ID: 1166654223

View in Genome Browser
Species Human (GRCh38)
Location 19:44598524-44598546
Sequence AGTTATGTACTGAAGATGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166654223_1166654227 -8 Left 1166654223 19:44598524-44598546 CCTGTCATCTTCAGTACATAACT No data
Right 1166654227 19:44598539-44598561 ACATAACTTGGGGTCCAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166654223 Original CRISPR AGTTATGTACTGAAGATGAC AGG (reversed) Intergenic
No off target data available for this crispr