ID: 1166675433

View in Genome Browser
Species Human (GRCh38)
Location 19:44737990-44738012
Sequence TGAAACTCCAGCCTTTTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166675433_1166675442 26 Left 1166675433 19:44737990-44738012 CCAGGGAAAAGGCTGGAGTTTCA No data
Right 1166675442 19:44738039-44738061 GCACCATGCTCCACCCTGCCAGG No data
1166675433_1166675437 -1 Left 1166675433 19:44737990-44738012 CCAGGGAAAAGGCTGGAGTTTCA No data
Right 1166675437 19:44738012-44738034 AGGAAAGGGACTGTCCCTCCTGG No data
1166675433_1166675445 30 Left 1166675433 19:44737990-44738012 CCAGGGAAAAGGCTGGAGTTTCA No data
Right 1166675445 19:44738043-44738065 CATGCTCCACCCTGCCAGGGTGG No data
1166675433_1166675438 4 Left 1166675433 19:44737990-44738012 CCAGGGAAAAGGCTGGAGTTTCA No data
Right 1166675438 19:44738017-44738039 AGGGACTGTCCCTCCTGGATAGG No data
1166675433_1166675443 27 Left 1166675433 19:44737990-44738012 CCAGGGAAAAGGCTGGAGTTTCA No data
Right 1166675443 19:44738040-44738062 CACCATGCTCCACCCTGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166675433 Original CRISPR TGAAACTCCAGCCTTTTCCC TGG (reversed) Intergenic
No off target data available for this crispr