ID: 1166676964

View in Genome Browser
Species Human (GRCh38)
Location 19:44746709-44746731
Sequence TGGGATGCCAGGAGTGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166676954_1166676964 10 Left 1166676954 19:44746676-44746698 CCTGCTAGGTTGGAACCACTGCA No data
Right 1166676964 19:44746709-44746731 TGGGATGCCAGGAGTGGGACAGG No data
1166676951_1166676964 21 Left 1166676951 19:44746665-44746687 CCCTCTACAGTCCTGCTAGGTTG No data
Right 1166676964 19:44746709-44746731 TGGGATGCCAGGAGTGGGACAGG No data
1166676952_1166676964 20 Left 1166676952 19:44746666-44746688 CCTCTACAGTCCTGCTAGGTTGG No data
Right 1166676964 19:44746709-44746731 TGGGATGCCAGGAGTGGGACAGG No data
1166676950_1166676964 22 Left 1166676950 19:44746664-44746686 CCCCTCTACAGTCCTGCTAGGTT No data
Right 1166676964 19:44746709-44746731 TGGGATGCCAGGAGTGGGACAGG No data
1166676957_1166676964 -5 Left 1166676957 19:44746691-44746713 CCACTGCACCAGCTGCCCTGGGA No data
Right 1166676964 19:44746709-44746731 TGGGATGCCAGGAGTGGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166676964 Original CRISPR TGGGATGCCAGGAGTGGGAC AGG Intergenic
No off target data available for this crispr