ID: 1166679226

View in Genome Browser
Species Human (GRCh38)
Location 19:44757149-44757171
Sequence AGCAGGGCTCGCAGGCAGGT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 279}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166679226_1166679239 28 Left 1166679226 19:44757149-44757171 CCGACCTGCCTGCGAGCCCTGCT 0: 1
1: 0
2: 0
3: 28
4: 279
Right 1166679239 19:44757200-44757222 CTGGAGGCCCGCAATTATGACGG 0: 1
1: 0
2: 0
3: 5
4: 39
1166679226_1166679236 12 Left 1166679226 19:44757149-44757171 CCGACCTGCCTGCGAGCCCTGCT 0: 1
1: 0
2: 0
3: 28
4: 279
Right 1166679236 19:44757184-44757206 TCCGGGCACGTTGGACCTGGAGG 0: 1
1: 0
2: 0
3: 2
4: 51
1166679226_1166679232 -6 Left 1166679226 19:44757149-44757171 CCGACCTGCCTGCGAGCCCTGCT 0: 1
1: 0
2: 0
3: 28
4: 279
Right 1166679232 19:44757166-44757188 CCTGCTGGACAGCGCAGCTCCGG 0: 1
1: 0
2: 3
3: 28
4: 228
1166679226_1166679234 3 Left 1166679226 19:44757149-44757171 CCGACCTGCCTGCGAGCCCTGCT 0: 1
1: 0
2: 0
3: 28
4: 279
Right 1166679234 19:44757175-44757197 CAGCGCAGCTCCGGGCACGTTGG 0: 1
1: 0
2: 1
3: 9
4: 120
1166679226_1166679235 9 Left 1166679226 19:44757149-44757171 CCGACCTGCCTGCGAGCCCTGCT 0: 1
1: 0
2: 0
3: 28
4: 279
Right 1166679235 19:44757181-44757203 AGCTCCGGGCACGTTGGACCTGG 0: 1
1: 0
2: 0
3: 2
4: 48
1166679226_1166679233 -5 Left 1166679226 19:44757149-44757171 CCGACCTGCCTGCGAGCCCTGCT 0: 1
1: 0
2: 0
3: 28
4: 279
Right 1166679233 19:44757167-44757189 CTGCTGGACAGCGCAGCTCCGGG 0: 1
1: 0
2: 2
3: 51
4: 334

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166679226 Original CRISPR AGCAGGGCTCGCAGGCAGGT CGG (reversed) Exonic
900091573 1:923073-923095 ATCTGGGCACGCAGGGAGGTGGG + Intergenic
900436645 1:2634197-2634219 ACCAGGGCTGTCGGGCAGGTGGG - Intergenic
900573933 1:3373763-3373785 AGCAGGGATTGCAGCCAGGAAGG + Intronic
900780765 1:4615821-4615843 AGGAGGGGGCACAGGCAGGTTGG + Intergenic
900923865 1:5690978-5691000 AGCATAGCTGGCAGGCAGGCCGG + Intergenic
900998655 1:6136423-6136445 AGCAGGTCTCACAGCCAGGATGG + Intronic
901003893 1:6162465-6162487 AGCAGGGCTCTGAGCCAGGGTGG + Intronic
901192706 1:7422090-7422112 AGCAGGGCTGACTGGCAGGAGGG + Intronic
901440288 1:9273525-9273547 AGCAGGGATGGCAGCCAGGGGGG + Intergenic
901798081 1:11691897-11691919 GTCCGGGCTCGCAGCCAGGTGGG - Intronic
903277068 1:22229019-22229041 AGCAGGGGTGGCTGGCAGATGGG + Intergenic
904259314 1:29279428-29279450 GGCAGGATTGGCAGGCAGGTGGG - Intronic
904447734 1:30588493-30588515 AGCAGTGGTCGCAGACAGGAAGG - Intergenic
904472490 1:30744760-30744782 AGCAGGGCTCTGAGGCATTTTGG - Intronic
904562296 1:31406905-31406927 TGCAGGGCTGGCAGGCAGTAGGG + Intergenic
904971387 1:34421847-34421869 AGAAGGGCTGACAGGCAGATGGG + Intergenic
905012962 1:34759522-34759544 AGCCTGGCTCCCAGGCAGGCAGG - Intronic
908187252 1:61664243-61664265 ATCAGGGCCAGCAGTCAGGTAGG - Intergenic
909949312 1:81701029-81701051 AGCAGGGCTGGCAAGCAGACAGG + Intronic
