ID: 1166674073

View in Genome Browser
Species Human (GRCh38)
Location 19:44728607-44728629
Sequence CTTTGCAAGGGCAAGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166674073_1166674084 -2 Left 1166674073 19:44728607-44728629 CCATCCACCTTGCCCTTGCAAAG No data
Right 1166674084 19:44728628-44728650 AGTGCTGGGATTACAGGCGGGGG 0: 11
1: 1141
2: 3280
3: 3260
4: 3017
1166674073_1166674082 -4 Left 1166674073 19:44728607-44728629 CCATCCACCTTGCCCTTGCAAAG No data
Right 1166674082 19:44728626-44728648 AAAGTGCTGGGATTACAGGCGGG 0: 1754
1: 2709
2: 2278
3: 2013
4: 2868
1166674073_1166674080 -8 Left 1166674073 19:44728607-44728629 CCATCCACCTTGCCCTTGCAAAG No data
Right 1166674080 19:44728622-44728644 TTGCAAAGTGCTGGGATTACAGG 0: 291
1: 11669
2: 313488
3: 264828
4: 144194
1166674073_1166674083 -3 Left 1166674073 19:44728607-44728629 CCATCCACCTTGCCCTTGCAAAG No data
Right 1166674083 19:44728627-44728649 AAGTGCTGGGATTACAGGCGGGG 0: 1142
1: 3395
2: 3470
3: 2707
4: 3182
1166674073_1166674085 13 Left 1166674073 19:44728607-44728629 CCATCCACCTTGCCCTTGCAAAG No data
Right 1166674085 19:44728643-44728665 GGCGGGGGCCGCTTTGCAAATGG No data
1166674073_1166674081 -5 Left 1166674073 19:44728607-44728629 CCATCCACCTTGCCCTTGCAAAG No data
Right 1166674081 19:44728625-44728647 CAAAGTGCTGGGATTACAGGCGG 0: 1569
1: 1825
2: 1354
3: 1301
4: 2386

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166674073 Original CRISPR CTTTGCAAGGGCAAGGTGGA TGG (reversed) Intergenic
No off target data available for this crispr