ID: 1166679225

View in Genome Browser
Species Human (GRCh38)
Location 19:44757148-44757170
Sequence GCAGGGCTCGCAGGCAGGTC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 369
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 345}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166679225_1166679232 -5 Left 1166679225 19:44757148-44757170 CCCGACCTGCCTGCGAGCCCTGC 0: 1
1: 0
2: 0
3: 23
4: 345
Right 1166679232 19:44757166-44757188 CCTGCTGGACAGCGCAGCTCCGG 0: 1
1: 0
2: 3
3: 28
4: 228
1166679225_1166679234 4 Left 1166679225 19:44757148-44757170 CCCGACCTGCCTGCGAGCCCTGC 0: 1
1: 0
2: 0
3: 23
4: 345
Right 1166679234 19:44757175-44757197 CAGCGCAGCTCCGGGCACGTTGG 0: 1
1: 0
2: 1
3: 9
4: 120
1166679225_1166679236 13 Left 1166679225 19:44757148-44757170 CCCGACCTGCCTGCGAGCCCTGC 0: 1
1: 0
2: 0
3: 23
4: 345
Right 1166679236 19:44757184-44757206 TCCGGGCACGTTGGACCTGGAGG 0: 1
1: 0
2: 0
3: 2
4: 51
1166679225_1166679233 -4 Left 1166679225 19:44757148-44757170 CCCGACCTGCCTGCGAGCCCTGC 0: 1
1: 0
2: 0
3: 23
4: 345
Right 1166679233 19:44757167-44757189 CTGCTGGACAGCGCAGCTCCGGG 0: 1
1: 0
2: 2
3: 51
4: 334
1166679225_1166679235 10 Left 1166679225 19:44757148-44757170 CCCGACCTGCCTGCGAGCCCTGC 0: 1
1: 0
2: 0
3: 23
4: 345
Right 1166679235 19:44757181-44757203 AGCTCCGGGCACGTTGGACCTGG 0: 1
1: 0
2: 0
3: 2
4: 48
1166679225_1166679239 29 Left 1166679225 19:44757148-44757170 CCCGACCTGCCTGCGAGCCCTGC 0: 1
1: 0
2: 0
3: 23
4: 345
Right 1166679239 19:44757200-44757222 CTGGAGGCCCGCAATTATGACGG 0: 1
1: 0
2: 0
3: 5
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166679225 Original CRISPR GCAGGGCTCGCAGGCAGGTC GGG (reversed) Exonic
900013323 1:133746-133768 GCAGGGCTGGGAGTCAGGGCAGG - Intergenic
900043387 1:489733-489755 GCAGGGCTGGGAGTCAGGGCAGG - Intergenic
900064825 1:724730-724752 GCAGGGCTGGGAGTCAGGGCAGG - Intergenic
900289007 1:1915948-1915970 GCAGTGGTGGCAGGCAGGTGTGG + Intronic
900477254 1:2881798-2881820 GCAGGGCCTGCACGCAGCTCTGG - Intergenic
900557977 1:3289597-3289619 GCAAGGCCTGCGGGCAGGTCAGG + Intronic
900587858 1:3442071-3442093 GCAGGGATGGCAGGCAGGCTCGG - Intergenic
900647891 1:3717278-3717300 CCAGGGCTCCCAGCCAGGCCGGG + Intronic
900867421 1:5278286-5278308 GCAAGGCGGGCAGGCAGGTGAGG - Intergenic
901637196 1:10675890-10675912 GCTGGCCTGGCAGGCCGGTCCGG + Intronic
901794505 1:11672663-11672685 GCAGGGGAGGCAGGTAGGTCAGG - Intronic
901798080 1:11691896-11691918 TCCGGGCTCGCAGCCAGGTGGGG - Intronic
902088661 1:13884373-13884395 GCAGGGTTGGCAGGGACGTCAGG - Intergenic
902373016 1:16017241-16017263 GCAGGCCTTGCATGCAGATCCGG + Intronic
902479352 1:16703296-16703318 GCAGGGCACCCTGCCAGGTCTGG + Intergenic
902885071 1:19398758-19398780 GCAGGGCTGGCAGTTAGGGCAGG + Intronic
903137601 1:21319571-21319593 GGAGGGCTCCCAGGAAGGCCAGG - Intronic
903681991 1:25103371-25103393 GCAAGGCTGTCAGGCAGGGCTGG - Intergenic
903887375 1:26548233-26548255 GAAGGGCTCACAGGCTGGGCAGG + Intronic
904562297 1:31406906-31406928 GCAGGGCTGGCAGGCAGTAGGGG + Intergenic
906967651 1:50474312-50474334 GCAGGGCTGGTAGGAAGGTGAGG - Intronic
910879898 1:91913881-91913903 TCAGAGCTAGCAGGAAGGTCGGG + Intergenic
911154153 1:94622872-94622894 GCTGGGGCCACAGGCAGGTCAGG - Intergenic
913041858 1:115034649-115034671 GCAGGGCTGGCATGGAGGTGGGG + Intergenic
914913872 1:151806374-151806396 GCAGGGCTGGCGGGCAGGCCAGG + Intronic
915367200 1:155323105-155323127 GCCGGGCGCGCAGGCCGGCCTGG + Exonic
