ID: 1166656484

View in Genome Browser
Species Human (GRCh38)
Location 19:44615724-44615746
Sequence CTGGAAGGAGGAAAGGGACG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 845
Summary {0: 1, 1: 0, 2: 6, 3: 67, 4: 771}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166656472_1166656484 26 Left 1166656472 19:44615675-44615697 CCACCTAGTTCAAAGCTTTGCTC 0: 1
1: 0
2: 1
3: 11
4: 132
Right 1166656484 19:44615724-44615746 CTGGAAGGAGGAAAGGGACGTGG 0: 1
1: 0
2: 6
3: 67
4: 771
1166656473_1166656484 23 Left 1166656473 19:44615678-44615700 CCTAGTTCAAAGCTTTGCTCTGT 0: 1
1: 0
2: 1
3: 46
4: 306
Right 1166656484 19:44615724-44615746 CTGGAAGGAGGAAAGGGACGTGG 0: 1
1: 0
2: 6
3: 67
4: 771
1166656476_1166656484 0 Left 1166656476 19:44615701-44615723 CCCCAGCTCAGGCAGGTGTCACA 0: 1
1: 0
2: 1
3: 23
4: 234
Right 1166656484 19:44615724-44615746 CTGGAAGGAGGAAAGGGACGTGG 0: 1
1: 0
2: 6
3: 67
4: 771
1166656477_1166656484 -1 Left 1166656477 19:44615702-44615724 CCCAGCTCAGGCAGGTGTCACAC 0: 1
1: 0
2: 0
3: 19
4: 179
Right 1166656484 19:44615724-44615746 CTGGAAGGAGGAAAGGGACGTGG 0: 1
1: 0
2: 6
3: 67
4: 771
1166656478_1166656484 -2 Left 1166656478 19:44615703-44615725 CCAGCTCAGGCAGGTGTCACACT 0: 1
1: 0
2: 0
3: 21
4: 200
Right 1166656484 19:44615724-44615746 CTGGAAGGAGGAAAGGGACGTGG 0: 1
1: 0
2: 6
3: 67
4: 771

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166656484 Original CRISPR CTGGAAGGAGGAAAGGGACG TGG Intronic
900145594 1:1157569-1157591 CAGGAAGGGGGAAGGCGACGAGG + Intergenic
900524646 1:3122645-3122667 CTGGAAGGAGGGCAGGGCTGCGG - Intronic
900747610 1:4371860-4371882 CTGGAAGGAGGAAGGGTGCAGGG - Intergenic
901628388 1:10636200-10636222 CAGGAAGGAGGAAGGAGCCGAGG + Intergenic
901668925 1:10842827-10842849 CTGGGAGGAGGGTAGAGACGAGG - Intergenic
902104377 1:14021540-14021562 GTGGAAGGAGGAGAGGGTCTAGG + Intergenic
902359765 1:15935990-15936012 CAGGAAGGGGGACAGGGACAGGG - Exonic
903161994 1:21495632-21495654 CTTGAAGCAGGAGAGGTACGGGG + Intergenic
903170820 1:21552110-21552132 GGGGAGGGAGGAAAGGGAAGGGG - Intronic
903294321 1:22333947-22333969 CTGGAGGGATGAAAGGGTGGTGG + Intergenic
903294672 1:22336178-22336200 CTGGAGGGATGAAAGGGTGGTGG - Intergenic
903331659 1:22599906-22599928 AGGGAAGGAGAGAAGGGACGAGG + Intronic
903378617 1:22881991-22882013 CTGGTGGGAGGAATGGGAGGCGG + Intronic
903935218 1:26890640-26890662 CAGAAAGGGGGAAAGGGACCTGG - Exonic
904033823 1:27548837-27548859 CTGGAAGGAGGAGGAGGAGGAGG + Exonic
904310612 1:29627113-29627135 GTGGAGGGTGGAAAGGGAGGTGG - Intergenic
904336473 1:29801492-29801514 AGGGAAGGAGGGAAGGGAGGAGG - Intergenic
904490260 1:30854226-30854248 ATGGTAGGGGAAAAGGGACGGGG + Intergenic
904557986 1:31377870-31377892 CTGGAAGGAGGAAAGGAGAAAGG - Intergenic
904755810 1:32767976-32767998 CTGGAGGGAGGAGAGGGGAGGGG - Intronic
904832975 1:33316966-33316988 CTGTAAGGAGGACAGAGATGGGG + Intronic
904904215 1:33882801-33882823 ATGGAAGGAAGAAAGGAAAGGGG - Intronic
905097744 1:35488696-35488718 CAGGAAGAAGGAAAAGGACCAGG + Intronic
905127573 1:35726333-35726355 CAAGAAGGAGGAAAGGGTCTGGG - Intronic
905162881 1:36052393-36052415 CTAGAGGCAGGAAAGGGAGGGGG + Intronic
905396506 1:37669894-37669916 GAGGAAGGAAGAAAGGGAGGAGG - Intergenic
905914983 1:41678495-41678517 CTGGGAAGAGGAAATGGACAAGG - Intronic
905923423 1:41733729-41733751 CTGGAAAGAGGAAAGGGATGTGG + Intronic
905969110 1:42127455-42127477 CGGGAAGGGGGAGAGGAACGTGG + Intergenic
907074129 1:51563663-51563685 CTGGAAGGAGGCTATGGATGGGG - Intergenic
907160123 1:52363596-52363618 CTGGAAGGAGGGGAGGAAGGGGG - Intronic
907237707 1:53062979-53063001 CTGGAGGGAGGAAGGGGTGGGGG + Intronic
907433647 1:54430106-54430128 CTGGAAGGAGGAAGGAGGTGGGG + Intergenic
907801674 1:57772201-57772223 GTGGAGGGAGGAAAGGCAGGAGG - Intronic
908372653 1:63498848-63498870 GTGGAAGGAAGGAAGGGATGGGG + Intronic
908459713 1:64337666-64337688 CTGGAAGGTGGAAACAGATGGGG - Intergenic
909614722 1:77593561-77593583 CTGGGAAGAGGAAAGGGGCAAGG + Intronic
909656412 1:78038410-78038432 ATGGAAAGAGGAAAAGGAGGTGG - Intronic
909932639 1:81515196-81515218 CTGGGAGGAGGAAAGGCAAGAGG + Intronic
910117567 1:83749195-83749217 GTGGAAGGTGGAAAGGCAAGAGG + Intergenic
910571026 1:88703070-88703092 AAGGAAGGAGAAAAGGGACAAGG - Intronic
911873459 1:103128964-103128986 GTGGAAGGAGGAAGGGGATCAGG + Intergenic
912398457 1:109367787-109367809 CTGTAAGGAGAAAAGGGAAGAGG - Intronic
912567660 1:110599832-110599854 CTGGAAGGAAGGAAGGGTCATGG + Intronic
912634190 1:111276229-111276251 CTAGAAGGAAGAAAGAGAAGAGG - Intergenic
912933668 1:113984916-113984938 CTGGATGGTGGAGAGGGACAGGG + Intergenic
913170214 1:116225254-116225276 CTGGAAGGAAGAAGGGGGCCTGG - Intergenic
914345412 1:146794550-146794572 CTGGGAGGGGGAAGGGGAGGAGG + Intergenic
915131618 1:153699039-153699061 CTGGGAGCAGGCATGGGACGTGG - Intergenic
915249042 1:154575739-154575761 CTGGATGGAGGAGACGGAGGAGG - Intronic
915282632 1:154833073-154833095 CTGGAGGGAGGAAAGGGGGAAGG - Intronic
915463062 1:156081281-156081303 CTGGAAGAGGGAAAGGGGAGGGG - Intronic
915993926 1:160545450-160545472 CAGGAAGGAGGAAAGAGGCTTGG - Intronic
916415591 1:164589212-164589234 CTGGAAGGAGGAGGGGGGCGCGG + Intronic
917149551 1:171929520-171929542 CAGTAAGGAGGAAGGGGACTGGG + Intronic
917647286 1:177041593-177041615 AAGAAAGGAGGAAAGGAACGTGG - Intronic
917737892 1:177937141-177937163 GAGGAAGCAGGAAAGGGAGGTGG - Intronic
918028215 1:180774989-180775011 CAGAAAGGATGAAAGGGACTAGG + Intronic
918201610 1:182272544-182272566 CTGGAAGGAGGCAAGAGGAGAGG + Intergenic
918326219 1:183413227-183413249 CTGGAAGATGTAAAGGGAGGAGG + Intronic
918356302 1:183708853-183708875 GTGGAAGGACACAAGGGACGCGG + Intronic
918972627 1:191439539-191439561 AAGGAAGGAGGAAAGGAAGGAGG - Intergenic
919505916 1:198397488-198397510 ATGGAAGGAGGAAAGGAAGGAGG - Intergenic
919518293 1:198554932-198554954 AGGGAAGGAGGAAAGGAAGGAGG - Intergenic
919999881 1:202789583-202789605 AGGAAAGGAGGAAAGGGAAGGGG + Intronic
920299179 1:204977957-204977979 GTGGATGGAGGCAAGGGATGGGG - Intronic
920341061 1:205275469-205275491 ATGGAGGGAGGGAAGGGAGGAGG + Intergenic
920369631 1:205470100-205470122 CTGAAGGGAGGAGAGGGAGGTGG - Intergenic
920654894 1:207867906-207867928 CTGGTAGGAGGACAGAGAGGAGG - Intergenic
920658740 1:207897435-207897457 AGGGATGGAGGAAAGGGACAGGG + Intronic
920888933 1:209963391-209963413 TTGGAAGGAGGGTAGGGAAGAGG + Intronic
921434303 1:215099635-215099657 CAGGACAGAGGAAAGGGAGGGGG + Intronic
921594123 1:217036674-217036696 TTGGGAGGAGGAAAAGGACCAGG + Intronic
921692483 1:218165711-218165733 CGGGAAGGAGGAAATAGACGGGG + Intergenic
921756669 1:218864688-218864710 AAGGAAGGAAGAAAGGGAAGGGG - Intergenic
921833949 1:219759079-219759101 AAGGAAGGAAGAAAGGGAGGAGG + Intronic
922081975 1:222306196-222306218 CTTGAAGGGGGAAAGGGAAAAGG + Intergenic
923008133 1:230067861-230067883 GTGACAGGGGGAAAGGGACGAGG - Intronic
923121832 1:230999166-230999188 CTGGTAGGAGGCAGGGGACCTGG - Intronic
923205105 1:231751623-231751645 CTGGAAGAGGGGAAGGGATGGGG - Intronic
923461608 1:234214112-234214134 CTGGGAGGAAGACAGGGATGAGG + Intronic
923684064 1:236142199-236142221 CGGGAAGGGGGGAAGAGACGCGG + Intergenic
923703170 1:236319091-236319113 CTGAAAGGGGGAAAGGTAAGGGG + Intergenic
1063105351 10:2987367-2987389 AAGGAAGGAGGGAAGGGAGGAGG - Intergenic
1063208431 10:3856415-3856437 CTGGAGGGAGGAAAGGTTGGAGG - Intergenic
1063485545 10:6417167-6417189 GTGGGAGGAGGAGAGGGTCGAGG + Intergenic
1063578585 10:7284311-7284333 TGGGAGGGAGGAAAGGGAAGGGG - Intronic
1063618349 10:7621953-7621975 CACGAAGGAGGAAAGAGACATGG - Intronic
