ID: 1166679228

View in Genome Browser
Species Human (GRCh38)
Location 19:44757153-44757175
Sequence GTCCAGCAGGGCTCGCAGGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 209}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166679228_1166679236 8 Left 1166679228 19:44757153-44757175 CCTGCCTGCGAGCCCTGCTGGAC 0: 1
1: 0
2: 3
3: 24
4: 209
Right 1166679236 19:44757184-44757206 TCCGGGCACGTTGGACCTGGAGG 0: 1
1: 0
2: 0
3: 2
4: 51
1166679228_1166679232 -10 Left 1166679228 19:44757153-44757175 CCTGCCTGCGAGCCCTGCTGGAC 0: 1
1: 0
2: 3
3: 24
4: 209
Right 1166679232 19:44757166-44757188 CCTGCTGGACAGCGCAGCTCCGG 0: 1
1: 0
2: 3
3: 28
4: 228
1166679228_1166679234 -1 Left 1166679228 19:44757153-44757175 CCTGCCTGCGAGCCCTGCTGGAC 0: 1
1: 0
2: 3
3: 24
4: 209
Right 1166679234 19:44757175-44757197 CAGCGCAGCTCCGGGCACGTTGG 0: 1
1: 0
2: 1
3: 9
4: 120
1166679228_1166679233 -9 Left 1166679228 19:44757153-44757175 CCTGCCTGCGAGCCCTGCTGGAC 0: 1
1: 0
2: 3
3: 24
4: 209
Right 1166679233 19:44757167-44757189 CTGCTGGACAGCGCAGCTCCGGG 0: 1
1: 0
2: 2
3: 51
4: 334
1166679228_1166679239 24 Left 1166679228 19:44757153-44757175 CCTGCCTGCGAGCCCTGCTGGAC 0: 1
1: 0
2: 3
3: 24
4: 209
Right 1166679239 19:44757200-44757222 CTGGAGGCCCGCAATTATGACGG 0: 1
1: 0
2: 0
3: 5
4: 39
1166679228_1166679235 5 Left 1166679228 19:44757153-44757175 CCTGCCTGCGAGCCCTGCTGGAC 0: 1
1: 0
2: 3
3: 24
4: 209
Right 1166679235 19:44757181-44757203 AGCTCCGGGCACGTTGGACCTGG 0: 1
1: 0
2: 0
3: 2
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166679228 Original CRISPR GTCCAGCAGGGCTCGCAGGC AGG (reversed) Exonic
900151513 1:1181040-1181062 GGCCACCTGGGCTCCCAGGCTGG + Intronic
900559060 1:3294666-3294688 GTCCCCCAGGCCTCGCGGGCTGG + Intronic
900587860 1:3442076-3442098 CACCAGCAGGGATGGCAGGCAGG - Intergenic
904047652 1:27618177-27618199 GTCCAGGAGGGCAGGCAGGAGGG + Intronic
904266601 1:29321926-29321948 GTCAGGCAGGGCTGGAAGGCTGG - Intronic
904563413 1:31413434-31413456 GTCCAGGAGGGCGAGCAGGCGGG - Intronic
905632172 1:39524940-39524962 ATCCAGGAGGCCTCCCAGGCGGG + Intronic
905665573 1:39761247-39761269 ATCCAGGAGGCCTCCCAGGCGGG - Intronic
906265927 1:44429406-44429428 GTTCAGGAGGGCCAGCAGGCTGG + Intronic
909904580 1:81178874-81178896 GGCCAGCAGGGCTGGCTGGCTGG + Intergenic
915544937 1:156591809-156591831 GCCCAGCAGCGCCCGCAGCCTGG - Exonic
918415262 1:184299489-184299511 GTCCAACAGGGCTCTGAGTCAGG + Intergenic
920411797 1:205767399-205767421 ATCCAGAAGGGCTGGCTGGCTGG + Intergenic
923483410 1:234405843-234405865 CTCCAGCAGGGCCCACAGGGAGG - Intronic
1063623226 10:7667275-7667297 GTCCAGGAGGGGACGCAGGGTGG - Intergenic
1066362001 10:34740201-34740223 TTCCAGCAGAGCTGGCCGGCTGG + Intronic
1069773107 10:70911702-70911724 GGCCAGCAGGGATCTCAGGCAGG - Intergenic