915616924 1:157046038-157046060 GCAGGGCGCGCAGGGAGGCCGGG - Intergenic
918145317 1:181750995-181751017 GTAGGTATCGCAGGAAGGTCAGG + Intronic
920017737 1:202927153-202927175 GCGGGGCTAGCAGGCGGCTCGGG + Exonic
921189877 1:212699790-212699812 GCAGGGCGCGCGGGCGGGGCGGG - Exonic
922099730 1:222470749-222470771 GCAGGGCTGGGAGTCAGGGCAGG - Intergenic
922261765 1:223950241-223950263 GCAGGGCTGGGAGTCAGGGCAGG - Intergenic
922735315 1:227975501-227975523 GCAGGGCTGGGAGTCAGGGCAGG + Intergenic
923436165 1:233969952-233969974 TCAGGGCTCCCAGGAAGCTCTGG - Intronic
924342930 1:243052416-243052438 GCAGGGCTGGGAGTCAGGGCAGG - Intergenic
1063614708 10:7591701-7591723 GCAGGGCTGGGAGGCAGGGAAGG - Intronic
1065022120 10:21509636-21509658 GCGGGGGGCGCAGGCAGGGCCGG - Intergenic
1066733553 10:38453136-38453158 GCAGGGCTGGGAGTCAGGGCAGG + Intergenic
1067078210 10:43199913-43199935 GCAGGGCTGGCAGGCCAGGCTGG + Intronic
1067786510 10:49253466-49253488 GCAGGGGTGGCAGACAGGTGAGG - Intergenic
1069146289 10:64896020-64896042 GCAGGGCTACCAGGCTGGGCAGG + Intergenic
1072151989 10:92690691-92690713 GCAGGGATCGCAGCCGGGCCCGG + Intronic
1072190160 10:93071913-93071935 GCAGGGGTCACAGGCGGGTCAGG + Intergenic
1072510658 10:96120951-96120973 GCAGGGATGGCAGGGAGGTGGGG - Intergenic
1072687427 10:97546619-97546641 CCAGGGCACGCAGTCAGGTGTGG + Intronic
1072692396 10:97580676-97580698 AGAGGGCTCCCAGGCTGGTCTGG + Intronic
1073074754 10:100816820-100816842 GCTGGGCTGGCAGGCAGGGAAGG + Intronic
1073190953 10:101650419-101650441 GCAGGGCTCTGAGGGAGGTGGGG - Intronic
1074532836 10:114308743-114308765 GCAGGGCAAGCAGGCTGCTCAGG + Intronic
1074819250 10:117166541-117166563 GCGGGGGGCGCAGGCAGGGCGGG + Intergenic
1075095785 10:119469741-119469763 GCAGGGCTGGAGGGCAGGACTGG - Intergenic
1075312760 10:121428610-121428632 GCAGGGATGGCAGCCAGGTGGGG + Intergenic
1076590024 10:131576618-131576640 CCAGGGCAGGCAGGCAGGGCAGG - Intergenic
1076726090 10:132413962-132413984 TGAGGGCTCCCAGGCAGGTGGGG + Intronic
1076870027 10:133188610-133188632 GCAGTGCGCGGAGGCAGGCCAGG - Exonic
1076969660 11:125950-125972 GCAGGGCTGGGAGTCAGGGCAGG - Intergenic
1077159852 11:1107759-1107781 GCAGGGCTGGTGGGCAGGGCAGG + Intergenic
1077206940 11:1349328-1349350 GCAGGGCTGGCAGGCCTGGCAGG - Intergenic
1077299084 11:1838997-1839019 GCAGGGCTGGGAGCGAGGTCAGG - Intronic
1077332731 11:1990483-1990505 GCAGGGCTGCAAGGCAGGGCAGG - Intergenic
1078542226 11:12221793-12221815 GCAGGGCACTCAGGCAGGAAAGG + Intronic
1079450635 11:20597570-20597592 GCAGGCCTGGCAGGCAGGCTCGG - Intergenic
1079661391 11:23041303-23041325 GTGGGGCTTGGAGGCAGGTCTGG - Intergenic
1081656716 11:44862211-44862233 GCAGGGCTGCCAGGCTGGCCTGG - Intronic
1081990968 11:47337401-47337423 GAAGGGCTGGGAGGCAGGGCTGG + Exonic
1083611582 11:64006965-64006987 GCAGGGGTGGCAGGAAGGCCTGG + Intronic
1084118405 11:67055271-67055293 GCAAGGCTGGAAGGCAGGTGGGG - Intergenic
1084170153 11:67397095-67397117 GGAGGGCTCGAAGGGAGCTCTGG - Intronic
1085565042 11:77506040-77506062 GCAGGGCTCCCAGTCAGGTTTGG + Intergenic
1089010017 11:115124521-115124543 GCAGGGAAAGCAGGCAGGTGTGG - Intergenic
1089139676 11:116275695-116275717 GGAGGGCACACAGGCAGGTGAGG + Intergenic
1089463785 11:118669717-118669739 GCAGGAGTCGCAGGGAGGTGGGG + Intronic
1090402668 11:126458942-126458964 GCAGGGCTGGCTGGCTGATCTGG + Intronic
1090496473 11:127217636-127217658 TCAGGGATTTCAGGCAGGTCTGG - Intergenic
