intronic
984234288 4:177137340-177137362 GGGGTTGTTGCAGCTGCTGTGGG - Intergenic
986167775 5:5290711-5290733 TGGGCTTCAGCAGCTTCTCTTGG + Intronic
986652778 5:9980721-9980743 AGGGCTGGTGCAAATGCTCTGGG - Intergenic
988501688 5:31789126-31789148 GGGGCTGGTATAGCTGCTCAAGG + Intronic
990629401 5:57651424-57651446 GGGCATTCTGCAGCTTCTCTAGG + Intergenic
991443032 5:66671234-66671256 AGGGCTGGTGCAGTTGCTCTAGG + Intronic
991674109 5:69075196-69075218 GGGACAGGTGCAGCTCCTCCAGG - Intergenic
992898653 5:81270438-81270460 GGGGTTGCTGCAGCTGCTGTGGG - Intergenic
998040345 5:138947410-138947432 GATACTGCTGCAGCTTCTCTGGG + Exonic
999838927 5:155403334-155403356 GGGCCTGCTGCAGCTGCTGTGGG - Intergenic
1000157273 5:158564069-158564091 GGGGCAGATGCAGCTCCTCTAGG - Intergenic
1001255000 5:170176798-170176820 GATTCTGGTGCAGCATCTCTCGG - Intergenic
1001702989 5:173721012-173721034 GCTGCTGCTGGAGCTTCTCTGGG - Intergenic
1002343367 5:178531513-178531535 GGGGCTGGTGTATCTGCTCAGGG - Intronic
1002441071 5:179264822-179264844 GGGGCTGGGTGAGCTGCTCTGGG + Intronic
1002721761 5:181265603-181265625 GGGGCTGGAGCTGGTTTTCTCGG + Intergenic
1002874617 6:1200347-1200369 GGGGCTGGTCATGCTTCTCCAGG - Intergenic
1003874779 6:10425923-10425945 GGGGCTGCTGCAGCTCCCCGAGG - Intergenic
1004628561 6:17399638-17399660 GGGGCTAGTGCACCTTCTGCAGG - Intronic
1004978687 6:20997680-20997702 GAGGGTGGTGCAGTTTCTCTTGG - Intronic
1006275769 6:33004681-33004703 GGGGCAGCTCTAGCTTCTCTGGG + Exonic
1006389103 6:33748183-33748205 TGGTCTGGTTCAGCCTCTCTCGG + Intergenic
1006791234 6:36702645-36702667 GGGGCTTGTGCAGGTTCTGCAGG - Intronic
1006883305 6:37358211-37358233 GGGGCTGGAGCAGCTAGTGTTGG + Intronic
1006915208 6:37589519-37589541 GGGGCTGGGACAGATGCTCTGGG + Intergenic
1007948998 6:45853000-45853022 GGGGCTGGGGCAGAATATCTAGG - Intergenic
1008752952 6:54758524-54758546 CAGGCTGGTGCAGAGTCTCTGGG - Intergenic
1014632271 6:123802817-123802839 GAGGCTGGTGCATCTCCACTAGG + Intergenic
1016746505 6:147586186-147586208 AGTGCTGCTGCTGCTTCTCTTGG + Intronic
1017275984 6:152569094-152569116 GGTGCTGATGCTGCTGCTCTGGG - Intronic
1018471184 6:164099781-164099803 GGTGCTGGTCCAGATACTCTGGG + Intergenic
1018612673 6:165660838-165660860 GGGGCGGGTGCGGCTTCCCGCGG - Intronic
1019554255 7:1620814-1620836 GGGGCAGGTGCAGCATCGCTGGG - Intergenic
1019648814 7:2145173-2145195 GTGCCTGGTGCAGCAGCTCTCGG - Intronic
1020040388 7:4996826-4996848 GTGGCTGGTACTGCTGCTCTGGG + Intronic
1020088474 7:5324160-5324182 GGGGCTGCTGGAGCCTCCCTTGG - Intronic
1021972202 7:25976538-25976560 AGAGCTGGTGCAGCTGCTCAAGG + Intergenic
1024342376 7:48280543-48280565 GGGACAGCTGCAGCATCTCTGGG - Intronic
1025233169 7:57216534-57216556 GGAGCTGGTGCTGCTGTTCTAGG + Intergenic
1029704831 7:102270709-102270731 GGCGCTGCTGCAGATGCTCTGGG - Intronic
1030060263 7:105615941-105615963 GGTGCTGCTGCTGCTACTCTGGG + Intronic
1031450781 7:121915285-121915307 GGGTCTGGTGGAGGTCCTCTTGG + Intronic
1033816723 7:145082792-145082814 GGGCCTGCTGCAGCTGCTGTGGG + Intergenic
1034267000 7:149785887-149785909 GGGGTTGGTGCCTCTCCTCTTGG + Intergenic
1034407277 7:150913425-150913447 GGGGCTGGGGCAGCTTCTCATGG + Intergenic