913041857 1:115034648-115034670 AGCAGGGCTGGCATGGAGGTGGG + Intergenic
915230174 1:154439856-154439878 AGGAAGGCAGGCAGGCAGGTAGG - Intronic
915468627 1:156112948-156112970 GGCAGGGCATGCAGGCAGATGGG + Intronic
915616925 1:157046039-157046061 GGCAGGGCGCGCAGGGAGGCCGG - Intergenic
919741693 1:200984833-200984855 AGCAGGGCTGGAGGGCAAGTGGG - Intronic
920007807 1:202846021-202846043 AACAGGGCTCGGAAGCAGGTGGG + Intergenic
921395674 1:214666695-214666717 AGCTGGGCTTGCAGGTAGGATGG - Intergenic
924320185 1:242840743-242840765 AGTAGGGATCTGAGGCAGGTAGG + Intergenic
924518968 1:244789192-244789214 AGCAGAGCAGGCAGGCAGGCCGG - Intergenic
924942265 1:248820398-248820420 AGCTGGGCCCCCAGGGAGGTAGG - Intronic
1065916001 10:30355463-30355485 AGCAGGGCTCTTAGCCAGGATGG + Intronic
1066153582 10:32650921-32650943 GGAGGGGCTGGCAGGCAGGTGGG + Intronic
1066580864 10:36880576-36880598 AGCATGGCATGCAGGCAGATGGG + Intergenic
1067718060 10:48704660-48704682 AGCAGTGCACACAGGCAGCTGGG - Intronic
1069621946 10:69842812-69842834 AGCAGGCCTGGCAGGGAGCTGGG - Intronic
1069861701 10:71475676-71475698 AGCAGGGATGGCAGGCTGGGAGG + Intronic
1070784790 10:79156583-79156605 AGCAGGCCCAGCAGGCAGGCTGG + Intronic
1072050865 10:91701668-91701690 AGCATGGCTGGAGGGCAGGTGGG + Intergenic
1072510659 10:96120952-96120974 GGCAGGGATGGCAGGGAGGTGGG - Intergenic
1073190954 10:101650420-101650442 TGCAGGGCTCTGAGGGAGGTGGG - Intronic
1074569966 10:114615348-114615370 AGCTGGGCTCGCAAACAGCTGGG - Intronic
1074834299 10:117274524-117274546 TGCACGGCTCCCAGGCAGGCAGG - Intronic
1075312759 10:121428609-121428631 AGCAGGGATGGCAGCCAGGTGGG + Intergenic
1075475117 10:122727679-122727701 AGGAGGGGCCGCGGGCAGGTGGG + Intergenic
1075929816 10:126286275-126286297 AGCAGGTCTGGCAGGCAGGAGGG + Intronic
1076196142 10:128519729-128519751 AGCAGGGCTCCACGGCAGGGAGG - Intergenic
1076561804 10:131371836-131371858 AGTAGGGCTGGCAGGGAGGAAGG - Intergenic
1076726089 10:132413961-132413983 CTGAGGGCTCCCAGGCAGGTGGG + Intronic
1076847329 10:133075683-133075705 AGCAGGGCTGGCAGGAGGCTGGG + Intronic
1077267109 11:1656391-1656413 AGCAGGGCTGGCTGTCAAGTGGG + Intergenic
1077328001 11:1971938-1971960 ACCAAGGCTGGCAGGCACGTGGG + Intronic
1077412477 11:2410094-2410116 AGGTGGGGTCGCAGGCAGGCAGG + Intronic
1080440754 11:32292297-32292319 AGCTGGGATCACAGGCATGTGGG - Intergenic
1080746354 11:35111743-35111765 TGCAGGCCTTGGAGGCAGGTAGG - Intergenic
1080848864 11:36050405-36050427 AGCAGGGCAGGCAGTCTGGTGGG + Intronic
1081663970 11:44905749-44905771 GGAAGGGCTCCCAGGGAGGTGGG + Intronic
1083310096 11:61779580-61779602 AGCAGGGATGGCAGGCGGGTTGG + Intronic
1083804681 11:65066750-65066772 AGCTGGGCTGGGAGGCAGGGAGG + Intronic
1084086422 11:66857246-66857268 GGCCGGGCTCGCAGGGAGGCCGG + Intronic
1084118406 11:67055272-67055294 GGCAAGGCTGGAAGGCAGGTGGG - Intergenic
1084144304 11:67255998-67256020 AGCCTGGCTGGGAGGCAGGTTGG - Exonic
