ID: 1166669489

View in Genome Browser
Species Human (GRCh38)
Location 19:44701376-44701398
Sequence GAGCCGAGCCCCAACCAGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 129}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166669480_1166669489 6 Left 1166669480 19:44701347-44701369 CCAAACCCTCCCAGGTCCTGCGG 0: 1
1: 0
2: 0
3: 23
4: 222
Right 1166669489 19:44701376-44701398 GAGCCGAGCCCCAACCAGGAAGG 0: 1
1: 0
2: 1
3: 11
4: 129
1166669476_1166669489 22 Left 1166669476 19:44701331-44701353 CCCTGGCTCCAAATCACCAAACC 0: 1
1: 0
2: 2
3: 16
4: 218
Right 1166669489 19:44701376-44701398 GAGCCGAGCCCCAACCAGGAAGG 0: 1
1: 0
2: 1
3: 11
4: 129
1166669486_1166669489 -4 Left 1166669486 19:44701357-44701379 CCAGGTCCTGCGGCAGACGGAGC 0: 1
1: 0
2: 1
3: 10
4: 152
Right 1166669489 19:44701376-44701398 GAGCCGAGCCCCAACCAGGAAGG 0: 1
1: 0
2: 1
3: 11
4: 129
1166669482_1166669489 1 Left 1166669482 19:44701352-44701374 CCCTCCCAGGTCCTGCGGCAGAC 0: 1
1: 0
2: 0
3: 19
4: 237
Right 1166669489 19:44701376-44701398 GAGCCGAGCCCCAACCAGGAAGG 0: 1
1: 0
2: 1
3: 11
4: 129
1166669483_1166669489 0 Left 1166669483 19:44701353-44701375 CCTCCCAGGTCCTGCGGCAGACG 0: 1
1: 0
2: 2
3: 7
4: 143
Right 1166669489 19:44701376-44701398 GAGCCGAGCCCCAACCAGGAAGG 0: 1
1: 0
2: 1
3: 11
4: 129
1166669477_1166669489 21 Left 1166669477 19:44701332-44701354 CCTGGCTCCAAATCACCAAACCC 0: 1
1: 0
2: 2
3: 21
4: 157
Right 1166669489 19:44701376-44701398 GAGCCGAGCCCCAACCAGGAAGG 0: 1
1: 0
2: 1
3: 11
4: 129
1166669475_1166669489 23 Left 1166669475 19:44701330-44701352 CCCCTGGCTCCAAATCACCAAAC 0: 1
1: 1
2: 2
3: 19
4: 178
Right 1166669489 19:44701376-44701398 GAGCCGAGCCCCAACCAGGAAGG 0: 1
1: 0
2: 1
3: 11
4: 129
1166669478_1166669489 14 Left 1166669478 19:44701339-44701361 CCAAATCACCAAACCCTCCCAGG 0: 1
1: 0
2: 2
3: 24
4: 164
Right 1166669489 19:44701376-44701398 GAGCCGAGCCCCAACCAGGAAGG 0: 1
1: 0
2: 1
3: 11
4: 129
1166669485_1166669489 -3 Left 1166669485 19:44701356-44701378 CCCAGGTCCTGCGGCAGACGGAG 0: 1
1: 0
2: 1
3: 11
4: 128
Right 1166669489 19:44701376-44701398 GAGCCGAGCCCCAACCAGGAAGG 0: 1
1: 0
2: 1
3: 11
4: 129
1166669487_1166669489 -10 Left 1166669487 19:44701363-44701385 CCTGCGGCAGACGGAGCCGAGCC 0: 1
1: 0
2: 0
3: 4
4: 89
Right 1166669489 19:44701376-44701398 GAGCCGAGCCCCAACCAGGAAGG 0: 1
1: 0
2: 1
3: 11
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166669489 Original CRISPR GAGCCGAGCCCCAACCAGGA AGG Exonic
901237871 1:7677213-7677235 TACCCGAGCCCCACCCAGGAAGG + Intronic
902118414 1:14140996-14141018 GTGCCCAGGCCCAACTAGGATGG + Intergenic
902821275 1:18944803-18944825 GAGCCCTGCCCCAAGCAGGATGG + Intronic
904585713 1:31579525-31579547 TAGCCCAGCCCAAGCCAGGAGGG - Intronic
904622776 1:31785175-31785197 GAGCCGAGTGCCAAGCCGGAGGG - Intergenic
905381180 1:37562567-37562589 GAGCCCAGCCCCCTCCAGAAAGG - Intronic
905512248 1:38530637-38530659 GTGCTGAGCACCAAACAGGAAGG - Intergenic
905733790 1:40312862-40312884 GAGCCTCGGCCCACCCAGGAGGG - Intronic
907328467 1:53656191-53656213 AAGCAGAGCCCCAAACAGGGAGG + Intronic
