ID: 1166675431

View in Genome Browser
Species Human (GRCh38)
Location 19:44737983-44738005
Sequence CCAGCCTTTTCCCTGGAAGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166675431_1166675436 -8 Left 1166675431 19:44737983-44738005 CCGACTTCCAGGGAAAAGGCTGG No data
Right 1166675436 19:44737998-44738020 AAGGCTGGAGTTTCAGGAAAGGG No data
1166675431_1166675435 -9 Left 1166675431 19:44737983-44738005 CCGACTTCCAGGGAAAAGGCTGG No data
Right 1166675435 19:44737997-44738019 AAAGGCTGGAGTTTCAGGAAAGG No data
1166675431_1166675438 11 Left 1166675431 19:44737983-44738005 CCGACTTCCAGGGAAAAGGCTGG No data
Right 1166675438 19:44738017-44738039 AGGGACTGTCCCTCCTGGATAGG No data
1166675431_1166675437 6 Left 1166675431 19:44737983-44738005 CCGACTTCCAGGGAAAAGGCTGG No data
Right 1166675437 19:44738012-44738034 AGGAAAGGGACTGTCCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166675431 Original CRISPR CCAGCCTTTTCCCTGGAAGT CGG (reversed) Intergenic
No off target data available for this crispr