ID: 1166654227

View in Genome Browser
Species Human (GRCh38)
Location 19:44598539-44598561
Sequence ACATAACTTGGGGTCCAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166654221_1166654227 12 Left 1166654221 19:44598504-44598526 CCTCCTTCAATTATTACTGGCCT No data
Right 1166654227 19:44598539-44598561 ACATAACTTGGGGTCCAAGATGG No data
1166654223_1166654227 -8 Left 1166654223 19:44598524-44598546 CCTGTCATCTTCAGTACATAACT No data
Right 1166654227 19:44598539-44598561 ACATAACTTGGGGTCCAAGATGG No data
1166654219_1166654227 25 Left 1166654219 19:44598491-44598513 CCTGGGGACACAGCCTCCTTCAA No data
Right 1166654227 19:44598539-44598561 ACATAACTTGGGGTCCAAGATGG No data
1166654222_1166654227 9 Left 1166654222 19:44598507-44598529 CCTTCAATTATTACTGGCCTGTC No data
Right 1166654227 19:44598539-44598561 ACATAACTTGGGGTCCAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166654227 Original CRISPR ACATAACTTGGGGTCCAAGA TGG Intergenic
No off target data available for this crispr