914915666 1:151817682-151817704 GAGCTGAGCCCCAGCGAGGGAGG - Intronic
920677484 1:208048312-208048334 GAGCTGGGGCCCAACCAGGCAGG + Intronic
1063141207 10:3257971-3257993 GAGCCGAGACCCAGACAGGCTGG + Intergenic
1066049173 10:31619173-31619195 CAGCCCAGCCCCACCCATGAGGG - Intergenic
1070157155 10:73842351-73842373 GAGCCCAGCTCCAGCCAGGAGGG + Intronic
1072429270 10:95356520-95356542 GAGCTGGGCCCCAGCCAGGAGGG - Intronic
1072563129 10:96595419-96595441 GAGGCAAGCCCAAACCAGCAGGG + Exonic
1074143143 10:110694380-110694402 TAGCCCAGCCCCAACAAAGATGG - Intronic
1074767091 10:116707415-116707437 AGGCCCAGCCCCAGCCAGGAAGG + Intronic
1074914141 10:117939416-117939438 GAGTCCAGTCCCAACCAGGGAGG + Intergenic
1075345327 10:121677973-121677995 GAGGGGAGCCACAACCAGGATGG + Intergenic
1076771364 10:132667223-132667245 CAGCCGAGCTCCAACCAAAAGGG - Intronic
1077007408 11:364748-364770 GGGCCGAGCAGCAAGCAGGATGG + Intergenic
1079112206 11:17611198-17611220 GAGCCGTGTCTCAGCCAGGACGG + Exonic
1079125886 11:17718672-17718694 GAGCCAAGCCCCGAGCAGAAGGG + Intergenic
1080818640 11:35783730-35783752 GAGCCTAGCCCCTTCCTGGAAGG + Intronic
1083822986 11:65182979-65183001 TAGCCGAGTCCCACCCAGGATGG - Intronic
1084007503 11:66331131-66331153 GTGCCGACCACCAACCACGAGGG - Intronic
1085272827 11:75280464-75280486 GAGCACAGCCCGACCCAGGAGGG + Intronic
1090950326 11:131467370-131467392 GAGCCCACCTCCCACCAGGAGGG + Intronic
1091400039 12:175978-176000 GGGCCGAGCCTCATGCAGGAGGG - Exonic
1096428358 12:51522957-51522979 GGGCAAAGTCCCAACCAGGAAGG + Intergenic
1097721839 12:63030059-63030081 AAGCCGAGGACCAGCCAGGAGGG - Intergenic
1101422620 12:104562081-104562103 GAAACGAGGCCCAGCCAGGAAGG - Intronic
1103322391 12:120099767-120099789 GAGCCCAGGGCCAGCCAGGAAGG + Intronic
1104738463 12:131154575-131154597 GGGCTGAGCCACAGCCAGGAGGG - Intergenic
1104965972 12:132509004-132509026 GCGCAGAGCCCCACCCTGGAAGG - Intronic
1104971508 12:132532866-132532888 GAGCAGAGACCCAGCCAGGTGGG + Intronic
1105209819 13:18250928-18250950 GACCCGAGGCACAGCCAGGAAGG + Intergenic
1105604180 13:21913250-21913272 CAGCCAGGCCCCAGCCAGGAGGG + Intergenic
1105628203 13:22134677-22134699 GAGCCCGGCTCTAACCAGGAAGG - Intergenic
1105978538 13:25495169-25495191 AAGCCCAGCCCCACCCTGGAAGG - Intronic
1106294385 13:28397218-28397240 TTGCCGAGCCCCAACAAGAATGG + Intronic
1114007659 14:18332346-18332368 CAGCTCAGCCCCATCCAGGATGG + Intergenic
1119446955 14:74673019-74673041 GAGCCCAGCCACATCCATGAGGG - Intronic
1120865571 14:89292957-89292979 GAGCCGAACCCAGGCCAGGAGGG - Intronic
1123171665 14:106378398-106378420 CAGCCCAGCCCCAACCATGCAGG + Intergenic
1127275371 15:57438856-57438878 GGACCGAGCTCCATCCAGGACGG - Exonic
1128523528 15:68391181-68391203 GAGCTGAGCCCCCTCCAGAATGG - Intronic
1128778651 15:70343094-70343116 GAGTCTGGCCCCAAGCAGGATGG + Intergenic
1131150160 15:90042787-90042809 TAACAGAGGCCCAACCAGGAAGG + Intronic
1132724725 16:1333800-1333822 GCCCCGCGCCCCAACCCGGACGG + Intronic
1139509111 16:67416322-67416344 GAGCGGGGCCCCATCCCGGACGG + Exonic
1141581934 16:85005193-85005215 GAGCAGAGCCTCAATCAGGCTGG + Intronic