1091079803 11:132655605-132655627 GCAGGGCTTGGAGGCTGGGCAGG + Intronic
1202815714 11_KI270721v1_random:45659-45681 GCAGGGCTGCAAGGCAGGGCAGG - Intergenic
1093592275 12:20917341-20917363 GCAGGGCTGGCAGCCAGGCAAGG + Intergenic
1096178359 12:49537972-49537994 GCGGCGCTGGCAGGCAAGTCCGG + Intergenic
1096588812 12:52643835-52643857 GCAGGGCTTCCAGGGAGTTCAGG - Intergenic
1102344657 12:112151936-112151958 GCTGGGCTGGCACCCAGGTCTGG - Exonic
1102491624 12:113292909-113292931 GCAGGGATGGAAGGCAGGTGTGG - Intronic
1103984359 12:124757470-124757492 GCTGGGCTCGCTTGCATGTCTGG - Intergenic
1104411397 12:128561083-128561105 GGAGAGCTGGCAGGGAGGTCTGG - Intronic
1104614532 12:130256926-130256948 GCAGGGCTGGCCGGCTGCTCCGG + Intergenic
1104912278 12:132245007-132245029 GCAGGGAGGGCAGGGAGGTCAGG + Intronic
1104984221 12:132587538-132587560 CCTGGGCTCGCAGGTAGTTCTGG - Intergenic
1106782783 13:33076553-33076575 CCCGGGCTCCCAGGCAGGGCTGG + Intergenic
1107922171 13:45220557-45220579 GGAGGGCTCCCAGGCAGGAATGG + Intronic
1108732357 13:53248096-53248118 CCAGGGCACTCATGCAGGTCTGG - Intergenic
1111672246 13:91347319-91347341 GCAGGGCTCCCAGGAAGCCCCGG + Intergenic
1112415592 13:99201056-99201078 GCAGGGTTCGGACGCGGGTCTGG - Intronic
1115442916 14:33456756-33456778 GCAGAGCTGGCATGCAGCTCAGG + Intronic
1119717429 14:76868808-76868830 GCAGGGCTTGCAGCTGGGTCTGG - Intronic
1120678746 14:87453673-87453695 GAAGGGATTGCAGGCAGGGCAGG + Intergenic
1120978037 14:90266641-90266663 ACAGGGCTGGGAGGCAGGACTGG + Intronic
1121117164 14:91351915-91351937 GCAGGCGTGGCAGGCAGGTGGGG - Intronic
1121464251 14:94103970-94103992 GCTGGGCTCGCTGCCATGTCTGG - Intergenic
1122153286 14:99736004-99736026 GCAGGGGTCGCTGGCAGGGCTGG - Intergenic
1122469325 14:101955707-101955729 GCTGGGCACGCAGGAAGGCCTGG - Intergenic
1123038184 14:105479745-105479767 CCTGGGCTTGCAGGCAGGACTGG - Intronic
1123423305 15:20148503-20148525 GCAGGCCTGGCACCCAGGTCAGG + Intergenic
1123532526 15:21155024-21155046 GCAGGCCTGGCACCCAGGTCAGG + Intergenic
1123676625 15:22715355-22715377 GCAGGCCTCGGAGGCAGGGGAGG - Intergenic
1124110627 15:26781968-26781990 GCAAGCCTCGCAGGCAGCCCCGG + Intronic
1124328843 15:28789618-28789640 GCAGGCCTCGGAGGCAGGGGAGG - Intergenic
1124355945 15:28994883-28994905 GAAGGGCTCGCAGCCTGGCCCGG + Intronic
1125284460 15:38077026-38077048 GCGGGCCTCCCAGTCAGGTCTGG - Intergenic
1125577519 15:40765736-40765758 TCAGGGCTAGCAGGCAGGGGAGG + Exonic
1126852498 15:52805779-52805801 CCAGGGCCCGCGCGCAGGTCGGG - Intergenic
1128255113 15:66190621-66190643 GCAAGGATCTCAGACAGGTCAGG - Intronic
1130382016 15:83379382-83379404 GCAGGGCTTGGAGGCAGGGTGGG - Intergenic
1131262182 15:90893220-90893242 GTAGGGCGCGCAGCCTGGTCAGG + Intronic
1131524254 15:93139981-93140003 GCAGGGCCGGCAGGGATGTCAGG + Intergenic
1132352615 15:101149171-101149193 TCAGGGGTCGCAGGCAAGACTGG - Intergenic
1132709840 16:1261509-1261531 GCAGGGCAGGCAGGCAGGGCGGG + Intergenic
1132767470 16:1541737-1541759 CCAGGGCTTGCAGGCAGGTGAGG + Intronic
1134092942 16:11401269-11401291 GCAGGGGTGGCAGGCAGAGCCGG - Exonic
1134682659 16:16137234-16137256 GCTGGGCTCACATGCATGTCTGG + Intronic
1136107514 16:28040709-28040731 TCTGGGCTTGCAGGCAGGTGGGG + Intronic
1137504507 16:49041402-49041424 CCAGGGCTGGCAGGCAGAGCTGG - Intergenic
1138453581 16:57107822-57107844 GCAGGGCTCACAGTCCAGTCTGG - Intronic
1138554698 16:57764640-57764662 GCAGGGCTGGCAGGTTGGTCTGG + Intronic
1138591040 16:58000103-58000125 GCTGGGCCTGCAGGCAGGGCCGG - Intronic