1064550284 10:16493666-16493688 ATGGAAGGAAGAAAGGGAAAGGG + Intronic
1064750315 10:18521840-18521862 ATGGGAGGAGGAAAGGAATGTGG - Intronic
1065284061 10:24170282-24170304 CTGAAAGGAGGAGAGGAAGGTGG + Intronic
1065497283 10:26342101-26342123 AAGGAAGGAGGGAAGGGATGAGG + Intergenic
1065761570 10:28987756-28987778 GGAGAAGGAGGAAAGGGAAGAGG - Intergenic
1065853868 10:29814137-29814159 AGGGAAGGAGGAAAGAGAAGGGG - Intergenic
1065967041 10:30779024-30779046 AGGGAAGGAGGAAGGGGAGGAGG + Intergenic
1066517632 10:36181466-36181488 CTGCAAGGAGGAAGGGGAAAAGG + Intergenic
1067059461 10:43070524-43070546 CAGGAGGGAGGAAAGGAAGGTGG + Intergenic
1067110591 10:43397053-43397075 CTGAAGGGAGGGAAGGGAAGAGG + Intronic
1067321231 10:45223110-45223132 CTGGAGGGAGGAAAGCCATGGGG + Intergenic
1068203888 10:53822369-53822391 ATAGAAGGAGGAGAGGGAGGAGG + Exonic
1068573877 10:58661389-58661411 CTGGAAGGAGAAAAGGTAGAGGG + Intronic
1069498665 10:68930031-68930053 AAGGAAGGAAGAAAGGGACCAGG - Intronic
1069568602 10:69480253-69480275 CAGGAAGGAGGAATGGGAACAGG + Intronic
1069896567 10:71683762-71683784 GGGGAAGGAGGACAGGGACCAGG + Intronic
1070784523 10:79155318-79155340 CTGGAACTGGGAAAGGGAGGGGG - Intronic
1071333050 10:84580162-84580184 CTGGAAAGAGGAGATGGAGGAGG - Intergenic
1071826726 10:89332833-89332855 CTGGGAGCTGGGAAGGGACGGGG + Intronic
1071892010 10:90019591-90019613 CTTGCAGGCGGAAAGGGAAGAGG + Intergenic
1072161485 10:92771208-92771230 AAGGAAGGAGGAGAGGGAAGGGG - Intergenic
1072701463 10:97644661-97644683 TTGGAAGAAGGAAAGGGAGAGGG + Intronic
1072945160 10:99803441-99803463 AGGGAAGGAGGAAAGGGAGAAGG - Intronic
1073276471 10:102315828-102315850 CTGGAAAGCAGAAAGGGACAAGG - Intronic
1073348508 10:102802087-102802109 GTGGAAGGAGGAGGGGGAAGGGG - Intronic
1073563861 10:104519086-104519108 CTGGAAGGAGCAGAGGGAAGAGG - Intergenic
1074134956 10:110618144-110618166 CTGGAAGGAGGAGGAGGAGGAGG + Intergenic
1074164107 10:110859575-110859597 CTGGCAGGAGGCAAGGGAAGTGG + Intergenic
1074791222 10:116889514-116889536 GTGGAAGGTGGAAAGGGACTAGG + Intronic
1075284695 10:121173113-121173135 GTGGAAGGAGGGAGGGGACAAGG + Intergenic
1075566717 10:123510397-123510419 TTGGAAGGAGGAGAGGAAGGCGG - Intergenic
1076001491 10:126916673-126916695 AAGGAAGGAGGAAAGGAAGGAGG - Intronic
1076191326 10:128485497-128485519 CTGGGAGGAGGAGAGGGAAGAGG + Intergenic
1076508341 10:130993757-130993779 CTGGGGGGAGGCAAGGAACGGGG - Intergenic
1077464679 11:2728078-2728100 CTGGAAGGAGCTGAAGGACGAGG - Intronic
1077482144 11:2820792-2820814 CTAGCAGGAGGGAAGGGAGGCGG - Intronic
1077497979 11:2895919-2895941 CTGGGTGGGGGAAAGGGACTGGG + Intronic
1078210220 11:9264788-9264810 CTGGAGGGGGGAAACGGATGAGG - Intronic
1078254491 11:9646309-9646331 GTGGAAGGAAGAAAGGAAAGAGG + Intergenic
1078492631 11:11783587-11783609 CTGGAGGGAGCAAAGAGAAGAGG - Intergenic
1078953906 11:16167811-16167833 AGGGAAGGAGGAAAGGGAATGGG - Intronic
1079284714 11:19117791-19117813 TAGGATGGAGGAAAGGGGCGTGG + Intronic
1079288701 11:19165795-19165817 ATGGAAGGAGGAAAGATACTGGG + Intronic
1079288716 11:19165945-19165967 ATGGAAGGAAGAAAGAGACAGGG + Intronic
1079430684 11:20386437-20386459 AGGAAAGGAAGAAAGGGACGTGG + Intergenic
1080641320 11:34160181-34160203 GAGGAAGCAGGAAAGGGAAGAGG + Intronic
1080652048 11:34230514-34230536 CTGGAACAAGGACATGGACGGGG + Intronic
1081397292 11:42601741-42601763 CTGGTAGGAGAAAAGGAAAGGGG - Intergenic
1081693146 11:45092043-45092065 CTGGGAGGAGTCCAGGGACGGGG - Intergenic
1082833828 11:57638399-57638421 GTGGAAGGAGAAAGGGGGCGAGG + Intergenic
1083172973 11:60933930-60933952 AGGGAAGGAGGAGAGGGATGCGG - Intronic
1083292032 11:61695816-61695838 CTGGAAGGAGGGCAGGGGCAGGG + Intronic
1083475098 11:62910260-62910282 CTGGAAGGAAGAAGAGGAAGAGG - Exonic
1084106098 11:66981588-66981610 CTGGAAGGAATAAAGTTACGCGG + Intergenic
1084288806 11:68148552-68148574 TTGGAAGGAGGAGAGGCCCGGGG + Intergenic
1084290500 11:68162619-68162641 TTGGAAGGAGGGATGGGATGGGG - Intronic
1084463583 11:69309425-69309447 CTGGAAGCAGGAGAGGGACCTGG + Intronic
1084488623 11:69465576-69465598 CTGGAAGGAGGGCAGGAGCGGGG - Intergenic
1085289845 11:75390125-75390147 CTGGAGGGTGGAAAGGGAGTGGG - Intergenic
1086103171 11:83122616-83122638 TTTGAAGGAGGTAAGGGACATGG - Intergenic
1086369632 11:86143481-86143503 GTGGAAGGAGGAAAGGCGCCTGG - Intergenic
1086380198 11:86244825-86244847 TTGGAAGGAGGAAGGGGGTGAGG + Exonic
1086518767 11:87646107-87646129 GGGGAAGGGGGAAAGGGAAGGGG - Intergenic
1086525380 11:87719399-87719421 CAGGGAGGAGGTAAGGGAGGAGG - Intergenic
1089210043 11:116793806-116793828 CAGGAAGGAGGAAAAGGAGAAGG + Intergenic
1089256463 11:117196848-117196870 CTGGAAAGAAGGAAGGGAAGGGG - Exonic
1089625036 11:119745807-119745829 CTGCAAGGATGAAGGGGAGGTGG + Intergenic
1089728731 11:120506604-120506626 CTGGATGGAGGCAGGGGAAGGGG - Intergenic
1089982955 11:122787643-122787665 CTGGAAGGAAGGATGTGACGTGG + Intronic
1090044018 11:123315336-123315358 CTGAAAGGAGGGAGGGGAGGAGG - Intergenic
1090191918 11:124777223-124777245 TTGGAAGGGTGAAAGGGACATGG - Intronic
1091481711 12:839217-839239 TTGGAAGTAGGAAAAGGACAAGG + Intronic
1092055617 12:5505999-5506021 CAGGAAGAAGGAAATGGATGTGG - Intronic
1093171113 12:15861838-15861860 CTGGAAGAAGGAAAGGGCATTGG - Intronic
1094530974 12:31274483-31274505 CTGGAAGGGGGAAGGTGACAAGG + Intergenic
1095431998 12:42144537-42144559 CTGGAAGAAGGAACGGGCGGCGG - Exonic
1096593945 12:52682263-52682285 CTGGGAGGAGAAGAGGGACAAGG - Intergenic
1096661788 12:53129903-53129925 ATGGTAGGAGGAGAGGGAAGAGG - Intergenic
1096847716 12:54417339-54417361 AGGGAAGGAGGAAGGGGATGAGG - Intronic
1096961382 12:55581629-55581651 CTGGAGGGTGGAGAGGGAGGAGG - Intergenic
1096961754 12:55585970-55585992 TTGGAAGGAGTAGAGGGACATGG - Intergenic
1097106744 12:56630255-56630277 CGGGAAGGGGGAGGGGGACGCGG + Intronic
1097987494 12:65799352-65799374 ATGGAAGGAGGAAAGGAAAAAGG - Intergenic
1098450201 12:70610391-70610413 GTGGAGGGAGGAAAGGGGCGGGG - Intronic
1099652475 12:85445804-85445826 CTGCAAGAAGGAAAGAGACAAGG + Intergenic
1100137097 12:91566953-91566975 AGGGAAGGAGGGAAGGGAGGTGG - Intergenic
1100324725 12:93530232-93530254 AGGAAAGGAGGAAAGGGAAGGGG - Intergenic
1101155673 12:101925428-101925450 CTGGAATGAGGAAAGGGGAGTGG + Intronic
1101246330 12:102887222-102887244 GTGGAAGTAGGGAAGGAACGAGG + Intronic
1101400327 12:104381725-104381747 CTGGAGGGAGGGAAGGCATGTGG - Intergenic
1101519522 12:105468581-105468603 CAGGAAGGAGGAAGAGGACAGGG - Intergenic
1102051476 12:109865222-109865244 CTGGAGGGAGGGAAGGGACTTGG + Intronic
1102530117 12:113540115-113540137 CTGGGATCAGGAAAGGGATGAGG + Intergenic
1102553717 12:113711822-113711844 CTGAAGGAAGGAAAGGGAGGAGG - Intergenic
1102679563 12:114682344-114682366 CTGGAGGGCAGAAAGGGCCGGGG + Intronic
1102723258 12:115035820-115035842 CTGGAGGGAGGGAAGGAAGGGGG - Intergenic
1102992027 12:117322417-117322439 CAGGAGTGAGGAAAGGGAGGAGG - Intronic
1103005636 12:117418104-117418126 GAGGAAGGAGGAAGGGGAGGAGG + Intronic
1103581465 12:121918626-121918648 CTGGAAGGAGGCCCGGGAGGTGG + Exonic
1103775628 12:123364667-123364689 GTGGAAGGAGAAAAGGGCCAAGG + Intronic
1103941916 12:124505920-124505942 CTGGAAGCAGGAGCAGGACGTGG - Intronic
1104085948 12:125474296-125474318 GTGGAAAAAGGAAAGGGAAGAGG - Intronic
1104554042 12:129783971-129783993 CTGGAAGAGGGAACGGGATGGGG - Intronic
1104933768 12:132353812-132353834 TTGGAAGGAGGGAAGAGTCGGGG + Intergenic
1105519914 13:21122741-21122763 CTGGCAGGGGGCAGGGGACGGGG - Intergenic
1105801814 13:23911357-23911379 CAGGAAGGAGAAAAAGGAGGAGG + Intergenic
1106022664 13:25930026-25930048 GTGCAAGGAGCAAAGGCACGTGG - Intronic