1084215465 11:67644956-67644978 AGCCAGGCTCACAGGCAGGCTGG - Intronic
1084447504 11:69212360-69212382 AGCAGGGATGGCAGGCAGGGAGG - Intergenic
1084528395 11:69711993-69712015 AGCAGGGGACGCAGGCAGGGAGG + Intergenic
1085022511 11:73218320-73218342 AGCCGGGCTCCCAGGCACGTGGG + Exonic
1085313543 11:75530184-75530206 AGCAGGAGGGGCAGGCAGGTGGG - Intergenic
1086218122 11:84407568-84407590 AGCAGGGTTGGAAGGAAGGTAGG - Intronic
1087920296 11:103859215-103859237 AGCAGAACTCCCAGGCAGCTAGG + Intergenic
1089463784 11:118669716-118669738 GGCAGGAGTCGCAGGGAGGTGGG + Intronic
1089497347 11:118914385-118914407 AGCAGAGCAGGCAGGCAGGCGGG - Intronic
1090457408 11:126861966-126861988 AGCATGGCTCGTAGGCACCTGGG + Intronic
1090468392 11:126956063-126956085 TGCAGGACTTGCAAGCAGGTGGG - Intronic
1202810980 11_KI270721v1_random:27118-27140 ACCAAGGCTGGCAGGCACGTGGG + Intergenic
1094136090 12:27128176-27128198 AGCAGGGATCGGAGGGTGGTAGG - Intergenic
1094185651 12:27639911-27639933 AGCAGGGATCGGAGGGTGGTAGG - Intronic
1095459196 12:42424408-42424430 AACAGGGATGGCAGGAAGGTGGG - Intronic
1095960883 12:47833590-47833612 ACCAGAGCAGGCAGGCAGGTGGG + Intergenic
1097289944 12:57906228-57906250 AGAAGCACACGCAGGCAGGTGGG + Intergenic
1103097727 12:118145428-118145450 AGCAGCGCTCGCTGACAGCTTGG + Exonic
1103601377 12:122056855-122056877 AGCAGGGATCGCAGGGAGTCAGG - Intronic
1103707696 12:122887514-122887536 AGAAGGGCTCCCAGGCATATGGG - Intronic
1104658393 12:130591374-130591396 AGCACGGCTCCTAGGCAGGAAGG + Intronic
1105640357 13:22256398-22256420 AGCTGGGGCAGCAGGCAGGTTGG + Intergenic
1105913927 13:24894959-24894981 AGCAGGCCTGGCTGGCGGGTGGG + Intronic
1107955423 13:45506690-45506712 AGCAAGGCTCTGAGTCAGGTAGG + Intronic
1108205300 13:48082881-48082903 AGCAGGGCAGGAAGGCATGTGGG + Intronic
1108484559 13:50910478-50910500 AGCAGGGCCAGCTGCCAGGTAGG - Intronic
1109122783 13:58479041-58479063 TGCAGGGTAGGCAGGCAGGTTGG - Intergenic
1111093804 13:83482894-83482916 ACCAGGGCTGGGAGGCATGTTGG + Intergenic
1111901667 13:94207156-94207178 ACCAGGGCTCTCAGGGAGGCAGG - Intronic
1112328898 13:98462174-98462196 AGATGGGCTCCCAGGGAGGTGGG - Intronic
1115905568 14:38199343-38199365 AGTATGGCAGGCAGGCAGGTGGG - Intergenic
1117460798 14:55942925-55942947 AGCAGGGCTGGAAGGCTGGAGGG - Intergenic
1119380415 14:74224673-74224695 AGCAGGGCTCGACGGGAGGGAGG + Intergenic
1121117165 14:91351916-91351938 TGCAGGCGTGGCAGGCAGGTGGG - Intronic
1122097436 14:99381918-99381940 AGCTGGGGGAGCAGGCAGGTGGG - Intergenic
1124412964 15:29451780-29451802 AGCAGGACTTGCAGGGGGGTGGG - Intronic
1125686098 15:41564273-41564295 AGGAGGGCTGGCAGGGAGGAAGG + Intronic
1126408710 15:48349747-48349769 AGCAGGGCTCCCTGGTAGGACGG + Intergenic
1126583745 15:50263311-50263333 AGCTGGGCTCGCAGGTAGCCAGG + Exonic
1127853448 15:62935326-62935348 AGCAAGGGTCGAAGGCAGGAGGG + Intergenic