1142299166 16:89246887-89246909 GATCCAAGCACCAAACAGGACGG + Intergenic
1144411371 17:15005308-15005330 GAGCCCTGCCCCAAACAGTAAGG + Intergenic
1145252825 17:21305691-21305713 GACCTGAGCCCCAACACGGAAGG - Intronic
1145323750 17:21782225-21782247 GACCTGAGCCCCAACATGGAAGG + Intergenic
1148549074 17:48539493-48539515 GAACCCTGCCCCAATCAGGATGG + Intergenic
1151687998 17:75660910-75660932 GAGCCAGGCCCAGACCAGGAGGG + Intronic
1152526215 17:80889686-80889708 GAGCCCAGCTCCATTCAGGAAGG + Intronic
1152758722 17:82097740-82097762 GAGCCGAGGCCCAGCCCGAAGGG - Intronic
1153285968 18:3453961-3453983 AAGCTGAGCCACAACTAGGAGGG + Intronic
1153600227 18:6773921-6773943 GAGCTGAGACACAAACAGGAAGG + Intronic
1153724763 18:7943298-7943320 GAGCAGAGGCCAGACCAGGAAGG - Intronic
1154216783 18:12421224-12421246 GGGCAGAGCCCCAAAGAGGAAGG - Intronic
1154529804 18:15331617-15331639 CAGCTCAGCCCCATCCAGGATGG - Intergenic
1161249936 19:3275242-3275264 CAGCCCAGCCCCACCCAGCAGGG + Intronic
1166669489 19:44701376-44701398 GAGCCGAGCCCCAACCAGGAAGG + Exonic
1166694474 19:44844879-44844901 GAGCCCAGCCCCACCCAGCCCGG + Intergenic
925237519 2:2292567-2292589 GCGCTGAGCCCCAACAGGGATGG - Intronic
925271670 2:2614227-2614249 GACCTGGGCCCCAGCCAGGAGGG - Intergenic
925271792 2:2615061-2615083 GACCTGGGCCCCAGCCAGGAGGG + Intergenic
925611199 2:5705249-5705271 CAGCCCAGCCCCAAGAAGGAAGG + Intergenic
927653372 2:24926277-24926299 GAGGCGGGCACCCACCAGGACGG - Intergenic
933790346 2:85879192-85879214 GAGCTGAGCCACAGCCAGAAAGG + Intronic
938528898 2:132163057-132163079 CAGCTCAGCCCCATCCAGGAGGG - Intronic
939782454 2:146465501-146465523 GTGCCAAGCTCCATCCAGGAAGG + Intergenic
946353144 2:219168708-219168730 GAGCCCTGCCACAACCAGGCTGG + Exonic
947715750 2:232338135-232338157 CAGGAGAGCCCCAAACAGGAAGG + Intronic
1171986583 20:31665292-31665314 GAGGCCAGCCCCACCCAGGAGGG - Exonic
1172359298 20:34301224-34301246 CAGCCGGGCCCCTCCCAGGAGGG - Intronic
1173852699 20:46228762-46228784 GAGCCCAGCCCAGCCCAGGAGGG - Intronic
1175416566 20:58805130-58805152 GAGCCCAGCCCCTCCCTGGATGG + Intergenic
1175891364 20:62317458-62317480 GGTCCGAGCCCCATCCAGGCTGG + Exonic
1176301499 21:5101138-5101160 GGGCTGAGCCCGAAGCAGGAGGG + Intergenic
1176767607 21:13036855-13036877 CAGCTCAGCCCCATCCAGGATGG + Intergenic
1179855532 21:44160761-44160783 GGGCTGAGCCCGAAGCAGGAGGG - Intergenic
1180432166 22:15263156-15263178 CAGCTCAGCCCCATCCAGGATGG + Intergenic
1180514733 22:16131093-16131115 CAGCTCAGCCCCATCCAGGATGG + Intergenic
1180766443 22:18348472-18348494 GACCCGAGGCACAGCCAGGAAGG - Intergenic
1180779872 22:18513906-18513928 GACCCGAGGCACAGCCAGGAAGG + Intergenic
1180812586 22:18771227-18771249 GACCCGAGGCACAGCCAGGAAGG + Intergenic
1180995717 22:19964297-19964319 GAGGTGAGCCCCAACCAGGATGG + Exonic
1181198745 22:21205475-21205497 GACCCGAGGCACAGCCAGGAAGG + Intergenic
1181400992 22:22650324-22650346 GACCCGAGGCACAGCCAGGAAGG - Intergenic
1181515303 22:23407533-23407555 GAGCTGAGCCCCAACCACCTTGG - Intergenic
1181573998 22:23782535-23782557 GAGCCCAGCCACCACCAGGTGGG - Intronic
