ID: 1166678842

View in Genome Browser
Species Human (GRCh38)
Location 19:44755423-44755445
Sequence GTCACGCCCCATGTGAATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 45}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166678842_1166678846 7 Left 1166678842 19:44755423-44755445 CCTTGATTCACATGGGGCGTGAC 0: 1
1: 0
2: 1
3: 2
4: 45
Right 1166678846 19:44755453-44755475 AAGCAGCTCTCTTGAGTTGAGGG 0: 1
1: 0
2: 2
3: 24
4: 219
1166678842_1166678847 21 Left 1166678842 19:44755423-44755445 CCTTGATTCACATGGGGCGTGAC 0: 1
1: 0
2: 1
3: 2
4: 45
Right 1166678847 19:44755467-44755489 AGTTGAGGGTAATTCCCAAATGG 0: 1
1: 0
2: 2
3: 9
4: 107
1166678842_1166678845 6 Left 1166678842 19:44755423-44755445 CCTTGATTCACATGGGGCGTGAC 0: 1
1: 0
2: 1
3: 2
4: 45
Right 1166678845 19:44755452-44755474 CAAGCAGCTCTCTTGAGTTGAGG 0: 1
1: 0
2: 5
3: 42
4: 1030

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166678842 Original CRISPR GTCACGCCCCATGTGAATCA AGG (reversed) Intronic
900547461 1:3236699-3236721 GGCAGGGCCCATGTGAATCCAGG + Intronic
900927259 1:5713399-5713421 GTCACACCCCATGTGACTCTGGG - Intergenic
901546480 1:9961575-9961597 TACAAGCCCCAAGTGAATCATGG + Intronic
906804429 1:48766654-48766676 GTCAAGAGGCATGTGAATCAAGG - Intronic
910072980 1:83242258-83242280 GTCATGCTTCATATGAATCAGGG - Intergenic
919762412 1:201106345-201106367 CTCAGGCCCCATGTGGAGCATGG - Intronic
1065129041 10:22601985-22602007 GTCACCCACCATGTAAAGCACGG - Intronic
1073453709 10:103624072-103624094 GTCAGGCAGCATGTGAATCCAGG + Intronic
1076682578 10:132181438-132181460 GTGAAGCCCCATGTAAAACAGGG - Intronic
1085201530 11:74705113-74705135 TTCACGCCCCATGGGATTCTGGG - Intronic
1087855096 11:103082496-103082518 GTCACTCACCAAGAGAATCAAGG + Intronic
1094609809 12:31983503-31983525 GTCACACCTAATGTCAATCAAGG + Exonic
1097937949 12:65274814-65274836 GTCAGGCAGCATGTCAATCACGG + Intergenic
1103050635 12:117776467-117776489 GTCTGGCCCCATGTGAGTCTGGG - Intronic
1104355060 12:128077986-128078008 GTCACTCCCAATGTGCACCAGGG - Intergenic
1117243017 14:53854595-53854617 GTGACTCCTCATGGGAATCAGGG + Intergenic
1121831019 14:97052758-97052780 GTCAGGCTCCATGTGGAGCAGGG + Intergenic
1129168367 15:73792576-73792598 ATCACGCCCCATGTTAGACACGG - Intergenic
1142065297 16:88059000-88059022 CTCACGCCCAGTGTGTATCAGGG + Intronic
1144959996 17:19039560-19039582 CTCACGGCCCATGGGAGTCAGGG - Intronic
1144975164 17:19134964-19134986 CTCACGGCCCATGGGAGTCAGGG + Intronic
1160955716 19:1690912-1690934 GTCACGCCCCATGAGAAAGCCGG + Intergenic
1166678842 19:44755423-44755445 GTCACGCCCCATGTGAATCAAGG - Intronic
926171598 2:10556175-10556197 CTCATGCCCCATGTTAATAATGG - Intergenic
937468509 2:122155582-122155604 GTCAGGGGCCTTGTGAATCAGGG - Intergenic
1175642255 20:60640674-60640696 GTCAGGCCCCATGGGTAGCAGGG + Intergenic
1181782161 22:25201268-25201290 GCCACGCCCCATGGGCAGCAAGG + Intronic
950422994 3:12909630-12909652 GTCGCTCCACATGTGACTCAGGG + Intronic
953268512 3:41416741-41416763 GAAATGCCCCATGTGAAACAGGG + Intronic
954577880 3:51686754-51686776 GTCCCGCCCCATTTCATTCAAGG + Intronic
961619272 3:128210721-128210743 GTCATGACACGTGTGAATCAAGG - Intronic
963079343 3:141376551-141376573 GTCACCCTCCATCTGATTCAAGG - Intronic
968596764 4:1489870-1489892 GACCCGCCCCATGAGAAGCATGG + Intergenic
977388447 4:96375762-96375784 TTCACGTCCCATGTCTATCAGGG - Intergenic
1001896729 5:175388827-175388849 GTCAGACCCCATCTCAATCAGGG + Intergenic
1010873878 6:81076764-81076786 GTCACGTCCCATTTAAATAAGGG + Intergenic
1011607512 6:89118650-89118672 GTTATGCCCCAAGTGAATAAAGG - Intergenic
1013370945 6:109470519-109470541 GTCATGCCCCATGTTATTCTGGG - Intronic
1015547778 6:134379123-134379145 GTCACACCCCATGTGAATGAAGG + Intergenic
1023636501 7:42216464-42216486 GTGAGCCCCCATGTGAATGATGG + Intronic
1024197514 7:47073522-47073544 GTGACACCCCAGGGGAATCAGGG - Intergenic
1024767065 7:52672052-52672074 GTAACGCTCCTTGTGAACCAAGG - Intergenic
1027290712 7:76707452-76707474 GTCATGCTTCATATGAATCAGGG - Intergenic
1037892323 8:22629848-22629870 GTCAGGCCCCATGGGAATCTGGG + Intronic
1047013177 8:120693869-120693891 GCCACGCCCTATGTGAAGAAAGG - Exonic
1056304415 9:85275098-85275120 GTGACTCCCCAGTTGAATCAGGG - Intergenic
1059626679 9:116074533-116074555 GTCAGGCCCCATGTTAAATATGG + Intergenic
1193967953 X:88011853-88011875 GTCACTCCCAATGTTGATCATGG - Intergenic
1196030718 X:111093081-111093103 CTCACTTCTCATGTGAATCAAGG + Intronic