1139349976 16:66328788-66328810 GCAGGTGTCATAGGCAGGTCAGG + Intergenic
1139853390 16:69963531-69963553 GCAGGGCTCGATGGCAGCCCAGG - Intronic
1139882359 16:70186440-70186462 GCAGGGCTCGATGGCAGCCCAGG - Intronic
1140370150 16:74409064-74409086 GCAGGGCTCGATGGCAGCCCAGG + Intronic
1141132695 16:81446072-81446094 CCAGGGCTGGCAGGCAGAACGGG + Intronic
1142308859 16:89300446-89300468 GCTGTGCTCGCAGGCGGGGCAGG - Intronic
1142451017 16:90173172-90173194 GCAGGGCTGGGAGTCAGGGCAGG + Intergenic
1142456546 17:60523-60545 GCAGGGCTGGGAGTCAGGGCAGG - Intergenic
1143012324 17:3872711-3872733 GCAGGGGTAGGGGGCAGGTCTGG + Intronic
1143264913 17:5629052-5629074 GCAGGGCTCAGAGCCAGTTCGGG - Intergenic
1143275036 17:5704011-5704033 GAAGGGCTTGCAGGCAGGTAGGG - Intergenic
1144687911 17:17238254-17238276 GCAGCGCGCACAGGCGGGTCAGG - Intergenic
1144909992 17:18672793-18672815 GCAGGGCTCGCTTGGAGCTCCGG + Intronic
1145101391 17:20080727-20080749 TAAGGGCTCGCAGGCAGCACAGG - Intronic
1145274618 17:21422225-21422247 GCAGAGCTCGCAGCCTGGTGAGG - Intergenic
1145840983 17:27994244-27994266 GCAGGGGTTGCAGGGTGGTCGGG + Intergenic
1145988047 17:29060796-29060818 GCAGACCACGAAGGCAGGTCAGG + Intergenic
1146288554 17:31591753-31591775 GGAGGGCCCTTAGGCAGGTCCGG + Intergenic
1147647567 17:42043030-42043052 GCAGGGGTCGTAGCCAGGCCTGG + Intronic
1147961154 17:44168424-44168446 GCAGGGCCAGGAGGCAGGACAGG + Intergenic
1148152552 17:45405145-45405167 GCAGGGCCAGCAGGCAGTACTGG - Intronic
1148220719 17:45859865-45859887 GCAGGATTCTCAGGCAAGTCTGG + Intergenic
1149474612 17:56949527-56949549 GTAGGGCTCCCAGACTGGTCGGG - Intronic
1151218336 17:72592784-72592806 GCAGGGCGCGCAGGCGGCGCGGG - Intergenic
1151582361 17:74987735-74987757 TCCGGGCCCGCAGGCGGGTCTGG - Exonic
1152484892 17:80584020-80584042 GCAGGCCCCACAGCCAGGTCTGG - Intronic
1152582167 17:81170945-81170967 GCAGGGCCCTCAGGCAGGAGGGG + Intergenic
1152632309 17:81415765-81415787 GCAGGGCTGGGGGGTAGGTCAGG - Intronic
1153227682 18:2910525-2910547 ACAGAGCTCCCAGGCAGGTGTGG + Intronic
1153880522 18:9418200-9418222 GCAGGCCTGGCAGGCGGGGCAGG + Intergenic
1154037283 18:10815314-10815336 GCAGGGCTCGAATCCATGTCTGG - Intronic
1157896464 18:51473313-51473335 GCAGGGCTCCCACGTAGGCCAGG + Intergenic
1159868407 18:73732892-73732914 GCAGTGGTCCCAGGCAGGTCTGG + Intergenic
1160490397 18:79332916-79332938 GCAGGGATGGCAGGAAGGGCTGG - Intronic
1160646464 19:195876-195898 GCAGGGCTGGGAGTCAGGGCAGG - Intergenic
1160659361 19:291119-291141 GCGGGGCGCGGAGGGAGGTCTGG + Exonic
1160749734 19:728153-728175 GCTGGGCCCGCAGGAAGCTCGGG + Intronic
1160814932 19:1030757-1030779 GCAGGGCGGGGAGGCAGATCCGG + Intronic
1161157171 19:2738554-2738576 GGAGGCCTCGCTGGAAGGTCAGG - Intronic
1161576910 19:5059422-5059444 GCTTGGCTCGCAATCAGGTCAGG - Intronic
1162017220 19:7852194-7852216 GCAGGGCCTCCAGGCAGGCCGGG - Intronic
1162960067 19:14120395-14120417 GCAGGACTCGCTGGGAGGCCTGG + Exonic
1163298065 19:16425183-16425205 GGGGGGCTGGCAGGCAGGACGGG + Exonic
1163587644 19:18172852-18172874 GGAGGGCTCAGAGGCAGGTGGGG - Exonic
1163604373 19:18266039-18266061 TCATGGCTGGCAGGCGGGTCTGG + Exonic
1164822604 19:31261894-31261916 GCTGGGCTCGCAGACAGGGAGGG - Intergenic
1165719241 19:38067333-38067355 GCAAGGCTCCCACACAGGTCAGG - Intronic
1165884849 19:39070813-39070835 GCAGGTCTCGCAGGGAGAACAGG - Intergenic
1166679225 19:44757148-44757170 GCAGGGCTCGCAGGCAGGTCGGG - Exonic