1106289885 13:28350880-28350902 AAGGAAGGAAGAAAGGGAGGAGG - Intronic
1106819390 13:33446356-33446378 CTAGAAGGAGGGAAGAGACAGGG + Intergenic
1107346717 13:39469391-39469413 CTTGAAGGAGGAAAGGAACCAGG - Intronic
1107832403 13:44385945-44385967 CGGGAAGGATGAAAGGCATGTGG - Intronic
1107837452 13:44423262-44423284 TTGGAGGGAGTAAAGGGAGGAGG + Intergenic
1108197503 13:48009649-48009671 CTGGAAGGAGTAAAGGAGAGGGG + Intergenic
1108485267 13:50917221-50917243 CTGGAAGAAGGAAAGGGTACAGG + Intronic
1108769501 13:53681226-53681248 CAGGAAGGAAGAAAGGGCAGGGG - Intergenic
1109166642 13:59043325-59043347 ATGGAAGGAGGAAAGGGTGTGGG - Intergenic
1109347762 13:61136472-61136494 GAGGAAGGAGGAAAGGGAAGAGG + Intergenic
1110534206 13:76632004-76632026 GTGGAGGCAGGAAAGGGACCAGG - Intergenic
1110555950 13:76859145-76859167 AGGGGAGGAGGAAAGGGAAGGGG + Intergenic
1110583077 13:77155386-77155408 TTTGAAGGAGGAAAGGGCTGGGG + Intronic
1112216039 13:97433136-97433158 GTTGAAGGAGTAAAGGCACGTGG + Intergenic
1112250445 13:97774469-97774491 ATGGAAGAAGGAGAGGGAGGGGG - Intergenic
1112326127 13:98443842-98443864 CTGGGAGGAGGGAAGGGACGGGG + Intronic
1112339346 13:98539728-98539750 CTGGAGGGAGCAAAATGACGTGG + Intronic
1112535342 13:100248335-100248357 GTGGAGGGAGGAATGGGAAGGGG - Intronic
1112541015 13:100313134-100313156 ATGGAGGGAGGAAAGGAAAGAGG - Intronic
1113080379 13:106513616-106513638 CAAGAAAGAGGAAAGGGAGGAGG - Intronic
1113487793 13:110667533-110667555 CTGGAAGGAATAAATAGACGAGG - Intronic
1113902233 13:113803783-113803805 CTGGAAGGTGGGAAGGGGCAGGG - Intronic
1114276862 14:21154605-21154627 AAGGAAGGAAGAAAGGGAGGTGG + Intergenic
1114453072 14:22838852-22838874 CTGGGGGGAGGAGAGGGATGGGG + Intronic
1114627051 14:24136628-24136650 CTGCAAGTAGGACAGGGATGGGG - Intronic
1115655452 14:35439291-35439313 TTTGAATGAGGAAAGGGAGGAGG - Intergenic
1115959940 14:38824364-38824386 CTAGAAGGGAGAAAGGGAGGAGG - Intergenic
1117294296 14:54365007-54365029 CTGAAAGGGGCAAAGGGATGTGG + Intergenic
1117369386 14:55062852-55062874 CCGGAAGGAGGAAAGGGTGCTGG - Exonic
1117459340 14:55929244-55929266 GAGGAAGGAGAAAAGGGAAGGGG + Intergenic
1117943693 14:60995602-60995624 AAGGAAGGAAGAAAGGGAGGAGG + Intronic
1118593517 14:67419124-67419146 ATGGAAGGAGGCGAGGGAAGGGG - Intergenic
1118706544 14:68485489-68485511 GTGGAAGGAGGAAAGGTAGCTGG - Intronic
1119768979 14:77208498-77208520 CTGAAGGGAGGAGAGGGAGGAGG - Intronic
1119890616 14:78179455-78179477 CTGGGTGGAGGAAAGGGAATTGG + Intergenic
1120327643 14:83050672-83050694 GTGGAAGGCAGAAAGGGAAGGGG - Intergenic
1121447457 14:93988000-93988022 CTGGAAGGAGGAGTGAGAGGAGG + Intergenic
1122090181 14:99333506-99333528 CTGGAAGGAGCAGAGGGTCATGG + Intergenic
1122322257 14:100862133-100862155 AAGGAAGGAGGAAAAGGAAGAGG - Intergenic
1122647931 14:103207384-103207406 GGGGAAGGAGGAAGGGGAAGGGG - Intergenic
1122741111 14:103872075-103872097 CTGGACTCAGGAAAGGGAAGAGG - Intergenic
1123146418 14:106135050-106135072 GTGGAAGGAGATAAGGAACGTGG - Intergenic
1202844587 14_GL000009v2_random:156483-156505 CTGGAACTGGGAAAGGGACTTGG + Intergenic
1202913977 14_GL000194v1_random:146727-146749 CTGGAACTGGGAAAGGGACTTGG + Intergenic
1202878683 14_KI270722v1_random:35977-35999 CTGGAACTGGGAAAGGGACTTGG - Intergenic
1124826426 15:33100496-33100518 TTTAAAGGAGGAAAGGGAGGAGG + Intronic
1125605750 15:40938812-40938834 CTTGAGGGAGGAAAGGGCCCAGG - Exonic
1126110326 15:45171391-45171413 CTGGAAGGAGGGCAGGGCAGTGG - Intronic
1126532200 15:49723367-49723389 GTAGAAAGAGGAAAGGGAGGAGG + Intergenic
1127064860 15:55226378-55226400 CTGCAAGGAGCAAAGGGAAAGGG + Intronic
1128462619 15:67882745-67882767 CTGGAAGGAAGGAAGGGAAGGGG - Intergenic
1128510001 15:68307540-68307562 CTGGAAGGAAGAAGGGAAAGGGG - Intronic
1128582997 15:68821411-68821433 CTGGAAGGAGGAGAGGGGTCAGG + Intronic
1128721144 15:69949332-69949354 CTGTAATGAGGAAAAGGAGGAGG - Intergenic
1128875669 15:71199226-71199248 CTGAAAGGAGGAAAGGGATGGGG - Intronic
1129044882 15:72725772-72725794 AGGGAAGGAGGAAGGGGAAGAGG - Intronic
1129360068 15:75019073-75019095 AGGGAAGGAGAAAAGGGAAGGGG - Exonic
1130159744 15:81386629-81386651 CTTGAAGGAGGAAAGGGAGCAGG - Intergenic
1130359004 15:83163300-83163322 TGGGAAGGAGGAAAGAGAAGAGG - Intronic
1130395155 15:83494965-83494987 CTGGAAGGGGGAGAGGGAGGAGG - Intronic
1130460204 15:84154581-84154603 GTAGAAGGAAGAAAGGGACCAGG - Intergenic
1130551256 15:84891176-84891198 CTGGAAGGAGGGCAGGAAAGAGG + Intronic
1130951739 15:88596233-88596255 AGGGAAGGAGGGAAGGGAAGAGG - Intergenic
1131106670 15:89739441-89739463 GTGGAAAGAGGAAGGGGAAGAGG - Intronic
1131978110 15:97966065-97966087 AGGGAAGGAGGAAAAGGAGGAGG - Intronic
1132724862 16:1334176-1334198 GCGGGAGGAGGGAAGGGACGAGG - Intronic
1132977532 16:2718041-2718063 TTGGAAGGAGCAAGGGGTCGGGG - Intronic
1133001994 16:2856476-2856498 ATGGAGGGAGGGATGGGACGGGG - Intronic
1133045663 16:3087099-3087121 CAGGAAGGAGGAAGGGGAAATGG + Intergenic
1133404773 16:5514739-5514761 AGGGAAGGAGGAAGGGGAAGAGG + Intergenic
1134038682 16:11051448-11051470 TTGGAAGGAGGAAGGGGCCGGGG - Intronic
1134042571 16:11079848-11079870 CTGGAGGCAGCAAAGGGAAGGGG - Intronic
1134197796 16:12172274-12172296 AAGGGAGGAGGAAAGGGGCGAGG + Intronic
1134310495 16:13071627-13071649 CAGGAAGGAGGGAAGGAAGGAGG - Intronic
1134692067 16:16197615-16197637 GGGGAAGGAGGAAAAGGAAGGGG + Intronic
1135464960 16:22677137-22677159 CTTGAAGGAGGAAAGGGCCCAGG + Intergenic
1135580535 16:23622332-23622354 GTGGAACGAGGAAAGGGTCTAGG + Intronic
1136045196 16:27609913-27609935 CTTGAAGGAGGAAAGGAATGTGG + Intronic
1136065160 16:27753770-27753792 AAGGAAGGAGGAAAGGAAGGAGG - Intronic
1136183751 16:28572911-28572933 CTGAATGGAGGAAAGTGACACGG - Intronic
1136399001 16:30007686-30007708 CTGCATGCAGGAAAAGGACGGGG - Intronic
1136692646 16:32046459-32046481 GTGGAAGGAGATAAGGAACGTGG + Intergenic
1136793143 16:32989685-32989707 GTGGAAGGAGATAAGGAACGTGG + Intergenic
1137410418 16:48223338-48223360 CTGGAAGGAGGAAGAAGATGAGG - Intronic
1137414874 16:48266515-48266537 AGGCAAGGAGGAAAGGGGCGGGG - Intronic
1137792201 16:51184788-51184810 TTGGGAGGAGGAAAAGGAAGAGG + Intergenic
1139469550 16:67170760-67170782 GTGGAGGGAGGTAAGGGGCGGGG + Intronic
1139988575 16:70920713-70920735 CTGGGAGGGGGAAGGGGAGGAGG - Exonic
1140025886 16:71289659-71289681 GGGGAGGGAGGGAAGGGACGGGG + Intronic
1140031099 16:71339975-71339997 TAGGAAGGAGGAAAGGGCCCCGG + Intergenic
1140846261 16:78891314-78891336 CAGAAAGGAGGGAAGGGAGGAGG - Intronic
1140938365 16:79697243-79697265 TAGGAAGGAGGAAAGGGGAGGGG - Intergenic
1141164320 16:81650371-81650393 CTGGAAGGAGGAAAGAAAGGTGG + Intronic
1141610264 16:85177166-85177188 CTGGAAGCAGGAGGGGGAAGGGG + Intronic
1141803062 16:86323992-86324014 CAGGATGGAGGGAAGGGAAGGGG + Intergenic
1141890303 16:86922074-86922096 GGGGAAGGAGGAAGGGGAAGGGG + Intergenic
1142264490 16:89057525-89057547 CTGGGAGGAGGACAGGAAGGAGG - Intergenic
1142264518 16:89057615-89057637 CTGGGAGGAGGACAGGAAGGAGG - Intergenic
1203095399 16_KI270728v1_random:1251376-1251398 GTGGAAGGAGATAAGGAACGTGG + Intergenic
1142476672 17:193126-193148 CAGGAAGGAGGAAGGGGTCCAGG + Intergenic
1142955018 17:3515733-3515755 CTGGCAGATGGAAAGTGACGTGG - Intronic
1142973337 17:3627981-3628003 CAGGAGGGAGGAAGGGGAGGAGG + Intronic
1143140240 17:4738536-4738558 CTGGAATGAGGAAGGAGCCGGGG - Intronic
1143593001 17:7896987-7897009 CCGGCAGGAGGAATGGGACAGGG - Intronic
1143595639 17:7912062-7912084 CTGGGAGGGAGGAAGGGACGAGG + Exonic
1143732440 17:8888692-8888714 CTGGGAGGATGCAAGGGACAAGG + Exonic
1143821434 17:9567162-9567184 CTGGAAGGAGGAAGAGGATTAGG + Intronic
