ID: 1166667472

View in Genome Browser
Species Human (GRCh38)
Location 19:44689622-44689644
Sequence GGAGTGGGGAGGAGTCCAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166667472_1166667480 5 Left 1166667472 19:44689622-44689644 CCGCCTGGACTCCTCCCCACTCC No data
Right 1166667480 19:44689650-44689672 TCCTACCACAGAGCAGCCCAAGG No data
1166667472_1166667482 6 Left 1166667472 19:44689622-44689644 CCGCCTGGACTCCTCCCCACTCC No data
Right 1166667482 19:44689651-44689673 CCTACCACAGAGCAGCCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166667472 Original CRISPR GGAGTGGGGAGGAGTCCAGG CGG (reversed) Intergenic
No off target data available for this crispr