1166694520 19:44844996-44845018 CCAGGGCGCGCAGGGAGGTAGGG + Intergenic
1166920618 19:46226821-46226843 CCAGGGCTCCCGGGCAGGGCTGG - Intergenic
1167017263 19:46849441-46849463 GCAGGGGTCCCAGGCAGGAAGGG + Intronic
1167374979 19:49106069-49106091 ACAGGGCTGGGAGGCAGGACAGG - Intronic
1167386721 19:49168039-49168061 GCAGGTCCTGCAGCCAGGTCTGG - Exonic
1167774887 19:51548467-51548489 TCAGGGCTTGGGGGCAGGTCTGG + Intergenic
1202713391 1_KI270714v1_random:29202-29224 GCAGGGCACCCTGCCAGGTCTGG + Intergenic
925887318 2:8404042-8404064 GCAGAGTTCGCTGGCATGTCAGG - Intergenic
925907117 2:8546139-8546161 CCAGGGCTCCCAGGCATGGCAGG + Intergenic
926206103 2:10835290-10835312 ACAGGGCTGGCAGGCGGGTGAGG + Intronic
927679717 2:25131671-25131693 GCACCGCGCGCAGGCAGGGCAGG - Intronic
928084460 2:28337173-28337195 GCAGGGCTAGAAGGCAAGCCTGG + Intronic
928419669 2:31128610-31128632 GCAGGGTTTGCTGGCAGGACAGG - Intronic
931864949 2:66399549-66399571 CCAGGGGTGGCAGGCTGGTCAGG - Intergenic
932340464 2:70960088-70960110 GCAGGGCCAGCAGGCATGGCTGG + Intronic
933762451 2:85681668-85681690 GTAGGGCTCGCAGCCAGGTGAGG + Intergenic
933766461 2:85712571-85712593 GCTGGGCTCGCAGGGAGTTCAGG + Intergenic
934688063 2:96335911-96335933 GCAGGGCTGGCGGGCTGGCCTGG + Intronic
934845177 2:97657661-97657683 GCAGGGCCCGCAGGCAGCCATGG - Intronic
935258096 2:101330500-101330522 GCAGGGCTCCAAGGCTGGTGGGG - Intergenic
937273636 2:120670871-120670893 GAAGGTCTCCCAGTCAGGTCTGG + Intergenic
938089492 2:128422009-128422031 GCAGGGCCCGCAGCCAGACCAGG + Intergenic
938468144 2:131536156-131536178 GCAGGGCTGTGAGGCAGGGCAGG - Intergenic
938501133 2:131831772-131831794 GCAGGGCTGGGAGGCAGGGAAGG - Intergenic
938708201 2:133952243-133952265 GCAGGGCTGGAAAGCAGGCCTGG - Intergenic
939293565 2:140225494-140225516 TCAGGGGTGGCAGGCAGGTATGG + Intergenic
941911703 2:170770849-170770871 GCGGGGCTGGGAGGCGGGTCCGG - Intergenic
945251036 2:207767037-207767059 GCCGCGCTCACAGGCAGGACCGG - Exonic
946254426 2:218432550-218432572 GCTGGGGTTGCAGGTAGGTCAGG + Intronic
947680063 2:232022456-232022478 GCAGGGCACTCAGACAGGCCAGG - Intronic
947864901 2:233389804-233389826 GCAGGGCTGGGAGTCAGGCCTGG - Intronic
947917091 2:233839667-233839689 GAAGGGCTCGCAGGCCAGGCGGG + Intronic
948087232 2:235261647-235261669 CAATGGCTCTCAGGCAGGTCAGG - Intergenic
948289641 2:236815789-236815811 CCAGGGCTCTCCAGCAGGTCTGG + Intergenic
948622461 2:239244894-239244916 GCAGAGCTCCCAGGGAGGGCCGG - Intronic
948770600 2:240249694-240249716 GCGGGGGTTGCAGGCAGGTGGGG - Intergenic
948884008 2:240874097-240874119 GCTGGGCTTGCAGGGAGCTCAGG + Intronic
948894123 2:240920428-240920450 ACAGGGCTCCCGGGCAGGTGCGG - Intronic
1169171783 20:3471165-3471187 GCAGCGCTCGCGGGCAGGAGCGG + Exonic
1169208481 20:3753057-3753079 TCAGGGCTCTCAGGCAGGTGGGG - Exonic
1170641650 20:18159352-18159374 GCATGGCTCGCAGGCCTCTCTGG + Intronic
1171438816 20:25145242-25145264 GCAGGGGGCACAGGCAGGCCTGG + Intergenic
1172618483 20:36305706-36305728 GCAGGGCTGGTACGCAGTTCAGG + Intergenic
1173202792 20:40966486-40966508 GCAGGGCTACCAGGCAGCTCTGG + Intergenic
1173490016 20:43472210-43472232 CCAAGGCTCACAGGCAGCTCTGG - Intergenic
1174340658 20:49893064-49893086 GCCGCCCTCGCAGGCAGGGCTGG - Intergenic
1175082043 20:56428918-56428940 TCAGGGCTGGGGGGCAGGTCGGG - Intronic
1175369720 20:58480139-58480161 TCAGGGCTGGCAGGCAAGTTGGG + Intronic
1175914834 20:62420979-62421001 GGAGAGCTCCCAGGCAGGGCTGG + Intronic