1143903292 17:10190613-10190635 AAGGAAGAAGGGAAGGGACGAGG + Intronic
1144101403 17:11945179-11945201 CTGGCAGGGGGAAGGGGAAGAGG + Intronic
1144483374 17:15645524-15645546 GTGGAAGTAGGAAAGTGACAGGG - Intronic
1144512994 17:15893506-15893528 CAGGGAGGAAGAAAGGGAGGAGG - Intergenic
1144738615 17:17568836-17568858 CTGGGAGGAGGAAGAGGAGGAGG - Intronic
1144798247 17:17907113-17907135 CAGGGAGGAGGGGAGGGACGAGG + Intronic
1144915313 17:18719502-18719524 TTGGAAGTAGGAAAGTGACAGGG + Intronic
1146058114 17:29591090-29591112 CGGGAAGGGGGTAAGGGGCGGGG + Intronic
1146178763 17:30684009-30684031 CTATAGGGAGGAAAGGGATGGGG + Intergenic
1146397421 17:32479907-32479929 CTGCAGGGAGGAATGGGACGGGG + Intronic
1146584180 17:34068229-34068251 ATGGAAGGAAGAAAAGGACAGGG + Intronic
1147257007 17:39187448-39187470 CTGGAGGGAGGGCAGGGAAGTGG - Intronic
1147314351 17:39612464-39612486 GGGGGAGGAGGAAAGGGAGGGGG + Intergenic
1147530194 17:41269070-41269092 ATGGAAGGAAGAAAGGAAGGAGG + Intergenic
1147565421 17:41533313-41533335 AGGGAAGGAGGAAAGGAAGGAGG + Intergenic
1147686754 17:42290505-42290527 GTGGAAGCAGGAAAGGGGTGTGG + Intronic
1147840592 17:43368931-43368953 CGGGAAGGAGGAGAGGGGCCTGG + Intergenic
1148464562 17:47857222-47857244 CTGGAAGGTGGGGAGGGACAGGG - Intergenic
1148768479 17:50053315-50053337 CTGGGAGCCGGAAAGGGATGAGG - Intergenic
1148966921 17:51443425-51443447 CTGTAAGGAGAAAAGGGAGGTGG + Intergenic
1149757532 17:59199929-59199951 AGGGCAGGAGCAAAGGGACGAGG + Intronic
1150293249 17:63993489-63993511 AGGGAAGGAGGAAAGGAAGGAGG + Intergenic
1150338637 17:64348087-64348109 CTGGAAGGAGCAAAGGCCCCTGG - Intronic
1150832844 17:68539756-68539778 CTCGAAGGAGACAAGGCACGTGG + Intronic
1150943343 17:69717470-69717492 CTGGAAGCAGGAGAGAGAGGTGG - Intergenic
1151280740 17:73072332-73072354 GAGGAAGGGGGAAAGGGATGGGG + Intronic
1151482792 17:74380114-74380136 CTGGAAGGAGCAGTGGGAAGTGG - Intergenic
1152104927 17:78323280-78323302 CTGGAGGGAGGAAACAGACCAGG + Intergenic
1152190745 17:78885836-78885858 CTGGGTGGAGGCATGGGACGGGG + Intronic
1152432106 17:80254213-80254235 ATGGGAGGAGGCAAGGGACCTGG - Intergenic
1152519657 17:80847777-80847799 CTGGAAGGAAGAAGGGCAGGTGG - Intronic
1152663506 17:81553805-81553827 CGTGGAGGAGGAAACGGACGTGG + Intronic
1154002540 18:10494613-10494635 CTGGCAGGAGGAGAGGGTAGAGG + Intergenic
1154123381 18:11669672-11669694 CTGAAATGAGGAAAGGGCCAAGG - Intergenic
1154199490 18:12289372-12289394 CTGGAAGGAGGGGAGGGAAGTGG + Intergenic
1155068488 18:22290119-22290141 GTGGAAGGTGGAAAGGGAGGAGG + Intergenic
1155404034 18:25468083-25468105 CTGGAAGAAGGAGAGAGAGGGGG + Intergenic
1156742683 18:40351474-40351496 CTGGTGGGAGGCAAGGGATGAGG + Intergenic
1156991506 18:43414173-43414195 CTCTAATGAGGAAAGGGAGGAGG + Intergenic
1157332999 18:46716896-46716918 CTGGAGGGAGGACAAGGACCTGG + Intronic
1157675148 18:49562992-49563014 CCAGGAGGAGGAAAGGGAGGAGG - Intronic
1157808997 18:50679839-50679861 CAGGAAGGAGGGCAGGGAGGAGG - Intronic
1157856607 18:51110406-51110428 CAGGAGGGAGGAGAGGGAAGAGG + Intergenic
1158227335 18:55214858-55214880 ATGGAAGGAGAAATGGGAGGAGG - Intergenic
1158362030 18:56685549-56685571 CTGGAAGGTGGCAAGGTATGTGG + Intronic
1158427258 18:57351836-57351858 CTGGAAGACGGAAAGGGGAGAGG + Exonic
1158499488 18:57987314-57987336 CTGGGAGGGGCAAAGGGAGGAGG - Intergenic
1158610513 18:58935501-58935523 CTCGAAGGGGGAGAGGGAGGAGG - Intronic
1158993593 18:62894662-62894684 AGTGAAGGAGGAAAGGGACCAGG - Intronic
1159510761 18:69395912-69395934 CTGCAATGAGGAGAGGCACGTGG - Intergenic
1160323973 18:77923937-77923959 CTAGATAGAGGAAAGGGAAGAGG - Intergenic
1161322417 19:3647301-3647323 ATGGGAGGAGGAATGGGAGGAGG + Intronic
1161398840 19:4058875-4058897 CTGGAAGGAGGGAAGGAAGGCGG - Intronic
1161483038 19:4520168-4520190 CTGGAAGGAGGTGAGGGATGTGG - Intergenic
1161748729 19:6078174-6078196 CTGGGAGGAGGAAGGGCAAGTGG + Intronic
1162038170 19:7953542-7953564 GGGGAAGGAGGAGAGGGAGGAGG - Intergenic
1162080432 19:8214746-8214768 CTGGCAGGAGGAAGGAGAGGAGG + Intronic
1162824616 19:13244002-13244024 CTGGCAGGAGATAAGGGATGAGG + Intronic
1162873699 19:13604786-13604808 AGGGAAGGAGGAAGGGGAAGGGG + Intronic
1163004544 19:14389225-14389247 GGGGAAGGGGGAAAGGGAGGGGG + Intronic
1163020276 19:14477861-14477883 CTGGAAGGAGAGATGGGAGGTGG + Exonic
1163044804 19:14632875-14632897 CTGGCAGAAGGAAAGGGAATAGG + Intronic
1163279681 19:16307951-16307973 CTTGAAGGAGGGGAGGGACAGGG + Intergenic
1163358512 19:16830098-16830120 CTGGAAGCAGGACAGGGATCTGG + Intronic
1163779613 19:19239577-19239599 ATGGGAGGAGGAGAGGGAGGAGG - Intronic
1164534577 19:29075735-29075757 GTGGAAGGAGGAGAGGGAGCAGG + Intergenic
1164572665 19:29385445-29385467 CTGGGAGGGGGAAATGGACCAGG + Intergenic
1164726275 19:30467968-30467990 CGGGAAGGAGGTGAGGGAAGGGG + Intronic
1165144122 19:33720768-33720790 GTGGAAGGAGGATAGGGGAGTGG - Intronic
1165307995 19:35013814-35013836 CTGGATGGAGGAACAGGACAGGG + Intronic
1165314235 19:35045070-35045092 CTGGTAGGGGCAAAGGGACTAGG + Intronic
1165371116 19:35406806-35406828 CTCCAAGGAGGAGAGGGAAGAGG + Intergenic
1165823695 19:38693473-38693495 CTGGAGGGAAGAAAGGGCCTTGG - Intronic
1166205790 19:41267927-41267949 CAGGAATGAAGAAAGGGACCTGG - Intronic
1166656484 19:44615724-44615746 CTGGAAGGAGGAAAGGGACGTGG + Intronic
1166745904 19:45141756-45141778 CTGGGTGGAGGGACGGGACGGGG + Intronic
1166960402 19:46493324-46493346 ATGGGAGGAGGAAAGAGAAGTGG - Exonic
1166998588 19:46731761-46731783 CTGGAGGGAGGAACAGGAGGAGG - Intronic
1167131911 19:47592431-47592453 GGGGAAGGAGGAAAGGCAGGTGG - Intergenic
1167145100 19:47676580-47676602 GGGGAAGGAGGAAGGGGAGGCGG - Intronic
1167448941 19:49556075-49556097 CTGGAGGCAGGGAAGGGGCGGGG + Intronic
1167504433 19:49863643-49863665 CTGGAGTGAGGAAAAGGAGGGGG + Intronic
1167578828 19:50330465-50330487 CTGGATGGAGGGGAGGGACCTGG + Intronic
1168190071 19:54731737-54731759 GAGGAAGGAGGAAGGGGACCAGG - Intronic
1168196633 19:54779409-54779431 GAGGAAGGAGGAAGGGGACCAGG - Intronic
1168202412 19:54825824-54825846 GAGGAAGGAGGAAGGGGACCAGG - Intronic
1202654305 1_KI270708v1_random:5011-5033 CTGGAACTGGGAAAGGGACTTGG - Intergenic
925081748 2:1074392-1074414 CTGGAAGGAAGGAAGTGATGTGG + Intronic
925293742 2:2764641-2764663 CTGGAAGGAGGGAAGGAGGGAGG + Intergenic
925545462 2:5011233-5011255 AAGGAAGGAGGAGAGGGAGGGGG - Intergenic
926977457 2:18529577-18529599 CTGGAAGGAGGATATGAATGTGG - Intergenic
927562739 2:24084904-24084926 GGGGAAGGAGGAAAGGAAAGAGG - Exonic
927715639 2:25350408-25350430 CAGGAAGGAAGACAGAGACGAGG - Intergenic
927806382 2:26150404-26150426 AAGGCAGGAGGAAAGGGAGGAGG + Intergenic
927866823 2:26594096-26594118 CTGGAAGAAGGAAACGGTAGTGG - Intronic
927877893 2:26670861-26670883 AAGGAAGGAGGGAAGGGAGGAGG + Intergenic
927979904 2:27368583-27368605 CTGGAGGGAGGAAAGGTGCTGGG - Intronic
928328510 2:30338969-30338991 CTGGAGAGAGGAAAGGGAGGAGG + Intergenic
928622768 2:33107914-33107936 CTGAGAGGAGGGAAGGGAGGAGG + Intronic
928665683 2:33548510-33548532 CTGGAAGGAGGAGAGTCCCGGGG + Intronic
928904517 2:36355902-36355924 CTCGGAGGAGGAGAGGGAGGAGG + Intergenic
929357937 2:41049478-41049500 CTGAAAAGAGGAAAGGAAAGGGG - Intergenic
929468234 2:42165741-42165763 GTGGAAGAAGGAAAGGGTAGAGG - Intergenic
929584231 2:43103607-43103629 GTGGAAGGAGGAAGGGAAGGGGG + Intergenic
929819668 2:45262937-45262959 CTGGGAGGAGAAGATGGACGGGG - Intergenic
930366519 2:50446420-50446442 AAGGAAGGAGGAAAGGAAGGAGG - Intronic
930713243 2:54569160-54569182 CTGGGAAGAAGAAAGGAACGGGG + Intronic
931192799 2:60022089-60022111 CTGGAGGGAGGAAAGGGAGAAGG + Intergenic