1128085101 15:64880686-64880708 TGCTGAGCTCGGAGGCAGGTGGG + Intronic
1129264185 15:74385318-74385340 AGCAGGGCGGGCAGGAAGGCTGG - Intergenic
1129707682 15:77804090-77804112 AGCAGGGTTCACAGGGAGGGAGG + Intronic
1130382017 15:83379383-83379405 CGCAGGGCTTGGAGGCAGGGTGG - Intergenic
1130664118 15:85854865-85854887 AGCAGGGCTCCGAGGCAAGCAGG + Intergenic
1130777124 15:86996102-86996124 AGCAGGGCTAGGAGGCTGGGAGG - Intronic
1130847508 15:87761150-87761172 GGCAGGGCTAGCAGGCAGTACGG + Intergenic
1131028671 15:89167819-89167841 AACATGGCTCGCTGACAGGTGGG - Intronic
1131111104 15:89765899-89765921 AGCAGAGCAGGCAGGCAGGCAGG + Intronic
1132709839 16:1261508-1261530 AGCAGGGCAGGCAGGCAGGGCGG + Intergenic
1133283854 16:4681564-4681586 AGATGGGCTCGTAGCCAGGTGGG - Exonic
1136062316 16:27735148-27735170 TGCAGGGGTCACAGGGAGGTGGG - Intronic
1136107513 16:28040708-28040730 CTCTGGGCTTGCAGGCAGGTGGG + Intronic
1137673652 16:50293218-50293240 GGCAGGGCAGGCAGGCAGGGAGG + Intronic
1137722131 16:50633513-50633535 GGCCGGGCTGGCAGCCAGGTGGG - Exonic
1138007454 16:53351141-53351163 AGCAGGGCTGGCGGGCATGGTGG - Intergenic
1138349478 16:56338837-56338859 AGCAAGGCCCGCAGGCTGGAAGG - Intronic
1139529906 16:67537879-67537901 AGCAGGTCACGCTGGCAGGCGGG + Intronic
1139837268 16:69849210-69849232 AGCAGAGCTAGCAGGGAGGAGGG + Intronic
1140997127 16:80271961-80271983 GGCAGGGCTGGCAGGCTGCTGGG + Intergenic
1141061876 16:80880904-80880926 AGGAGGGCGGGCAGGCAGGCAGG + Intergenic
1141064526 16:80903076-80903098 AGCAGGGGTTGCAAGCAGGGGGG + Intergenic
1141137017 16:81473094-81473116 GGCAGGGGCCGCAGGCAGGCTGG - Intronic
1142194957 16:88735084-88735106 ATCAGGGCGGGCAGGCAGGAGGG + Intronic
1142759288 17:2034015-2034037 AGCAGGGCTCTCAGCAAGCTGGG - Intronic
1142994204 17:3751331-3751353 AGCAGGGACCCGAGGCAGGTGGG + Intronic
1143275037 17:5704012-5704034 GGAAGGGCTTGCAGGCAGGTAGG - Intergenic
1145251759 17:21300662-21300684 AGCAGGGCCTGGAGGCAGCTGGG + Intronic
1145840982 17:27994243-27994265 AGCAGGGGTTGCAGGGTGGTCGG + Intergenic
1147839861 17:43363606-43363628 AGAGTGGCTCCCAGGCAGGTTGG - Intergenic
1148032125 17:44628636-44628658 AGCAGGGCACACAAGCAGGCGGG - Intergenic
1148479783 17:47952618-47952640 GGCAGGGCCAGCAGGGAGGTGGG - Exonic
1148683350 17:49487005-49487027 AGCAGGGCCTGGAGGCTGGTGGG - Intergenic
1152041890 17:77908992-77909014 GGCAGGGCTTCCAGGCAGGTGGG - Intergenic
1152516631 17:80828599-80828621 AGCACGGTGGGCAGGCAGGTGGG - Intronic
1152521541 17:80859491-80859513 AGCTGGGCTCGGAGCCAGGTTGG + Intronic
1152582166 17:81170944-81170966 AGCAGGGCCCTCAGGCAGGAGGG + Intergenic
1152832030 17:82503423-82503445 AGCAGGTCTTGCAGGCTGGTGGG + Intergenic
1153201830 18:2655496-2655518 AGCAGGGCTCGGGGGCAGCGGGG - Intergenic
1157858382 18:51121188-51121210 AGAAGGGCCCGCAGGCCGCTTGG + Intergenic
1160387496 18:78505363-78505385 AGCAGGGCGGGGAGGCAGGGAGG + Intergenic
1160749733 19:728152-728174 AGCTGGGCCCGCAGGAAGCTCGG + Intronic
