ID: 1166675438

View in Genome Browser
Species Human (GRCh38)
Location 19:44738017-44738039
Sequence AGGGACTGTCCCTCCTGGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166675427_1166675438 29 Left 1166675427 19:44737965-44737987 CCTTGAGTAGGGGAGGCACCGAC No data
Right 1166675438 19:44738017-44738039 AGGGACTGTCCCTCCTGGATAGG No data
1166675433_1166675438 4 Left 1166675433 19:44737990-44738012 CCAGGGAAAAGGCTGGAGTTTCA No data
Right 1166675438 19:44738017-44738039 AGGGACTGTCCCTCCTGGATAGG No data
1166675431_1166675438 11 Left 1166675431 19:44737983-44738005 CCGACTTCCAGGGAAAAGGCTGG No data
Right 1166675438 19:44738017-44738039 AGGGACTGTCCCTCCTGGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166675438 Original CRISPR AGGGACTGTCCCTCCTGGAT AGG Intergenic
No off target data available for this crispr