931902764 2:66807565-66807587 GGGGAAGGAGGAGAGGGAGGAGG + Intergenic
934665202 2:96164720-96164742 CGGGAAGGAGGAAGGGAAGGGGG - Intergenic
934862336 2:97774692-97774714 CTGGCAGGTGGGAAGGGAAGTGG + Intronic
935757120 2:106284836-106284858 CTGGAAGAAGGAAGGGCATGGGG + Intergenic
936025631 2:109029203-109029225 CATGAAGGAGGAAAGGGCCCAGG - Intergenic
936456949 2:112682576-112682598 CTGGGAAGGGGAAAGGGAAGAGG - Intergenic
936752064 2:115655622-115655644 ATGAAAGGAGGAAAAGGACAAGG - Intronic
937049451 2:118876407-118876429 GGGGAGGGAGGAAAGGGACTTGG - Intergenic
937159631 2:119747718-119747740 CTTGAAGAAAGAAAGGGAGGAGG + Intergenic
937538840 2:122924357-122924379 CTGAAAGGAGGAAGGGAATGAGG - Intergenic
937683419 2:124668842-124668864 CTGGAATGAGGGAAGGAATGAGG + Intronic
937688522 2:124725463-124725485 GGGGAAGGAGGAAGGGGAAGGGG - Intronic
937985877 2:127637907-127637929 CAGGAAGGAAGGAAGGGAGGGGG - Intergenic
938220659 2:129564464-129564486 CTGGTAGGGAGAAAGGAACGAGG - Intergenic
938780777 2:134582829-134582851 CTGAGAGGAGGAAAGGTAGGGGG + Intronic
938966841 2:136396193-136396215 CTGGTTGGAGGAGAGCGACGGGG - Intergenic
939189764 2:138902404-138902426 CTGGAAGGGCGAAACAGACGAGG - Intergenic
939255256 2:139735762-139735784 CTGAAAAGAGAAAAAGGACGAGG - Intergenic
939430594 2:142100927-142100949 AGGGAAGGAGGAAGGGGACAAGG + Intronic
939548704 2:143586931-143586953 TTGGAGGGAGGAAAGGGAGAGGG - Intronic
940424077 2:153511086-153511108 GTGGAAGGAGGAAGAGGATGTGG + Intergenic
940836741 2:158530306-158530328 CTGGAAGGAGGAAAATGCCATGG - Intronic
942127761 2:172844492-172844514 CTGTAAGGAGGAGAGGAAGGAGG - Intronic
942502569 2:176607087-176607109 CTGGAAGAAGGAGAAGGAAGAGG + Intergenic
942748778 2:179264819-179264841 CGGGAAGGAGGAAGGAGGCGGGG + Intergenic
942964590 2:181876316-181876338 GTGGAAGGAGGAAGGGAACATGG - Intergenic
944062456 2:195583707-195583729 CTGGAAGGGAGAAACAGACGAGG - Intronic
944131576 2:196353101-196353123 CTGGAAGGGGGTAAGGAGCGAGG - Intronic
944187883 2:196969500-196969522 CAGGAAGGAGGTAGGGGATGAGG + Intronic
944205501 2:197153883-197153905 TGGGAAGGAGGAAAGGGATTAGG + Intronic
944259442 2:197660045-197660067 CAGGAAGAAAGAAAGGGACTAGG + Intronic
944465183 2:199993603-199993625 GTGGAAGGGGGAAATTGACGAGG + Intronic
944987870 2:205199317-205199339 CAGGGAGGAAGAAAGGGAAGAGG + Intronic
945214166 2:207415312-207415334 CTGGAAGCAGCAGAGGGAAGGGG + Intergenic
946235931 2:218324222-218324244 CTGGTAGTAGGAAGGGGACAGGG - Intronic
946922200 2:224591676-224591698 ACGGAAGGAGGAAAGTGAGGCGG - Intergenic
947243567 2:228021726-228021748 CTTGGAGGAGGAAAGCGAGGTGG - Exonic
947451009 2:230208966-230208988 TTGGAAGGAGGAAAGGCCAGTGG + Intronic
947674221 2:231962391-231962413 CTGGAAGGAGGGGAGAGATGGGG - Intronic
947868924 2:233421633-233421655 CTGGAAGGAAGCAAGGAAGGAGG - Intronic
947875569 2:233465344-233465366 CTGGGAAGAGGACATGGACGGGG + Intronic
948064879 2:235070143-235070165 CAGGCAGGAGGAAGGGGAGGGGG + Intergenic
948322894 2:237085342-237085364 CTGGAAGGAGGCAGGGGTCCCGG + Exonic
948423235 2:237873202-237873224 CTGGGAGGAGGACAGTGATGGGG + Intronic
948445947 2:238032988-238033010 CTGGAAGGGGCTAAGGGAAGTGG - Intronic
948542834 2:238702495-238702517 CAGGACGGAGGACAGGGACAGGG + Intergenic
948870392 2:240794992-240795014 CAAGGAGGAGGAAAGGGCCGTGG - Intronic
1168913531 20:1468461-1468483 CTGGCAGGAGGCATGGGAGGAGG + Intronic
1168949158 20:1784700-1784722 CTGGAAGGCTGAAGGGGAAGTGG + Intergenic
1169276531 20:4236853-4236875 CTAGAAGGTGGAAGGGGCCGGGG + Intronic
1169495756 20:6113376-6113398 CTGGAAAAAGGAAAGGGAGAGGG - Intronic
1169684352 20:8253758-8253780 GGGGAGGGAGGAAAGGGACCAGG - Intronic
1169717846 20:8640703-8640725 CTAGGAGGAGGGAAGGGAGGAGG + Intronic
1170127025 20:12975232-12975254 CTAGAAGGAGGAAACTGAGGAGG - Intergenic
1170144081 20:13153792-13153814 CTGGAAGGCAGGAAGGGAGGTGG - Intronic
1170880982 20:20296278-20296300 AGGGAAGGAGGGAAGGGATGAGG - Intronic
1170881022 20:20296434-20296456 CAGGAAGGAGGGAAGGAAGGAGG - Intronic
1171307380 20:24117939-24117961 CTGGGAGGAGGAATGGGGCCAGG - Intergenic
1171412981 20:24958905-24958927 CTGGAGGGAGCAAAGGGACTGGG - Intronic
1172057390 20:32164142-32164164 GTAAAAGGAGGCAAGGGACGAGG - Intronic
1172357905 20:34292478-34292500 CTGGAAGGGCGAAACGGACGAGG - Exonic
1172414904 20:34757440-34757462 CTGGAAGGAGGAGGGTGAGGAGG + Exonic
1172799752 20:37567543-37567565 CTCGTAGGAGGAAGGGGAGGTGG - Intergenic
1173358322 20:42316421-42316443 GTGGAAGGAGAAAAGAGAGGTGG - Intronic
1173834141 20:46114021-46114043 CTGCTAGGAGGAAAAGGACTTGG - Intergenic
1175070298 20:56327517-56327539 CTGGAAGGAGGAGAGGTGCCTGG - Intergenic
1175988751 20:62777183-62777205 CTGGAAGGAGGAAATGGGACAGG + Intergenic
1176277485 20:64280626-64280648 CTGGAATGAGGAAACGGCCATGG + Intronic
1176286855 21:5022974-5022996 CTGGAAGGAGGGAGGGAAGGCGG + Intronic
1176633332 21:9161401-9161423 CTGGAACTGGGAAAGGGACTTGG + Intergenic
1177498074 21:21914785-21914807 CTCCCAGGAGGAAAGGCACGGGG + Intergenic
1178098244 21:29238340-29238362 CTGGGAAGAGGACAGGGAAGGGG - Intronic
1178887686 21:36496691-36496713 GTGGAAGGAAGGAAGGGAGGAGG + Intronic
1179870326 21:44240501-44240523 CTGGAAGGAGGGAGGGAAGGCGG - Intronic
1180389193 22:12209413-12209435 CTGGAACTGGGAAAGGGACTTGG + Intergenic
1180416750 22:12725059-12725081 CTGGAACTGGGAAAGGGACTTGG - Intergenic
1180622903 22:17173614-17173636 TTGGAAGGAGGAAAGCGAGGTGG - Intergenic
1180623986 22:17181778-17181800 CTGGAAGGAGGCGGGGGACCTGG + Intronic
1180677809 22:17599967-17599989 GGGGAAGGAAGAAAGGGAGGGGG + Intronic
1180794498 22:18595394-18595416 CAGGAAAGAAGAAAGGGACTGGG - Intergenic
1181167099 22:20989673-20989695 CTGGGAGGAGGTGAGGGGCGTGG + Exonic
1181227241 22:21399926-21399948 CAGGAAAGAAGAAAGGGACTGGG + Intergenic
1181251409 22:21534913-21534935 CAGGAAAGAAGAAAGGGACTGGG - Intergenic
1181442223 22:22942493-22942515 CTGGAAGGAGGGGAGGCAGGAGG - Intergenic
1181480009 22:23192799-23192821 CTGGGAGGGGCAGAGGGACGAGG + Intronic
1181540910 22:23572905-23572927 CTGCAAGGAGGAAGGGGAGGAGG + Intergenic
1181550822 22:23638267-23638289 CTGCAAGGAGGAAGGGGAGGAGG + Intergenic
1181577156 22:23802374-23802396 AAGGAAGGAGGAAAGGAAAGAGG - Intronic
1181797463 22:25320428-25320450 CTGCAAGGAAGAAGGGGAGGAGG - Intergenic
1182094383 22:27616189-27616211 CTGGAAGGAGGAGGGGGAGGTGG - Intergenic
1182172150 22:28242209-28242231 TTAGAAGGAGTAAAGGGCCGGGG - Intronic
1183278630 22:36919161-36919183 TTGCCAGGAGGAAAGGGACACGG + Intronic
1183582095 22:38732141-38732163 CTGGAAGGAGGGAAGGAGAGGGG - Exonic
1184093743 22:42305647-42305669 CTGGAAGGACGAATGGGAGGTGG - Intronic
1184261938 22:43322641-43322663 CTTGAAGGAGGAAAGGAGGGAGG - Intronic
1184409826 22:44320045-44320067 ATGGAAGGAAGAAAGGGACGGGG - Intergenic
1184518089 22:44975390-44975412 CTGGAGGGAGGGGAGGGACAGGG - Intronic
949161402 3:887216-887238 CGGGAAGGAAGAAAGGAATGAGG - Intergenic
949614308 3:5737093-5737115 CTGGAGGCAAGAAAGGGACATGG + Intergenic
949648427 3:6126325-6126347 CCGGAAAGGGGAAAGGGAAGGGG + Intergenic
949813836 3:8037820-8037842 CTGGGTGGAGGAATGGGATGGGG - Intergenic
949927397 3:9052527-9052549 CTGGGAGGAGAAAGGAGACGGGG - Intronic
950008447 3:9705627-9705649 CAGGCAGGAGGAGAGGGACCAGG - Intronic
950140206 3:10610002-10610024 CAGGAAGGAGCAAAGGAACCAGG - Intronic
950193192 3:10992228-10992250 CTGGAAGGAGAAAAGCCAGGAGG + Intergenic
950206074 3:11082159-11082181 CAGGAAGGGAGAAAGGGACTGGG - Intergenic
950326609 3:12116354-12116376 CTGGAAGAAGGAAAAGGAAAAGG + Intronic
950453342 3:13078107-13078129 CTGGCTGGAGGAAGGGGGCGTGG + Intergenic
950484394 3:13264535-13264557 CTGGAGGGAGGGAGGGGAGGAGG - Intergenic