1176061779 20:63175723-63175745 GGAGGGCTCTCTGGCAGGCCGGG - Intergenic
1176102651 20:63371617-63371639 ACAGGGCACGCAGGGACGTCTGG - Intronic
1176279043 20:64290340-64290362 GCAGGGCTGGGAGTCAGGGCAGG + Intergenic
1176306368 21:5125470-5125492 ACAGGGCTGTCAGGCAGGACAGG + Intronic
1179375555 21:40847132-40847154 GCCCGGCTCGCAGGCAGGGAAGG - Exonic
1179850690 21:44136560-44136582 ACAGGGCTGTCAGGCAGGACAGG - Intronic
1180858101 22:19060789-19060811 GCGGGGCTCACAGGCTGGTGTGG + Intronic
1180974837 22:19842593-19842615 GCAGCCCTCCCTGGCAGGTCTGG - Intronic
1181052022 22:20242376-20242398 GCAGGGCACGCAGGGGGGCCAGG + Exonic
1181107932 22:20585662-20585684 GCAGGGCTGTGAGGCAGGGCAGG + Intronic
1181528229 22:23502105-23502127 GAAGGGCACACAGGCAGGTTGGG - Intergenic
1182555612 22:31126977-31126999 GCACGTCTCGCAGGAAGGGCAGG - Exonic
1182631740 22:31691232-31691254 GCTGGGATCACAGGCATGTCGGG + Intronic
1183598495 22:38826473-38826495 GCAGGGCTGGCAGGGAGGGCTGG - Intronic
1183704504 22:39468633-39468655 GCAGGGCTCTCAGGCCTGTCTGG - Intronic
1183780271 22:39994930-39994952 GCAGAGCTCGCGGCCAGGTGAGG + Exonic
1183987381 22:41576971-41576993 CCAGGGCAGGCAGGCAGGGCAGG + Exonic
1184060684 22:42079315-42079337 GCGGGGCTTCCAGGCAGGGCTGG - Exonic
1184119148 22:42439058-42439080 GGAGGGCTCGCAGGAGGGACTGG + Intergenic
1184161836 22:42701637-42701659 GCAGGGCCCACAGGCAGGGGTGG - Intronic
1184292536 22:43505725-43505747 ACTGGCCTAGCAGGCAGGTCAGG + Exonic
1184332516 22:43835156-43835178 GCAGGCCACGCAGGAAGCTCAGG - Intronic
1184414135 22:44342314-44342336 CAAGGGCTCTCAGGCAGATCGGG + Intergenic
1185061734 22:48610542-48610564 GGCAGGCTCGCAGGCAGCTCGGG + Intronic
1185061751 22:48610606-48610628 GGCAGGCTCGCAGGCAGCTCGGG + Intronic
1185078276 22:48694865-48694887 GGAAGGCTCACAGGCAGGTGGGG - Intronic
950115087 3:10445599-10445621 GCACGGCTGGCAGCCAGCTCAGG - Intronic
950315531 3:11998690-11998712 GCAGAGCTAAAAGGCAGGTCTGG - Intergenic
952743863 3:36760171-36760193 TCAGGCCTCCTAGGCAGGTCTGG - Intergenic
953045902 3:39294121-39294143 GCAGGACTCGAAGCCAGGCCTGG + Intergenic
954134385 3:48575373-48575395 CCCGGGCTCCCAGGCAGGGCTGG - Exonic
954138105 3:48591568-48591590 ACAGGGCTCACAGGCAGCTCTGG + Exonic
954430028 3:50465725-50465747 GCATGCCTTGCAGGCAGGCCAGG - Intronic
955856532 3:63278715-63278737 CCAGGGCTCGCAGGAAGGCAAGG - Exonic
960487304 3:118269784-118269806 GCTGGCCTGGCAGGCAGGGCCGG - Intergenic
961464512 3:127073091-127073113 GCAGGCCTGGCAGGCAGGGAGGG + Intergenic
961519261 3:127457201-127457223 GCAGGGGGCGCAGAGAGGTCAGG - Intergenic
961524324 3:127486913-127486935 AAGGGGCTCCCAGGCAGGTCTGG - Intergenic
965327645 3:167327676-167327698 GGAGGGGAGGCAGGCAGGTCAGG + Intronic
965873563 3:173289350-173289372 GCAGGACTGGTTGGCAGGTCTGG + Intergenic
966433862 3:179861466-179861488 GCAAGGCCCGCAGGCAGCACAGG + Intronic
966882821 3:184359687-184359709 GCTGGGCTGGCAGGCTGGTGGGG - Intronic
968371217 3:198223650-198223672 GCAGGGCTGGGAGTCAGGGCAGG + Intergenic
968481619 4:835540-835562 GCCGAGCTCTCAGGCAGGTTTGG - Intergenic
968642229 4:1720571-1720593 GCAGGGCTTGCTGGGAGGTCAGG - Intronic
969575158 4:8032427-8032449 GCAGGGCTGGCAGACATATCGGG + Intronic
969599198 4:8166076-8166098 GCAGGGCAGGCAGGCAACTCAGG - Intergenic
969614164 4:8242642-8242664 CCAGGACTCTGAGGCAGGTCGGG - Intergenic
972815488 4:42640703-42640725 GAAGGGCTCACAGGCAGGGATGG - Intronic
973639631 4:52890102-52890124 GTAGGGCTGGAAGGAAGGTCTGG - Intronic