1160808453 19:1002655-1002677 AGAGGGGTTCCCAGGCAGGTGGG + Intronic
1160919239 19:1512142-1512164 AGCAGAGCCTGAAGGCAGGTGGG + Intronic
1161160234 19:2757627-2757649 GGCAGGGCTCGCAGGCGGAAGGG - Intronic
1162017221 19:7852195-7852217 AGCAGGGCCTCCAGGCAGGCCGG - Intronic
1162671464 19:12261067-12261089 GGCAGGCCTCTCAAGCAGGTGGG + Intronic
1162913698 19:13863538-13863560 AGAAGGGCTGGCCGGCAGGGGGG + Intronic
1163587645 19:18172853-18172875 TGGAGGGCTCAGAGGCAGGTGGG - Exonic
1164399898 19:27895298-27895320 CACAGGGCTGGCAGGCAGATAGG - Intergenic
1164555148 19:29245679-29245701 AGCAGGCCTGGGAGGCAGATGGG + Intergenic
1164822605 19:31261895-31261917 GGCTGGGCTCGCAGACAGGGAGG - Intergenic
1165455821 19:35909838-35909860 AGCAGGGCTCTGAGCCAGGAGGG + Intergenic
1165995041 19:39838066-39838088 ACCTGGGCTCTCAGGCAGATGGG - Intronic
1166679226 19:44757149-44757171 AGCAGGGCTCGCAGGCAGGTCGG - Exonic
1166694518 19:44844995-44845017 ACCAGGGCGCGCAGGGAGGTAGG + Intergenic
1167017262 19:46849440-46849462 GGCAGGGGTCCCAGGCAGGAAGG + Intronic
1167024944 19:46908896-46908918 AGCAGGGATTGCATGGAGGTGGG + Intergenic
1168328362 19:55550249-55550271 AGGAGGCCTCGGAGGCTGGTGGG - Intergenic
925203547 2:1988211-1988233 AGCTGGGCTGGCAGGAGGGTTGG - Intronic
928263058 2:29785159-29785181 AGCAGTGCTTAGAGGCAGGTAGG - Intronic
929789115 2:45010737-45010759 AGAAGGGCTCGCACAAAGGTGGG + Intergenic
930064829 2:47319870-47319892 AGAAAGGCTGGCGGGCAGGTGGG - Intergenic
931868175 2:66433649-66433671 AGCAGGGCTCGCAGCTCGCTCGG - Intronic
931933004 2:67161835-67161857 AGCTGGACTTGCTGGCAGGTGGG - Intergenic
932856665 2:75241309-75241331 GGAAGGGCTGGCAGGCAGGTGGG - Intergenic
933712884 2:85340638-85340660 AGCAGCGCTCGCTGACAGCTTGG - Intergenic
933940347 2:87239845-87239867 AGGAGGGCTTGCAGGGAGGCTGG - Intergenic
934523086 2:95032167-95032189 AGCAGCGCTCACACTCAGGTCGG + Intronic
935019565 2:99216605-99216627 AGCAGGACTTGCAGGAAGGGAGG + Intronic
935258097 2:101330501-101330523 AGCAGGGCTCCAAGGCTGGTGGG - Intergenic
935327382 2:101949012-101949034 AGCAGGCTTGGCTGGCAGGTGGG + Intergenic
936352791 2:111725931-111725953 AGGAGGGCTTGCAGGGAGGCTGG + Intergenic
936640223 2:114303850-114303872 TTCAGGGCTGGCAGGCAGGAAGG + Intergenic
938143043 2:128812160-128812182 AGCAGGGCTTTGGGGCAGGTGGG - Intergenic
939953304 2:148501902-148501924 AGCAGTTCTAGCAGGAAGGTAGG + Intronic
940292271 2:152089054-152089076 AGGAGGGCACTCAGGGAGGTAGG - Intronic
944580258 2:201125959-201125981 TGCAGGGCTGGCAGTCAGGAGGG + Intronic
946315575 2:218909220-218909242 AGCAGGGGTCGCAGGAGGGCGGG + Intergenic
947735331 2:232451728-232451750 GGCAGGGGTGGCTGGCAGGTGGG - Intergenic
947917090 2:233839666-233839688 AGAAGGGCTCGCAGGCCAGGCGG + Intronic
948283928 2:236769557-236769579 AGCAGTGTTCCCTGGCAGGTGGG + Intergenic
948627676 2:239279096-239279118 AGCAGGGCCCACAGGCCGGAGGG + Intronic