950591016 3:13935738-13935760 CTGGGAGGAGGAGGGGGAAGAGG + Intergenic
951184855 3:19701855-19701877 CTGGCAGGAGGAAAAGGAGAGGG + Intergenic
951317967 3:21209458-21209480 CTGGAAGGTGGAAGGGGACCTGG - Intergenic
951792856 3:26505437-26505459 CAGGAAGGAGGAAAAGGAAAGGG - Intergenic
951962883 3:28348815-28348837 CTGGAAGGAGGGACGAGCCGAGG + Exonic
952750129 3:36818094-36818116 CTGAAAGGAGGAAAGTGGTGGGG + Intergenic
952955700 3:38556002-38556024 CTGGGAGGAGAAAAGGGTAGGGG - Intronic
953205752 3:40827419-40827441 TTGGAAGGAGGAGGGGGACAGGG - Intergenic
953637920 3:44678221-44678243 CTGGAAGGTGGGAAGGGCCAAGG - Intergenic
953903655 3:46857549-46857571 AAAGAAGGAGGAAAGGGAAGAGG + Intergenic
954411787 3:50374185-50374207 GTGGAGGGAGGAAAGGGGAGGGG + Intronic
954558351 3:51535903-51535925 CTGGGAGGAGGGAATGGAAGAGG + Intergenic
954621942 3:52001460-52001482 CTGGTAGAAGGAAAGGGCCATGG + Intergenic
954823550 3:53351552-53351574 CTGGAAGGAAGAAAGGCATCTGG - Intergenic
955879676 3:63530145-63530167 CTGGAAGGAGATAAAGGAAGGGG + Intronic
956086406 3:65615644-65615666 CTGGAAGGTGGTGAGGGAAGCGG - Intronic
956180712 3:66515650-66515672 CTAGAAGGAGGATAGAGAGGAGG + Intergenic
956267394 3:67412561-67412583 CTGGCAGGAGGAGAGGGAATTGG + Intronic
957100201 3:75817345-75817367 CTGGAACTGGGAAAGGGACTTGG + Intergenic
957140488 3:76348696-76348718 CTGAAAGGAGGAAGGGGAGATGG - Intronic
958028286 3:88074997-88075019 CAGGAAGGAGGAAATGGTCAGGG - Intronic
958474537 3:94564195-94564217 CTGAAAGGAAGAAAAGGAAGAGG + Intergenic
958643380 3:96838012-96838034 GTGGAAGGAGGTAAAGGACTAGG - Intronic
960062560 3:113339332-113339354 CTGAAAGAAGGAAAGGAATGAGG - Intronic
960141525 3:114155890-114155912 CTCCAAGGAGGAAAGGGAGGAGG - Intronic
960674353 3:120180315-120180337 CTTGAAGGAGGAGTGGGATGAGG + Intronic
961340136 3:126212324-126212346 ATGGAAGGAGGGAAGGAAGGAGG + Intergenic
962388980 3:134956077-134956099 CTGCAGGGAGGAAGGGGAGGAGG + Intronic
962527078 3:136246538-136246560 TAGGAAGGAGGAAATGGAAGAGG - Intergenic
962718813 3:138152986-138153008 CTGGAAGGAGGTAAGGGAATAGG + Intergenic
962968678 3:140378921-140378943 CAGGAAGGAGGAAAGGTGGGAGG - Intronic
964194392 3:154045748-154045770 CTAGATGGAGGAAAGAGCCGTGG + Intergenic
966061324 3:175760024-175760046 ATGGGAGTAGGAAAGGCACGGGG + Intronic
966624428 3:182001053-182001075 CATGAAGGAGGAAAGGGTGGAGG - Intergenic
966736291 3:183189621-183189643 CTGGAAGGAGAAATGGGTCCTGG + Intronic
967050593 3:185780254-185780276 GGGAAAGGAGGAAAGGGACCAGG + Intronic
967267197 3:187701202-187701224 CTAAAAGGAGGAAAGGCATGTGG + Intronic
967303372 3:188038290-188038312 GTGGAAGGAGGAAAGCAACATGG + Intergenic
967506249 3:190255957-190255979 GTGGAAGCAGGAAAGGTAGGCGG + Intergenic
967971977 3:195005924-195005946 CTGGAAGGAGAAGTGGGACAGGG + Intergenic
968432287 4:566092-566114 CTGCACGGAGGAGAGGGAGGTGG - Intergenic
968632347 4:1658580-1658602 CTGGAAGCAGGAAAGCCACAGGG + Intronic
968729856 4:2264577-2264599 ATGGCAGGAGGAGAGGGAAGGGG + Intergenic
968813617 4:2810865-2810887 CTGCAAGGAGGAAAGAGAATGGG + Intronic
968868534 4:3228659-3228681 GAGGGAGGAGGAATGGGACGAGG + Exonic
969220767 4:5757001-5757023 CTGGGAGGAGGAGAGGGCCTGGG + Intronic
969318340 4:6395466-6395488 AAGGAGGGAGGAAAGGGAGGTGG - Intronic
969495339 4:7523116-7523138 CTGGAAGGAAGAAAGGGAGGAGG - Intronic
969531939 4:7735090-7735112 CTGGAATGAGCAAAGTGACCCGG + Intronic
969551279 4:7869232-7869254 GGGGAAGGAGGAAGGGGAAGGGG + Intronic
969864345 4:10064010-10064032 CTGGCAGGAGGAATGGGAAATGG + Intergenic
970876639 4:20878334-20878356 CTAGAAGGAGGAAAGGGCCATGG - Intronic
971469600 4:27007510-27007532 CTAGAAGAAGGAAAGGAAGGAGG - Intronic
971804387 4:31336308-31336330 CTGAAAGGTGGAAAGGGAACAGG + Intergenic
972010356 4:34172134-34172156 CAGGAAGGGGGTAAGGGACAGGG - Intergenic
972713957 4:41627111-41627133 CTGGAAAGAGGAACTGGAGGGGG - Intronic
973535117 4:51873194-51873216 GTGCAAGGAGGAAAGGCATGAGG + Intronic
973544388 4:51966185-51966207 AGGGAAGGAGGAAAGGAAGGAGG - Intergenic
973730080 4:53814878-53814900 CAGGAAGGAGGAAAAGGAATGGG - Intronic
973927038 4:55749081-55749103 CTGGAAGGGGGAAAGGGGGAGGG + Intergenic
974683435 4:65194546-65194568 CTGGAAGCAGGACAAGTACGTGG - Intergenic
975009800 4:69336071-69336093 CTGTGAGGAGGAAAGGAACGTGG + Intronic
975292340 4:72691823-72691845 GTGGAAGGAGGAAAGAGTGGGGG - Intergenic
975367686 4:73547775-73547797 CTGAGAGGTGGAAAGGGGCGAGG - Intergenic
976152641 4:82107528-82107550 CAGGAAGGAGGAAAGAGAAGGGG + Intergenic
976223181 4:82774670-82774692 CTGGGAGGAGCAAAGGGTGGGGG - Intronic
976446469 4:85135633-85135655 CTGGGTGGGGGAAAGGGAGGGGG + Intergenic
976794256 4:88914475-88914497 CTGGAAGGCAGGAAGGGACTTGG - Intronic
977619615 4:99121216-99121238 AGGAAAGGAGGAAAGGGATGAGG + Intergenic
977810081 4:101347574-101347596 CCGGGAGGAGGAAGGGGAGGAGG - Intronic
979268436 4:118731548-118731570 GAGGAAGGAGGGAAGGGAAGGGG - Intronic
981092169 4:140743029-140743051 GAGGAAGGAGGAAAGGAAGGAGG + Intronic
981884049 4:149651293-149651315 CTGGAAGGTGGAAATAGATGAGG + Intergenic
982031360 4:151304375-151304397 CTGGGAAGAGGGAAGGGACCAGG - Intronic
982119718 4:152130985-152131007 CGAGAAGGAGGAAGGGGAGGAGG - Intergenic
982626032 4:157767356-157767378 CTGGAAGGAAAAAAGGGCAGGGG + Intergenic
982693629 4:158575058-158575080 CTGGAAGCAGGAAAGGAACGTGG + Intronic
984350842 4:178590987-178591009 CTGGAAGGAGGAAGAGGATAAGG - Intergenic
984497033 4:180511489-180511511 AAGGAAGGAGGGAAGGGAGGAGG - Intergenic
984762731 4:183376758-183376780 GTGGAAGGGGGACAGGCACGTGG - Intergenic
984963714 4:185122763-185122785 GTGGATGAAGGAAAGGGAAGGGG - Intergenic
984979929 4:185270678-185270700 CTGGAGGGAGGGAAGGAATGGGG - Intronic
985336965 4:188906149-188906171 GAGGAAGGAGGAAAGGAAGGGGG - Intergenic
985478224 5:91722-91744 CTGGACGGAGGAGAGGGCCTGGG + Intergenic
985671117 5:1207156-1207178 CTCGAAGGTGGAGAAGGACGAGG - Intronic
985756324 5:1720832-1720854 CAGGCAGGAGGAAGGGGCCGTGG - Intergenic
985795997 5:1962533-1962555 AGGGAAGGAGGAAAGGGGAGGGG - Intergenic
986091335 5:4511527-4511549 CTGGAAGGAGTAAAAAGACCCGG + Intergenic
986283981 5:6346529-6346551 AAGGAAGGAGGAAAGGAAGGAGG + Intergenic
986773511 5:10994360-10994382 GGGGAAGGAGGAAGGGGCCGGGG + Intronic
986773536 5:10994417-10994439 GGGGAAGGAGGAAAGGGGTGGGG + Intronic
986879077 5:12147793-12147815 AGGGAAGGAGGAAAGGAAGGAGG - Intergenic
987115074 5:14719740-14719762 CTCGGAGTAGGAAAGGGACAGGG + Intronic
988963726 5:36394182-36394204 CAGGAAGGAAGAAAGGGGAGAGG + Intergenic
989088395 5:37700941-37700963 CTGTAAAGAAGAAAGGGAAGGGG - Intronic
989217123 5:38917031-38917053 CTGGGAGGAGGAGTGGGATGAGG + Intronic
990099993 5:52170887-52170909 GAGGAAGGAGGAAAAGGAGGAGG - Intergenic
991352791 5:65736108-65736130 CTGGTATGAGGAAAGGGACATGG - Intronic
991942095 5:71863093-71863115 ATGGAAGGAGGAAAGGAACAGGG - Intergenic
992125025 5:73631119-73631141 CTGGAAAGAGGAAAGACAAGTGG + Intronic
992812861 5:80407525-80407547 CCGGGAGGAGGAAGGGGAAGCGG + Intergenic
993464033 5:88222508-88222530 CTGGAAGGAGGTCAGGGAAGTGG + Intronic
994982733 5:106897806-106897828 CTGGAAAGAGGAAAGTCAGGTGG + Intergenic
995487375 5:112652951-112652973 CTGGAAAGTGAAAAGGGATGTGG + Intergenic
996387531 5:122925079-122925101 AGGGAAGGAGGAGAGGGAAGAGG - Intronic
996587581 5:125107740-125107762 CTAGAAGGAGGAGAAGGAGGAGG - Intergenic
997526448 5:134556010-134556032 CAGGAAGGATGAAGGAGACGGGG - Intronic
998216750 5:140243282-140243304 CTGGAGGGAGAAGAGGGAAGAGG - Intronic
1000050046 5:157554970-157554992 AAGGTAGGAGGAAAGGGAAGGGG + Intronic
1000208398 5:159085135-159085157 CTGGAAGTAGTAAAGTGAGGAGG - Intronic
