ID: 1166674950

View in Genome Browser
Species Human (GRCh38)
Location 19:44734663-44734685
Sequence AAGAAGAAGGAGAAGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166674950_1166674956 8 Left 1166674950 19:44734663-44734685 CCCTTCTCCTTCTCCTTCTTCTT No data
Right 1166674956 19:44734694-44734716 AGGGTCTCACTGTGTTGCCCAGG 0: 910
1: 11291
2: 40927
3: 108076
4: 237800
1166674950_1166674957 12 Left 1166674950 19:44734663-44734685 CCCTTCTCCTTCTCCTTCTTCTT No data
Right 1166674957 19:44734698-44734720 TCTCACTGTGTTGCCCAGGCTGG 0: 3138
1: 40460
2: 101153
3: 213792
4: 342817
1166674950_1166674958 22 Left 1166674950 19:44734663-44734685 CCCTTCTCCTTCTCCTTCTTCTT No data
Right 1166674958 19:44734708-44734730 TTGCCCAGGCTGGAGTGCAGCGG 0: 66497
1: 175004
2: 225621
3: 191618
4: 110379

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166674950 Original CRISPR AAGAAGAAGGAGAAGGAGAA GGG (reversed) Intergenic
No off target data available for this crispr