979259902 4:118636123-118636145 GCAGGGCTGGGAGTCAGGGCAGG + Intergenic
979328389 4:119404087-119404109 GCAGGGCTGGGAGTCAGGGCAGG - Intergenic
979328482 4:119404502-119404524 GCAGGGCTGGGAGTCAGGGCAGG - Intergenic
979825719 4:125229849-125229871 GCAGGGCTGGCCGGCTGCTCCGG + Intergenic
985790812 5:1926144-1926166 GCAGGGCTGGAGGGCAGGGCTGG - Intergenic
985846286 5:2351870-2351892 GCAGAGCTCCCAGGCAGGGTGGG - Intergenic
986967985 5:13298544-13298566 GCAGGGCTGGTAGGGAGGTGGGG + Intergenic
988536080 5:32070420-32070442 GCACAGCTTTCAGGCAGGTCGGG - Intronic
988707865 5:33743257-33743279 GCAGGCCTCGGAGGCAGTCCAGG + Intronic
988825309 5:34929677-34929699 GCCGGGCTCGCTGGCTGGCCCGG + Exonic
989206012 5:38809546-38809568 TCAGGGCTCTCAGGAAGGACAGG + Intergenic
989319808 5:40121315-40121337 GCAGGGCCTGCAGCCAGATCAGG - Intergenic
989401775 5:41015431-41015453 GCAGGGTTTGCAGGAAGGGCTGG - Exonic
996864878 5:128109335-128109357 GCAGGGCAGGCATGCAGGGCAGG - Intronic
997207538 5:132058895-132058917 GCAGGGCTGACCTGCAGGTCTGG + Intergenic
1001399286 5:171437219-171437241 GCAGGGTTGGCAGGCAGGCGGGG - Intronic
1001412535 5:171521040-171521062 GCAGAGCTTGCAGGCAGGCAGGG + Intergenic
1001797999 5:174518298-174518320 GCAGGGGTCTCAGGCAGATGTGG - Intergenic
1002436507 5:179234941-179234963 GGAGGGTTGGCAGGCAGGTCAGG - Intronic
1002730456 5:181329196-181329218 GCAGGGCTGGGAGTCAGGGCAGG + Intergenic
1002754077 6:144908-144930 GCAGGGCTGGGAGTCAGGGCAGG - Intergenic
1003095055 6:3135951-3135973 GCAGTGTTCGCAGGCAGGCCGGG - Intronic
1003540287 6:7012602-7012624 GCAGGGCCCAGAGGCAGGTTTGG + Intergenic
1006631823 6:35435697-35435719 GCAGGGCTCGCCGGCACTCCTGG - Intergenic
1006818141 6:36867592-36867614 GCAGGGCAGGCACGCAGGGCTGG + Intronic
1007414100 6:41682219-41682241 GCAGGACTCCCAGGCAGGATGGG + Intergenic
1007716062 6:43856998-43857020 GCAGAGCTTACAGGCAGGCCTGG + Intergenic
1008054932 6:46936385-46936407 GCAGGTTTGGCAGGCAGATCTGG - Intronic
1009998577 6:70925014-70925036 GCAGGACTGGTTGGCAGGTCAGG - Intronic
1012713554 6:102639167-102639189 GAGGGGCTCGGAGGCAGGTGGGG + Intergenic
1012975798 6:105779784-105779806 GCAGGACTGGCAGGGAGGTGGGG + Intergenic
1013273320 6:108561320-108561342 GCAGGGCTCGCTTGGAGCTCCGG - Exonic
1014551877 6:122798467-122798489 GCAGGGCTGGGAGGGAGGTGTGG - Intronic
1016556120 6:145340745-145340767 TCAGGGCTTGCAAGCATGTCAGG - Intergenic
1017654997 6:156619125-156619147 TCAGGGTGCGCAGGCAGGGCTGG - Intergenic
1018805590 6:167257057-167257079 GCTGGGATCGCAGGCATGCCTGG + Intergenic
1019434432 7:1014891-1014913 GGAGGGCCCGCAGGCAGGAAGGG - Intronic
1019506931 7:1396027-1396049 GCAGGTCTGGCAGCCAGGGCTGG - Intergenic
1019731013 7:2629696-2629718 GCAGGGCTGCCAGGCTGGTGTGG + Intergenic
1019744118 7:2689898-2689920 CCAGGGCTCACATGCAGCTCTGG + Intronic
1023401621 7:39795747-39795769 GCAGGGCTGGGAGTCAGGGCAGG + Intergenic
1023852925 7:44160148-44160170 GCAGGGCTCACACCCAGGTTTGG + Intronic
1023938286 7:44754978-44755000 GCAGGGCTCCAGGGCATGTCTGG + Intronic
1024237716 7:47410432-47410454 TCAGGCCTGGAAGGCAGGTCTGG - Intronic
1024647997 7:51384928-51384950 GCAGGGCTGGGAGTCAGGGCAGG - Intergenic
1026224298 7:68427133-68427155 GCGGAGCTCCCAGGCAGGTTAGG - Intergenic
1026829224 7:73600947-73600969 GCACGGATCACAGGCTGGTCAGG - Intronic
1029597840 7:101547088-101547110 GCAGTGCTGGGAGGCTGGTCCGG - Intronic
1030121212 7:106112317-106112339 GCCGGGCTCGGAGGCGGGCCCGG + Intronic