1000430960 5:161152100-161152122 CTGGAATGTGGAAAGGGAGGTGG - Intergenic
1000443783 5:161295150-161295172 CTGAGAAGAGGAAAGGGAAGAGG + Intronic
1000996753 5:167967198-167967220 TTGGATGGAGGCAAGGGAGGTGG + Intronic
1001004604 5:168039077-168039099 CTGCAAGGAGGAGAGGCAAGGGG - Intronic
1001132896 5:169079506-169079528 GAGGAAGGAGGAGAGGGAGGAGG + Intronic
1001328446 5:170745836-170745858 CGGGAGGGAGGAAAGGGGCCTGG + Intergenic
1001600166 5:172923355-172923377 CTGGGAGGAGGAGGGGGAGGAGG + Intronic
1001948499 5:175799433-175799455 CTGGAAGGTGGAAAAGGAAGGGG + Intronic
1002201188 5:177529378-177529400 GTGGAAGGAGACAAGGGAGGAGG + Intronic
1002461802 5:179377605-179377627 CTGGACGCAGGAGAAGGACGGGG + Intergenic
1002626371 5:180532380-180532402 GTGGAAGGAGGAGAGGGTGGAGG - Intronic
1003130798 6:3393834-3393856 CTGAAAAGAGGATAGGAACGAGG + Intronic
1003273690 6:4629714-4629736 CTTGTAGGAGGAAGGGGAAGAGG + Intergenic
1003315874 6:5011455-5011477 GCGGAAGGATGAAAGGGATGTGG + Intergenic
1003483108 6:6551168-6551190 CTGGAAGGAGGCAGGAGACAGGG + Intergenic
1004562041 6:16760761-16760783 CGGGGAGGAGGAATGGGAAGAGG + Intronic
1004973565 6:20938966-20938988 GGGGAAGGAGGAAAAGGAGGAGG - Intronic
1006060766 6:31416879-31416901 CTGGAAGCAAGAGAAGGACGAGG + Intergenic
1006129808 6:31862431-31862453 CTCGAATGAGGAGAAGGACGGGG + Intronic
1006337012 6:33426068-33426090 CTGGAAGGTGGAGCGGGACAGGG + Intronic
1006337188 6:33426929-33426951 CTGGAAGGAGCCAAAGGATGGGG - Intronic
1006509507 6:34514550-34514572 CTGGAAGGACGATTGGGAGGTGG + Intronic
1006770539 6:36549001-36549023 TTGGAAGGAGGAAAGAGAAGAGG - Intergenic
1006804116 6:36777437-36777459 CTGGGAGGAGGAGAGGGATTTGG - Intronic
1006822308 6:36907049-36907071 ATGGAAGGAGGAAAAGAAGGAGG - Intronic
1006868147 6:37225873-37225895 CAGGAAGGGGGAAAGGGAGAAGG - Intronic
1007392902 6:41560898-41560920 GTGGAAGGAGAAAAGAGAAGGGG - Intronic
1007769344 6:44180566-44180588 CGGGGAGCAGGAAAGGGACCTGG - Intronic
1008418659 6:51271905-51271927 AAGGAAGGAGGGAAGGGAGGGGG + Intergenic
1008659606 6:53652426-53652448 CTGCAAGGAGGCGAGGGACCTGG + Intronic
1008717388 6:54305569-54305591 CTGGAAGGAAGAAAGGAAGATGG + Intergenic
1008800494 6:55362993-55363015 CAGGAAGGAGGAAAAGAACAAGG + Intronic
1008907653 6:56697226-56697248 CAGGAAGAAAGAAAGGGACTTGG - Intronic
1008929417 6:56922667-56922689 CTGGAAGGAGGATATGGAAGAGG - Intronic
1009419049 6:63444904-63444926 CTGGAAGGAGGGAAAGGACAAGG + Intergenic
1009860657 6:69326812-69326834 ACAGAAGGAGGAAAGGGAAGAGG + Intronic
1009958682 6:70491011-70491033 CTGGAAGGAGTAAAGAGTAGAGG - Intronic
1009970744 6:70623228-70623250 CTGGGAGGAGGGAAGGGGCAGGG + Intergenic
1010154019 6:72770993-72771015 CTAGAAGGGGGAAGGGGGCGGGG + Intronic
1010192231 6:73206436-73206458 CTCGAGGGAGTAAAGGGAAGAGG - Intergenic
1010402520 6:75462806-75462828 TTGGAATGAGTAAAGGGATGGGG - Intronic
1011220282 6:85047902-85047924 GTGGAAGGAGGAAAGGTTAGAGG - Intergenic
1011424824 6:87214897-87214919 CTGGAGGGAGGGAAGGGGTGGGG - Intronic
1011553495 6:88550942-88550964 CTGGAGGGAGGGAAGAGAAGTGG - Intergenic
1012014535 6:93834524-93834546 CTAGAAGGAGGAATGGAAGGTGG + Intergenic
1012214567 6:96566155-96566177 CTGGAAGCAGAAAAGGGTAGGGG - Intronic
1012587079 6:100936547-100936569 GTGGAAGGAGGAAGGAGATGTGG + Intergenic
1013196419 6:107848491-107848513 CCGGAAGGAGGAAGGGAACACGG + Intergenic
1013408602 6:109864709-109864731 CTGCAAGGAGTTAAGGGACTGGG - Intergenic
1014217029 6:118762261-118762283 CTGGATGGAGGGAGGGGACAAGG - Intergenic
1014398236 6:120953285-120953307 CTGGAAGGAGGAAACGGAGTGGG + Intergenic
1014486181 6:122002236-122002258 CTTGAAGGAGACAAGGGAGGAGG - Intergenic
1014981984 6:127955639-127955661 CTGGTGGGAGGAAAGGGAGGTGG - Intergenic
1015137820 6:129893281-129893303 ATGGTAGGAGGAAAGAGACATGG - Intergenic
1015552992 6:134431544-134431566 GTGGAAGCAGGAAAGGGAATGGG + Intergenic
1015770423 6:136762790-136762812 CTGGGAGGAGGAAGGGGGAGAGG - Intronic
1016446955 6:144143613-144143635 CTGGCAGGAGGACAGGGGCAGGG - Intergenic
1017170750 6:151452272-151452294 CCGGAAGCAGGCAAGGGACCGGG - Exonic
1017237258 6:152129774-152129796 CTGGAAGGAGGGTGGGGATGAGG - Intronic
1017764026 6:157592692-157592714 GGGGAAGGAGGAAAAGGGCGGGG + Intronic
1017996275 6:159534195-159534217 CTGGAAGCAGGAAACGGCCTGGG + Intergenic
1018171912 6:161150491-161150513 CAGGAAGGAGGAAAGGCCCTTGG + Intronic
1018390726 6:163339094-163339116 CCAGAAGGAGGAAAGGCAGGCGG + Intergenic
1018614763 6:165676543-165676565 CTGGAAGGTGGTGAGGGAAGGGG + Intronic
1019292199 7:256303-256325 CAGGAGTGAGGAGAGGGACGGGG - Intronic
1019352414 7:560874-560896 CTGGAGGGAGGAACGTGTCGTGG - Intronic
1020119470 7:5495093-5495115 CTGCAGGGAGGATGGGGACGAGG + Intronic
1020354130 7:7258264-7258286 ATGGAAGGGGGAAAGGAATGGGG + Intergenic
1020931767 7:14405973-14405995 CTTGAAGGAGAAAAAGGAGGAGG + Intronic
1021107198 7:16651576-16651598 CTGGCTGGAGGAAAAGGATGCGG + Intronic
1021343066 7:19488614-19488636 CTGGATGCAGGAAAGGAACTCGG - Intergenic
1021486327 7:21172530-21172552 CAGGAAGGAGGAGAGGGAAATGG - Intergenic
1022027673 7:26464064-26464086 CTGGAAGGAGGTCAGGGAAGAGG - Intergenic
1022393912 7:29968471-29968493 AAGAAAGGAGGAAAGGGACCAGG + Intronic
1023239408 7:38127791-38127813 CTGGATGGAGGGAAGGAAGGAGG - Intergenic
1023401099 7:39793352-39793374 CCGGAAGGCGGACAGGGACTTGG + Intergenic
1024570381 7:50718149-50718171 CAGGAAGGAAGAAAGGGAAGGGG + Intronic
1026357080 7:69567484-69567506 CTGGAAGGAGGAGAGGGAGTGGG + Intergenic
1026736671 7:72953483-72953505 CTGGAAGGAGTTGAGGGGCGGGG - Intergenic
1027107063 7:75411580-75411602 CTGGAAGGAGTTGAGGGGCGGGG + Intergenic
1027172647 7:75883651-75883673 CTGGAGGCAGCAAAGGGAGGAGG - Intronic
1027491749 7:78835645-78835667 CAGGAAGGAGAAAATGGACAGGG + Intronic
1027784534 7:82564344-82564366 CTGGAAGTGGGAATGGGAGGAGG + Intergenic
1028186081 7:87786230-87786252 CTGGAAGGAGGAAGTGGAGCTGG - Intronic
1028278034 7:88882861-88882883 GGGGAAGGAGGAAGGGGACAAGG + Intronic
1029248634 7:99220416-99220438 AGGGAAGGAGGAGAGGGACATGG + Intergenic
1029356079 7:100052757-100052779 CAGGAAGGAGGAAGGGCACCCGG + Intronic
1029373213 7:100162578-100162600 AGGGAAGGAGGGAAGGGAAGAGG + Intronic
1029412954 7:100427138-100427160 AGGGAGGGAGGAAAGGGAGGAGG - Intronic
1029451895 7:100646229-100646251 CTGGTGAGAGGAAAGGGACCTGG - Exonic
1030157015 7:106465564-106465586 CTGAAGGAAGGAAAGGGATGGGG + Intergenic
1030375733 7:108751342-108751364 CAGGAAGGAGGAATGGGAGGAGG - Intergenic
1030974604 7:116105890-116105912 ATGGAAGGTGGAAAGAGATGGGG - Intronic
1031353069 7:120759226-120759248 TTGGAAGGTGGGCAGGGACGAGG + Intergenic
1031981658 7:128130901-128130923 GAGGAAGGAGGGAAGGGAAGAGG - Intergenic
1031991853 7:128203560-128203582 CTGTTAGGAGGAAAGGGAGGAGG - Intergenic
1032297736 7:130657232-130657254 ATGGAAGGAGAAAGGGGAGGAGG - Intronic
1032386541 7:131529500-131529522 GTGGAAGGAGGCCAGGGAGGAGG + Intronic
1033658855 7:143390407-143390429 CTGGAAGTAGGATAGGGATGGGG + Intronic
1033825757 7:145187116-145187138 CTGGAAGGAAGGAAGGGAAGGGG - Intergenic
1034584622 7:152078175-152078197 CTAGAAGGAGAAGAGGGAGGGGG + Intronic
1034919508 7:155068412-155068434 CTGGCAGGGGGTAAGGGAGGGGG + Exonic
1036279358 8:7386380-7386402 AAGGAAGAAGGAAAGGGAGGGGG - Intergenic
1036342156 8:7925492-7925514 AAGGAAGAAGGAAAGGGAGGGGG + Intergenic
1036688874 8:10928774-10928796 CTGGAAGGTGGAGAAGGAGGGGG - Intronic
1036711876 8:11085080-11085102 CTGGAAGGAGGAGGCGGAGGAGG - Intronic
1037053797 8:14410218-14410240 CAGGCAGAAGGAAAGGGAGGAGG - Intronic
1037601121 8:20395055-20395077 CTGGAAGAAGAAAAGAGACCCGG - Intergenic