948770601 2:240249695-240249717 GGCGGGGGTTGCAGGCAGGTGGG - Intergenic
948944708 2:241213642-241213664 AGCTGGGGTCGCAGGCAGCAGGG + Intronic
1169208482 20:3753058-3753080 CTCAGGGCTCTCAGGCAGGTGGG - Exonic
1171482471 20:25464518-25464540 AGCTGGGATGGAAGGCAGGTTGG - Intronic
1174450336 20:50616186-50616208 AGCGGGGCTCAGAGGCAGGTAGG + Intronic
1175369719 20:58480138-58480160 TTCAGGGCTGGCAGGCAAGTTGG + Intronic
1175553905 20:59834258-59834280 AGAAGGGCTCGGAAGCAGGAAGG - Intronic
1178899982 21:36591196-36591218 AGCAGGACTAGCCGGCAGGCTGG - Intergenic
1179502848 21:41820903-41820925 AGCAGGGCTCGGGGGCAGCTGGG - Intronic
1179817179 21:43914187-43914209 CCCAGGCCTCGCAGGCAGGGGGG - Intronic
1179947613 21:44688775-44688797 TGTGGGGCTCCCAGGCAGGTGGG - Intronic
1180714115 22:17859826-17859848 AGGAGGGCCCGCAGGCTGGGCGG - Intronic
1180959775 22:19757274-19757296 AGCAGGACCTGCAGGCAGGCAGG - Intronic
1180966089 22:19788660-19788682 AGGAGGGCGGGCAGGGAGGTGGG - Exonic
1181490358 22:23257518-23257540 AGCACGGCTGGCAGGCTGGGTGG + Intronic
1181528230 22:23502106-23502128 GGAAGGGCACACAGGCAGGTTGG - Intergenic
1181863905 22:25840417-25840439 AGCCAGGATCGCAGGCAGGGAGG - Intronic
1182804195 22:33057079-33057101 AGCAGGGCTCCCGGGCAGAGGGG + Intronic
1183438285 22:37807922-37807944 CGCACGGCTCCCAGGCAGGCAGG + Exonic
1183630137 22:39027685-39027707 AGCAGGGCCACCAGGCAGGAAGG - Intronic
1183633571 22:39047549-39047571 AGCAGGGCCACCAGGCAGGAAGG - Intronic
1183932888 22:41246230-41246252 AGCCGGGCCGGAAGGCAGGTGGG + Exonic
1183951447 22:41355221-41355243 AGCAGGCCTCCCAGGGAGTTGGG + Intronic
1184048242 22:41985820-41985842 AGTGGGGATTGCAGGCAGGTGGG - Intronic
1184877456 22:47284518-47284540 ACCTCGGCTGGCAGGCAGGTGGG + Intergenic
1184980065 22:48089600-48089622 AGCAGGGGTGGGAGGCAGGCGGG + Intergenic
1185078277 22:48694866-48694888 AGGAAGGCTCACAGGCAGGTGGG - Intronic
1185199456 22:49492520-49492542 AGCAGGGTCCACAGGCTGGTTGG + Intronic
950100559 3:10354032-10354054 AGCAGGGCAAGAAGGCAGGAAGG - Intronic
950509034 3:13414593-13414615 AGCAGGGCTGGGAGGGAGGGTGG - Intronic
952761518 3:36918945-36918967 AGCAGGCATCACAGGCAGGTGGG + Intronic
953913890 3:46906005-46906027 AGCAGGCCTGGCAGGCAGGCAGG + Intergenic
954416445 3:50395701-50395723 AGCAGGGCAGGGAGGAAGGTGGG + Intronic
954610747 3:51943405-51943427 AGAAGGGCCGGCAGGCAGGAAGG + Exonic
958522639 3:95211264-95211286 AGGAGAGCTCTCAGGCAGGAAGG - Intergenic
961449064 3:126994337-126994359 AGCAGCACTCCCAGCCAGGTCGG - Intronic
961464511 3:127073090-127073112 CGCAGGCCTGGCAGGCAGGGAGG + Intergenic
961466456 3:127084781-127084803 AGCAGGGCACACAGGGAGGGAGG + Intergenic
961616699 3:128188338-128188360 ATGAGGGCTGGCAGGCAGGCAGG + Intronic
963727761 3:148940916-148940938 TGCAGGCCTCAGAGGCAGGTAGG + Intergenic
966882822 3:184359688-184359710 AGCTGGGCTGGCAGGCTGGTGGG - Intronic
967099117 3:186201321-186201343 AGCAGGGATCATGGGCAGGTAGG + Intronic