1035373005 7:158391342-158391364 GGGCCTGGTGCAGCTTGGCCAGG - Intronic
1035985893 8:4431536-4431558 GGGGCTGGTGTAGATTATCAGGG - Intronic
1037965377 8:23129887-23129909 GGAGCAGGTGCAGCTTCTGCTGG - Intergenic
1038697558 8:29819609-29819631 GGGGCTGGGGGAGCTGCTCACGG - Intergenic
1039387788 8:37151737-37151759 GTGGCTGCTGCAGCTCCTCACGG + Intergenic
1040886478 8:52268881-52268903 GGGGGAAGTGCAGCTACTCTTGG + Intronic
1041221519 8:55656362-55656384 GGTGAAGGTACAGCTTCTCTTGG - Intergenic
1041868664 8:62607391-62607413 AAGGCTGATGCACCTTCTCTTGG + Intronic
1042095961 8:65216327-65216349 GGTGCTGCTGCTGCTCCTCTGGG - Intergenic
1045929494 8:107605448-107605470 GGGGGTGGTGGAGGTCCTCTAGG + Intergenic
1045937255 8:107695036-107695058 GGTGCTGCTTCATCTTCTCTAGG - Intergenic
1047343993 8:124009710-124009732 GGAGCTGGTGCTGCTGTTCTAGG + Intronic
1049244033 8:141551928-141551950 GGGGCTGGCGCTGCGTCTCCTGG - Intergenic
1049310352 8:141930891-141930913 GGGGCTGGTGCAGCCCAGCTGGG - Intergenic
1049614675 8:143570918-143570940 GGTGCTGGTGCAACTGCTGTGGG - Exonic
1049674462 8:143883508-143883530 GAGGCTGGTGGAGCTGCTCATGG - Intergenic
1049711126 8:144063838-144063860 GCGGCTGGTGCAGCTCATCCAGG - Intergenic
1049796351 8:144498933-144498955 GGAGCTGCTGCACCATCTCTCGG - Exonic
1050319645 9:4438413-4438435 CGGGGTGGGGAAGCTTCTCTGGG - Intergenic
1051243056 9:15080526-15080548 TGGGCTGTTCCTGCTTCTCTTGG + Intergenic
1052218342 9:25992684-25992706 GGGCCTGCTGCAGCTGCTGTGGG - Intergenic
1053345694 9:37376764-37376786 GGGGCTGGTACAGGGTCTGTGGG + Intergenic
1056143460 9:83707266-83707288 CGGGCTGATGCCGCTTTTCTCGG - Intronic
1056319215 9:85420825-85420847 CGAGCTGGTGCAGCTTCCCAGGG + Intergenic
1056493267 9:87129210-87129232 AGGGCTGGTGCTGCTGATCTGGG - Intergenic
1056792616 9:89635852-89635874 TGGGCTTCTGGAGCTTCTCTGGG - Intergenic
1060729926 9:126030801-126030823 AGGGCTGGTGCAGCCTCTTTGGG + Intergenic
1061138559 9:128750850-128750872 GGGGCTGGAACAGGCTCTCTGGG + Intronic
1061208524 9:129177665-129177687 GGTGCTGGTGCAGCTGCTGCTGG + Exonic
1061895504 9:133644776-133644798 GGAGCTGGGGCAGCTGCTGTTGG + Intronic
1062109207 9:134772876-134772898 GGGGCGGGTCCAGGTGCTCTGGG + Intronic
1062165737 9:135106417-135106439 GGTGCTGGAGCAGCACCTCTAGG - Intronic
1062402332 9:136378097-136378119 GGCGCAGGGGCAGCTTCTCCAGG + Exonic
1062694445 9:137866291-137866313 GGGGCTCGGGCTGCTTCCCTGGG - Intronic
1203527172 Un_GL000213v1:100162-100184 GTGGCTGGTCCAACTGCTCTAGG + Intergenic
1187246291 X:17555506-17555528 GGGGCTGATGCTGCTGGTCTGGG + Intronic
1189367252 X:40398230-40398252 GGGGTTGGGGCAGCCTCCCTTGG + Intergenic
1191123260 X:56927398-56927420 GCTGTTGCTGCAGCTTCTCTAGG - Intergenic
1192921618 X:75713123-75713145 GGGCTTGTTGCAGCTGCTCTGGG + Intergenic
1193399132 X:81021339-81021361 GGAGGTAGTGCAGCTGCTCTGGG + Intergenic
1196299392 X:114037257-114037279 GGGGCTGGACCAGCTTGACTTGG + Intergenic
1197785159 X:130191158-130191180 GGGGCTGCTCCAGCTATTCTGGG - Intergenic
1197902911 X:131392877-131392899 GGGGCTGCTCCAGCTATTCTGGG - Intronic
1198628024 X:138601527-138601549 AGGGCTGGTACAGCTACTCAAGG - Intergenic