1037691443 8:21184587-21184609 CTGGAGGAAGGGAAGGGACGCGG - Intergenic
1037815592 8:22110046-22110068 CTGGAAGGAGGGAGGGGGCAGGG + Intergenic
1037886271 8:22598081-22598103 CAGAAAGGAGCAAAGGGAAGGGG + Intronic
1037911046 8:22743773-22743795 CTGGGCAGAGGAAAGGGGCGTGG - Intronic
1037997383 8:23363103-23363125 CTGGAAGAAGGAAAGGGAAAGGG - Intronic
1038002678 8:23404381-23404403 CTGCAGGGAGGAAAGGGTAGAGG - Intronic
1038131118 8:24732605-24732627 CTGGAAGAATGAAAGGAACTGGG + Intergenic
1038154120 8:24971343-24971365 GTGGGAGGAGGAATGGGAAGTGG + Intergenic
1038208279 8:25490375-25490397 ATGAGAGGAGGAAAGGGATGAGG + Intronic
1038276486 8:26125728-26125750 CTTGAAGGAGAAAAGGGAAGAGG + Intergenic
1038375076 8:27032191-27032213 CTGGGAGGTGGAAAGGAACTTGG + Intergenic
1038460217 8:27709819-27709841 CTGGAGGGAGGGAAAGGAAGTGG - Intergenic
1038589609 8:28824610-28824632 CTGGCAGGAGTACAGGGAAGTGG + Intronic
1038716267 8:29993985-29994007 CTGGAGGGAGGAGATGGAAGAGG - Intergenic
1039738090 8:40354025-40354047 CTGGAAGGATGAGTGGGAGGTGG + Intergenic
1040858029 8:51970374-51970396 CTGGCAGGGGGTAAGGGACAGGG - Intergenic
1041146267 8:54879640-54879662 CTGAAAGGAGGAGATGGAGGAGG + Intergenic
1041174596 8:55181445-55181467 CTGGAAGGATGAAAGGAAGGAGG - Intronic
1041216823 8:55608882-55608904 CTGGCAGGAGGAATGGGGAGGGG + Intergenic
1041258514 8:56000183-56000205 CTGGAAGGAGGAAACCCACATGG + Intronic
1042190280 8:66178826-66178848 ATGGGAGGAGGAAGGGGAAGTGG + Intergenic
1043407286 8:79950958-79950980 CAGGAAGAAGGAAATGGAGGTGG - Intronic
1044413431 8:91910039-91910061 CAGGGAGGAGGAAAGGGGCCTGG + Intergenic
1046027869 8:108746891-108746913 AAGGCATGAGGAAAGGGACGTGG - Intronic
1047298956 8:123596572-123596594 CTGGAGGGAGGAAAGCCAAGAGG - Intergenic
1047372168 8:124265171-124265193 CTGGAAGGTGGAAGGAGATGAGG - Intergenic
1047938956 8:129808768-129808790 GTGGAAGGTGGAAAGGGAGCAGG - Intergenic
1048157210 8:131968633-131968655 TTAGAAGAAGGAAAGGGAGGAGG - Intronic
1048363172 8:133715397-133715419 AAGGAAGGAGAAAAGGGAGGAGG - Intergenic
1048363195 8:133715469-133715491 AAGGAAGGAGAAAAGGGAGGAGG - Intergenic
1048625736 8:136183017-136183039 CAGGATGGATGAAAGGCACGAGG + Intergenic
1048752754 8:137698268-137698290 CAGGGAGGAGGAGAGGGAGGTGG + Intergenic
1049387272 8:142349657-142349679 CAGGAATGAGAAAGGGGACGTGG + Intronic
1049542498 8:143214940-143214962 CGGGGAGGTGGACAGGGACGTGG + Intergenic
1049630118 8:143649382-143649404 ATGGAGGGAGGAAAGGGCAGGGG + Intronic
1050014385 9:1218638-1218660 CTGGATGGAGGAAAGGAGAGAGG + Intergenic
1050138447 9:2492846-2492868 CTGGATGGAAGAAAGGGAAATGG + Intergenic
1050299556 9:4243253-4243275 CAGGAAGGAGGAAGAGGAAGTGG + Intronic
1050744269 9:8858191-8858213 CAGGAAGGAGGAAAGAGGAGAGG - Intronic
1050816225 9:9815739-9815761 ATGGAAGGAGGTAGGGGATGGGG + Intronic
1050930683 9:11320870-11320892 CTTGAAGAAGGAAAGAGAAGAGG - Intergenic
1051162503 9:14224074-14224096 CTGGAAGGCGTAATTGGACGAGG - Intronic
1051734049 9:20179613-20179635 AAGGAAGAAGGAAAGGGAAGGGG + Intergenic
1052441501 9:28502013-28502035 AAGGAAGGAAGAAAGGGAGGAGG + Intronic
1052733789 9:32319431-32319453 CTGGAAAGAGGAAAAGGGAGAGG - Intergenic
1053164956 9:35837754-35837776 CTGATAGGAAGAAAGGGACAAGG - Intronic
1053329821 9:37193953-37193975 CTGTAAGAGGGAAAGGGATGAGG - Intronic
1055511036 9:76995792-76995814 CTGGAAGGAGCAGAAGGAAGGGG - Intergenic
1056304376 9:85274669-85274691 CTGGGAGGAGGGAAGAGAGGGGG + Intergenic
1057092928 9:92276445-92276467 CTGTAGGGAGGAATGGGATGAGG + Intronic
1057196941 9:93120708-93120730 CTTGGAGGAGGAAAGGGCAGAGG + Intergenic
1057197356 9:93122382-93122404 CTGGAAGGAGGAAGAGGAGAGGG + Intronic
1058171277 9:101684068-101684090 CAGGAAGAAGGAAAGGAAGGGGG - Intronic
1058503393 9:105645696-105645718 CAGGAAGGAGGACAGGGACTGGG + Intergenic
1058752315 9:108051590-108051612 CAGGAAGCAGGAAAGGAAAGGGG - Intergenic
1059559073 9:115314320-115314342 TGGGAAGGTGGAAAGGGAGGTGG + Intronic
1059765416 9:117379305-117379327 CTTGCAGGAGCAAAGGGACCCGG + Intronic
1060236003 9:121863041-121863063 CGGGAAGAAAGAAAGGGAGGAGG - Intronic
1060288939 9:122282312-122282334 ATGGACGGATGAAAGGGAAGAGG - Intronic
1061119906 9:128636072-128636094 CTGGAAGGGGGCCAGGGTCGGGG - Intronic
1061373834 9:130212670-130212692 CTGGCAGGAGGGGAGGGAGGAGG + Intronic
1061865738 9:133490998-133491020 GGGGGAGGAGGAAAGGGAGGAGG + Intergenic
1061939476 9:133876370-133876392 GTGGTAGGGGGCAAGGGACGGGG + Intronic
1062161882 9:135085124-135085146 CTGGCATGAGGATAGAGACGTGG + Intronic
1062182237 9:135196694-135196716 CGGGAAGGAGAAATGGGAAGGGG - Intergenic
1062446239 9:136596516-136596538 GTGGAAGGAGGGGAGGGACATGG - Intergenic
1062537558 9:137027619-137027641 GTGGACGGAGGGAAGGGACAGGG + Exonic
1062543670 9:137052520-137052542 TTGGAAGGAGAACAGGGAGGTGG + Intronic
1203756173 Un_GL000218v1:129029-129051 CTGGAACTGGGAAAGGGACTTGG + Intergenic
1185644619 X:1608332-1608354 CAGGAAGGAGGCATGGGAGGAGG - Intergenic
1185701202 X:2231749-2231771 CAGAAAGGAGGAAGAGGACGAGG - Intronic
1185726683 X:2427270-2427292 ATGGAAGGAGGGAAGAGAGGAGG + Intronic
1185999152 X:4989063-4989085 AAGGAAGGAAGAAAGGGAAGGGG - Intergenic
1186155733 X:6724521-6724543 AAGGAAGGAGGAAAGGGTGGGGG + Intergenic
1187150756 X:16679510-16679532 TTGGAGGAAGGCAAGGGACGAGG + Intronic
1187236853 X:17475836-17475858 CTGGAGATAGGAAAAGGACGAGG - Intronic
1187266223 X:17736899-17736921 TTGGAATGAGGAGAGGGGCGGGG - Intergenic
1187504437 X:19867314-19867336 GGGGAGGGAGGAAAGGGAAGAGG + Intronic
1187737981 X:22323817-22323839 TTGGAAAGAGGAAAAGGAGGAGG - Intergenic
1187940062 X:24372658-24372680 CTGGAAGTAAGAAGGGGAAGGGG + Intergenic
1188822486 X:34792605-34792627 CTTGAGGGAGGAAAAGGAAGAGG - Intergenic
1188958569 X:36463519-36463541 CTGGGAGCAGGAAAGGGAGGAGG + Intergenic
1189309060 X:40007425-40007447 TTGGAAGAAGGAAAGGGAACAGG + Intergenic
1189360252 X:40344413-40344435 CTGGATGCAGGACAAGGACGTGG + Intergenic
1190289716 X:48984207-48984229 AAGGAAGGAGGAAAGGGGCAGGG - Intronic
1192047348 X:67689946-67689968 TGGGAAGGAGGAAAGGGTCAGGG - Intronic
1192199901 X:69060238-69060260 AGGGAAGGGGGAAAGGGAGGGGG + Intergenic
1192377393 X:70577523-70577545 CTGGAAGCAGCAAAAGGAAGTGG + Intronic
1193353280 X:80486390-80486412 ATGGATGGAGGAAATGGACATGG + Intergenic
1194607893 X:96004540-96004562 CAGGAAGTAGGAAAGGGCAGAGG - Intergenic
1195365664 X:104122908-104122930 CTCAAAGGAGGAAAGGAACTTGG + Intronic
1198313162 X:135439029-135439051 TGGGAAAGAGGAAGGGGACGGGG + Intergenic
1198517823 X:137427055-137427077 TTGGAGGGAGGAAGGGGATGGGG + Intergenic
1198523321 X:137474365-137474387 CTGGAATGAGGACAGGGACTGGG - Intergenic
1199537439 X:148918669-148918691 CAGGAGGAAGGAAAGGGAGGAGG + Intronic
1199600952 X:149540706-149540728 CCGGAAGGAGGAAAAGGAACGGG - Exonic
1199649436 X:149938729-149938751 CCGGAAGGAGGAAAAGGAACCGG + Exonic
1200073819 X:153541577-153541599 CTGGAAGGAGGAAGAGGAATGGG + Intronic
1200232143 X:154449442-154449464 CTGGTGGGAGGGAAGGGAAGAGG - Intronic
1201169769 Y:11246646-11246668 CTGGAACTGGGAAAGGGACTTGG + Intergenic
1201340239 Y:12925581-12925603 CTGGAAGGAGAAAGGGTAAGGGG + Intergenic
1201348851 Y:13016287-13016309 CAGGAAGGAGGGAAAGGAGGGGG - Intergenic
1201550131 Y:15210501-15210523 GAGGAAGGAAGAAAGGGAGGAGG + Intergenic
1201770623 Y:17614134-17614156 CTGTAGGGAGGACAGGGACTCGG - Intergenic
1201830932 Y:18291852-18291874 CTGTAGGGAGGACAGGGACTCGG + Intergenic
1202044438 Y:20724278-20724300 CTCGAAGCAGGAAAGGGGCTTGG + Intergenic
1202379048 Y:24260592-24260614 GTAGAAGGAAGAAAGGGACCAGG + Intergenic
1202491734 Y:25409529-25409551 GTAGAAGGAAGAAAGGGACCAGG - Intergenic