968230919 3:197003896-197003918 AGCAGTGCTCGGGCGCAGGTAGG - Exonic
968568222 4:1326124-1326146 AGCAAGGCTGGCAGGCGGGGTGG + Intronic
968827293 4:2908449-2908471 AGCAGGGCTCCCAGGCAGCATGG + Intronic
968845337 4:3038108-3038130 AGCAGGGCTGGCTGGCAGCCAGG + Intronic
969427856 4:7136358-7136380 AGCAGGGCTCACAAGCAGGAGGG - Intergenic
970815644 4:20152724-20152746 AGCAGGGCACAGAGGCAGATGGG + Intergenic
970824109 4:20252762-20252784 AGAATGGCTCGGTGGCAGGTGGG - Intergenic
973144797 4:46812446-46812468 AACAGGGCACACTGGCAGGTGGG + Intronic
976800174 4:88981638-88981660 AGCAGGGATACCAGGCAGGGTGG + Intronic
978829299 4:113064524-113064546 AGCAGGGCTGGCAGGTGGGGAGG - Intronic
979606698 4:122646002-122646024 AGCAGGGCTGGAAGTCAGGATGG - Intergenic
982670418 4:158313946-158313968 AGAAGGGCTGGTGGGCAGGTGGG + Intergenic
982758343 4:159251114-159251136 TGCAGGGCGGGCAGGCAGGCGGG - Intronic
984123102 4:175770681-175770703 ATCAGGGCTGGCAGGGATGTTGG - Intronic
985846287 5:2351871-2351893 TGCAGAGCTCCCAGGCAGGGTGG - Intergenic
986967984 5:13298543-13298565 TGCAGGGCTGGTAGGGAGGTGGG + Intergenic
987072861 5:14354160-14354182 AGCAGGGCTGGGAGGGTGGTTGG + Intronic
988465036 5:31482022-31482044 TGCAGGGCTCTCAGGCATGAGGG + Intronic
988536081 5:32070421-32070443 AGCACAGCTTTCAGGCAGGTCGG - Intronic
988883557 5:35531657-35531679 AGCAGAGCTTGCAGGCCGGCTGG + Intergenic
989499832 5:42152493-42152515 AGCCTGCCTCTCAGGCAGGTTGG - Intergenic
995149953 5:108831056-108831078 AACAGGGCTTTTAGGCAGGTTGG + Intronic
995991773 5:118247944-118247966 AGCAGGTGGCACAGGCAGGTGGG - Intergenic
997422495 5:133780249-133780271 AGCAGGGGACGCAGACACGTGGG + Intergenic
997564601 5:134877221-134877243 AGGAAGGCTCTAAGGCAGGTGGG + Intronic
997863545 5:137441548-137441570 TGCAGGGCTCCCTGGCATGTAGG + Intronic
997978843 5:138456519-138456541 AGCAGGGATTGCAGGGAGGAAGG + Intergenic
999185733 5:149707191-149707213 AGAAGGGCTTGGAGCCAGGTGGG - Intergenic
999709323 5:154302452-154302474 AGCAGGGCTCCCAGGGAGTAGGG - Intronic
1001399287 5:171437220-171437242 GGCAGGGTTGGCAGGCAGGCGGG - Intronic
1001403899 5:171462349-171462371 AGCTGGGCAGGCAGGCAGGAGGG - Intergenic
1001412534 5:171521039-171521061 GGCAGAGCTTGCAGGCAGGCAGG + Intergenic
1002043602 5:176530490-176530512 ATCTGGGCTCCCAGGCAGCTGGG - Intronic
1002467284 5:179413933-179413955 AGGGAGGCTGGCAGGCAGGTGGG - Intergenic
1003095056 6:3135952-3135974 CGCAGTGTTCGCAGGCAGGCCGG - Intronic
1007414099 6:41682218-41682240 TGCAGGACTCCCAGGCAGGATGG + Intergenic
1010211798 6:73368004-73368026 AGCAGGGTTCCCAGGCACCTTGG - Intergenic
1012013625 6:93826054-93826076 AGAAGGGCTCACAAGGAGGTAGG + Intergenic
1012475041 6:99608263-99608285 TGCAGGGCTCACAGGCAACTAGG + Intronic
1012713553 6:102639166-102639188 TGAGGGGCTCGGAGGCAGGTGGG + Intergenic
1012975797 6:105779783-105779805 AGCAGGACTGGCAGGGAGGTGGG + Intergenic
1017980918 6:159400633-159400655 ACCAGGCCTCCCAGGGAGGTGGG + Intergenic