1181648527 22:24246558-24246580 GACCCGAGGCACAGCCAGGAAGG + Intergenic
1181702969 22:24631416-24631438 GATCCGAGGCACAGCCAGGAAGG - Intergenic
1184193945 22:42914122-42914144 GAGCAGAGCCCTAACCAGTGTGG - Intronic
1203228060 22_KI270731v1_random:89362-89384 GACCCGAGGCACAGCCAGGAAGG - Intergenic
950430143 3:12945988-12946010 GAGCTGAGTCCTAATCAGGAAGG - Intronic
953165112 3:40457740-40457762 GAGCCAGGCGCCAACCTGGATGG - Intronic
954628971 3:52038067-52038089 GTGCCGAGCCCCCAGCAGAAGGG - Intergenic
954848218 3:53578222-53578244 GAGCAGAGCCCCATCCAGCTGGG + Intronic
955018816 3:55098378-55098400 GAACTTAGCCCAAACCAGGATGG + Intergenic
961603543 3:128077592-128077614 TAGCTGAGCCTCACCCAGGATGG + Intronic
962615011 3:137116909-137116931 GAGCTGAGTCCCAACCTGTAGGG + Intergenic
962809588 3:138949161-138949183 GAGAGGAGCCCCCACCAGGATGG - Intronic
967149068 3:186631525-186631547 GAGCTGAGACCCTACAAGGATGG + Intergenic
968512679 4:1002520-1002542 GAGCCGCTCCCCAGCCTGGAGGG - Intronic
968640643 4:1712752-1712774 GAGCCGCGCTCCACCCAGGCCGG - Intergenic
968667020 4:1828001-1828023 GAGGCGCCCCCCAACCCGGACGG + Intronic
968819240 4:2837402-2837424 GCGCTGAGCCCCAACCAGCAGGG - Exonic
969531555 4:7733522-7733544 GAGGCGAACACCCACCAGGAGGG - Intronic
970006477 4:11416017-11416039 CAGCCCTTCCCCAACCAGGAAGG - Intronic
971381861 4:26106539-26106561 CATCCGAGCCACAATCAGGAAGG - Intergenic
983957577 4:173715862-173715884 CAGCCTCCCCCCAACCAGGAGGG - Intergenic
985558835 5:571202-571224 GAGCCGAGCCCAGGCCAGAAGGG + Intergenic
996046948 5:118884712-118884734 ACGCCCAGCCCCAACCTGGAAGG - Intronic
996443010 5:123512646-123512668 GACCCCAGCCCCACCCGGGAGGG - Intronic
999125354 5:149242171-149242193 CAGCAGAGCCCCATGCAGGAAGG - Intronic
1002202350 5:177536926-177536948 GAGCCCAGGCCCAAGCAAGAAGG + Intronic
1006123579 6:31822499-31822521 GAGCAGAGCAGCAGCCAGGACGG + Intergenic
1006589182 6:35141572-35141594 AAGCCGAGCCACACCCAGGAGGG + Exonic
1015245063 6:131065672-131065694 GTGCCAAGCCCAAACCAGGTTGG + Intergenic
1019292414 7:257243-257265 GCCCCAGGCCCCAACCAGGAGGG + Intronic
1019530164 7:1499270-1499292 AAGCTGAGCCCCGAGCAGGAGGG - Exonic
1019891226 7:3948742-3948764 GAGCTGAGCCCCCACCAGTCTGG + Intronic
1024042800 7:45568132-45568154 GTGCCCAGCCCCAAAAAGGAAGG - Intergenic
1029991588 7:104967410-104967432 AAGCAGAGCCCCAGCCAGTAGGG + Intergenic
1041304041 8:56441552-56441574 GAGCGTAGCCACCACCAGGATGG - Exonic
1042128069 8:65558841-65558863 AAGCAGTGCCCCAAGCAGGACGG - Intergenic
1042341799 8:67687257-67687279 GAGCCTTGAGCCAACCAGGATGG + Intronic
1049599430 8:143500143-143500165 GTGCTGAGGCCCACCCAGGATGG - Intronic
1050794042 9:9514209-9514231 ATGCAGAGCCCTAACCAGGAGGG - Intronic
1057167459 9:92940340-92940362 CAACCAAGCCCCAACCAGGCTGG + Intergenic
1060132422 9:121116786-121116808 GATACTAGCACCAACCAGGAAGG + Intronic
1060668860 9:125450866-125450888 GAGAGGAGACCCAACCAGGAGGG - Intronic
1061189055 9:129071180-129071202 GAGCCTAGCACCACCCAGGGAGG - Exonic
1062177120 9:135169514-135169536 AAGCCCAGCCCCAACCACAAGGG + Intergenic
1062394344 9:136346722-136346744 GAGCCTGGCCCCGACCATGAGGG - Intronic