1032047776 7:128623733-128623755 GCATGACTCGCCGGCAGCTCTGG - Intergenic
1032052126 7:128656116-128656138 GCAGGGCTGGGAGTCAGGGCAGG + Intergenic
1032164051 7:129531879-129531901 GAAGGGCGAGCAGGCAGGTGTGG - Intergenic
1032489063 7:132310387-132310409 GCAAGGCTCCCTGGCAGCTCTGG + Intronic
1034238212 7:149589249-149589271 GTAGAGCTAGCAGGCAGGTGTGG - Intergenic
1034241309 7:149613245-149613267 GTAGAGCTGGCAGGCAGGTGTGG - Intergenic
1035565027 8:635594-635616 GCAGGGTCCTCTGGCAGGTCGGG - Intronic
1037522411 8:19692883-19692905 GAAGGGCTCTCAGGCAGATGAGG + Intronic
1037540116 8:19862649-19862671 GCAGGTCTCCAAGGCAGTTCTGG - Intergenic
1037748174 8:21662830-21662852 GCAAGGGTGGCAGGCAGATCTGG - Intergenic
1039879006 8:41611945-41611967 TCAGCGCTCGCACGCAGATCCGG - Exonic
1042102099 8:65284737-65284759 GCAAGGCTCTCAAGCAGGTCTGG - Intergenic
1047773412 8:128049152-128049174 GCAGGGCTGGCAGGGAGGCTGGG + Intergenic
1048906771 8:139096352-139096374 TGAGGGCTCGCAGGAATGTCAGG + Intergenic
1049166301 8:141128338-141128360 CCAGGGCCCGCAGGCGGGTTAGG + Intronic
1049230417 8:141478771-141478793 CCAGGGGTGGCAGGCAGGTGAGG + Intergenic
1049431342 8:142566725-142566747 GCAGGGCCCGCAGCCAGCGCTGG + Intergenic
1049603001 8:143516658-143516680 GCAGGGCTCCCAGGAGGGGCCGG - Intronic
1050602761 9:7269250-7269272 GCAGGGCTCACTGGCAGGTTAGG + Intergenic
1050737595 9:8781712-8781734 GCAGGGGATGCAGGAAGGTCAGG + Intronic
1052376525 9:27723975-27723997 GCAGGGTTCCCAGGTAGGACAGG - Intergenic
1057185817 9:93057274-93057296 ACAGGGCTGGGAGGGAGGTCTGG - Intergenic
1057541461 9:95976313-95976335 CCAGGGCTCCCACCCAGGTCAGG - Intronic
1057911858 9:99025805-99025827 GCAGGGTTGGGAGGCAGGTGAGG - Intronic
1058317531 9:103586909-103586931 GCAGGGCTTGCGGCCAGATCAGG - Intergenic
1058838368 9:108880052-108880074 GCAAGCCCAGCAGGCAGGTCTGG - Exonic
1059734843 9:117090771-117090793 TCAGGACTCACAGCCAGGTCTGG + Intronic
1060551472 9:124487531-124487553 GGAGGGCGCGGAGGCAGGTAAGG - Intronic
1060771948 9:126338236-126338258 GCAGGGCCCTCTGGCAGGCCAGG + Intronic
1061406430 9:130395133-130395155 GCAGGGCCGGGAGGCAGGACGGG + Intronic
1061679280 9:132235004-132235026 GCAAGGCAGGCAGGCAGGGCTGG - Intronic
1061841993 9:133364136-133364158 CCAGGGCTCTCAGTCAGCTCCGG + Intronic
1062085340 9:134645318-134645340 GCAGGGCAGGCAGACAGGCCAGG - Intronic
1062363230 9:136197362-136197384 GCGGGGCTGGCAGGGAAGTCGGG + Exonic
1062472614 9:136712967-136712989 GCAGGGACCGCCTGCAGGTCGGG - Intronic
1062623629 9:137433542-137433564 GCAGTGCCCGCAGGCTGGACAGG - Exonic
1062754866 9:138281706-138281728 GCAGGGCTGGGAGTCAGGGCAGG + Intergenic
1203578774 Un_KI270745v1:25875-25897 GCAGGGCTGGGAGTCAGGGCAGG + Intergenic
1186502690 X:10064779-10064801 GCTGCCCTCCCAGGCAGGTCCGG + Intronic
1190873731 X:54445552-54445574 GCAGGGCCAGCGGGCAGGACAGG - Exonic
1191174513 X:57484947-57484969 GCTGAACTCTCAGGCAGGTCAGG + Intronic
1192150133 X:68706969-68706991 GCAGGGCTAGGAGGCAGGCAAGG - Intronic
1193485391 X:82080291-82080313 GCAGGGCTTGCAGTCAGATCTGG + Intergenic
1193601437 X:83511366-83511388 GCAGCGCCCCCAGCCAGGTCTGG - Intergenic
1198312640 X:135436715-135436737 GCAGGCCTCGCTCGCGGGTCCGG - Intergenic
1199557002 X:149120521-149120543 GCAGGGGTGGCAGGCAGGGTTGG + Intergenic
1200846636 Y:7837380-7837402 GCAGGGTTGTCAGGCAGATCTGG - Intergenic
1202381394 Y:24278493-24278515 GCAGGGCTGGGAGTCAGGGCAGG + Intergenic
1202489391 Y:25391633-25391655 GCAGGGCTGGGAGTCAGGGCAGG - Intergenic