1018836057 6:167485103-167485125 AGCAGGGCTGGGAGAGAGGTGGG - Intergenic
1019273547 7:164094-164116 AGCAGCTCTCGCGTGCAGGTCGG - Intergenic
1019312578 7:369864-369886 AGGTGGGCTCGGAGTCAGGTGGG - Intergenic
1019434433 7:1014892-1014914 GGGAGGGCCCGCAGGCAGGAAGG - Intronic
1019480529 7:1264690-1264712 AGCAGGACCTGCAGGCAGCTGGG - Intergenic
1022770623 7:33468639-33468661 AGCAGGGCAGGCAGAGAGGTTGG - Intronic
1024529586 7:50380335-50380357 AGCAGGGCAGGCAGGCAGGCGGG - Intronic
1024617267 7:51126487-51126509 AGAAGGGCACTCAGGCAGTTTGG - Intronic
1026480204 7:70772139-70772161 AACAGGGCCTGCCGGCAGGTGGG + Intronic
1026484203 7:70803950-70803972 AGGGGGGCTTGCAGGGAGGTGGG + Intergenic
1029439166 7:100577793-100577815 AGCAGGGCTGGCCGGGAGCTGGG - Intronic
1030488908 7:110206590-110206612 ATCAATGCTAGCAGGCAGGTGGG - Intergenic
1031150296 7:118046263-118046285 AGGTGGGCAGGCAGGCAGGTGGG - Intergenic
1033603663 7:142909012-142909034 ATCAGGGCTTGCAGGGTGGTAGG + Intronic
1035274161 7:157737496-157737518 GGCAGGGGGCGCAGGCAGGAGGG + Intronic
1035417791 7:158704578-158704600 AGCACTGCCCGCACGCAGGTCGG + Intronic
1038000845 8:23390114-23390136 AGCAGGAATCCCAGGCAGGGAGG - Intronic
1042084062 8:65088761-65088783 ACCTGGACTTGCAGGCAGGTAGG + Intergenic
1043164422 8:76885620-76885642 ACCAGGGCTCCAAGTCAGGTGGG + Intergenic
1045146044 8:99346004-99346026 AGCAGAGTGGGCAGGCAGGTGGG + Intronic
1047773411 8:128049151-128049173 TGCAGGGCTGGCAGGGAGGCTGG + Intergenic
1048550783 8:135432161-135432183 AGCAGGGATGGCAGGAAGGAGGG - Intergenic
1049454762 8:142681250-142681272 ATGGGGGCTCCCAGGCAGGTGGG - Intronic
1053208545 9:36208330-36208352 GGCAGGGCTCTCAGACAGGAAGG - Intronic
1053265385 9:36709240-36709262 AGCTGGGCTGGAAGGCAGTTTGG + Intergenic
1057383941 9:94591414-94591436 AGCAGGGCTGGCTGGCTGCTCGG + Intronic
1057520470 9:95755729-95755751 AGCAGTGATTCCAGGCAGGTGGG + Intergenic
1059491168 9:114668418-114668440 AGCAGCGCACACAGGCAAGTGGG + Intergenic
1061629010 9:131859753-131859775 AGCAGGACTCGCAGGGGTGTCGG - Intergenic
1061902517 9:133680356-133680378 AGGGGGCCTCACAGGCAGGTGGG - Intronic
1061935000 9:133852648-133852670 AGCAGGGCTGGCAGCCTGGCAGG - Intronic
1062578261 9:137218432-137218454 AGCCGGGCACCCAGGCAGGGTGG - Intergenic
1187705779 X:22008062-22008084 AGCATGGCCCTCAGGCAGATGGG - Intergenic
1188790975 X:34408038-34408060 AGCAGGGCCAGCAGTCAGGAAGG + Intergenic
1189159243 X:38793803-38793825 AGCAAGGCAGGCAGGCAGGAAGG + Intergenic
1189981294 X:46513584-46513606 AGCATGGATTGCAGCCAGGTGGG - Intronic
1190765693 X:53473759-53473781 AGCAGGGCTTCCAGGGAGGGAGG - Intergenic
1194073006 X:89350773-89350795 AGAAGGACTGGCAGGCAGGAGGG + Intergenic
1195708841 X:107758115-107758137 AGGAGGGCTAGCAGGGAGGGAGG + Intronic
1200727246 Y:6686513-6686535 AGAAGGACTGGCAGGCAGGAGGG + Intergenic
1200728398 Y:6702288-6702310 AGAAGGACTGGCAGGCAGGAGGG + Intergenic