1071003742 10:80859333-80859355 GGCCAGCAGGGCTGGCTGGCTGG - Intergenic
1072190158 10:93071908-93071930 GGCCTGCAGGGGTCACAGGCGGG + Intergenic
1075977203 10:126706302-126706324 AGCCAGCAGGGCCAGCAGGCAGG + Intergenic
1076313143 10:129522264-129522286 GCCCTGCAGGGGTCACAGGCTGG + Intronic
1076362298 10:129897641-129897663 GTCCGTCAGGGCTCTGAGGCAGG - Intronic
1076373821 10:129970854-129970876 GTCCAGCAGCGCGCGGCGGCGGG + Intergenic
1076417297 10:130300908-130300930 TCCCAGCAGGGCCTGCAGGCAGG - Intergenic
1076871288 10:133196259-133196281 GTCCAGCAGGGAGACCAGGCAGG - Intronic
1077848036 11:6046529-6046551 GTCCAGCAGGGAGAGGAGGCTGG + Intergenic
1079690034 11:23406346-23406368 GTCCAGCAGGGGCAGCAGCCAGG + Intergenic
1080642090 11:34164087-34164109 GATAAGCAGGGCTGGCAGGCAGG - Intronic
1080961741 11:37168571-37168593 GTCCAGCAGAGCTCTGAGGATGG - Intergenic
1081656717 11:44862216-44862238 GGGCAGCAGGGCTGCCAGGCTGG - Intronic
1082029695 11:47595112-47595134 GTCCAGCAGGGCACCCGGGCTGG + Intergenic
1084086420 11:66857242-66857264 GGCCGGCCGGGCTCGCAGGGAGG + Intronic
1084208119 11:67607655-67607677 GTCCAGCAGGGGAGCCAGGCCGG + Intronic
1084447507 11:69212364-69212386 ATCCAGCAGGGATGGCAGGCAGG - Intergenic
1084528393 11:69711989-69712011 GGGCAGCAGGGGACGCAGGCAGG + Intergenic
1085565040 11:77506035-77506057 GTCCAGCAGGGCTCCCAGTCAGG + Intergenic
1089169569 11:116502747-116502769 GTCCTGCAGGGATCACAGCCTGG + Intergenic
1089668149 11:120033242-120033264 TCCCAGCAGGGCTCCCAGCCAGG - Intergenic
1090073731 11:123565796-123565818 GTCCTGCTGGGTTCACAGGCTGG - Intronic
1090771306 11:129921854-129921876 GGCCAGCAGGGCTGGCAGTCAGG - Intronic
1090975147 11:131673653-131673675 GTCCAGCAGTGCTCCCAGTGAGG - Intronic
1091215048 11:133895832-133895854 GGCCAGCAGGACTTGCTGGCAGG + Intergenic
1091655285 12:2341558-2341580 GTCCAGCAGGGCTCCGCGGGAGG - Intronic
1091993581 12:4975626-4975648 GTGCTGCAGGGCTGGCAGGGAGG + Intergenic
1092617170 12:10225895-10225917 GGCCAGCAGGGCTGGCTGGCTGG + Intergenic
1098123830 12:67269680-67269702 CTCCAGCAGCGCCAGCAGGCGGG + Exonic
1102624060 12:114220438-114220460 GTCCAGCTGGGATCTCAGGATGG - Intergenic
1112506730 13:99980451-99980473 GTCCAGCGTGGCTCGGACGCGGG - Intergenic
1114618522 14:24081353-24081375 GTCCAGCTGGGCGGCCAGGCGGG + Exonic
1117295107 14:54371915-54371937 ATTCTGCAGGGCTGGCAGGCTGG - Intergenic
1118473168 14:66093878-66093900 GTCCAGCGGGGCGAGGAGGCAGG + Intergenic
1119380412 14:74224669-74224691 CTCCAGCAGGGCTCGACGGGAGG + Intergenic
1120526132 14:85579103-85579125 GTCCAACAGGGCTGGCAGAAAGG - Intronic
1121626165 14:95386803-95386825 GTCCAGGAGGGCTGGTAGACAGG - Intergenic
1122262251 14:100530334-100530356 GTCCAGCAGGCCTGGGAGGAGGG - Intergenic
1122853688 14:104549632-104549654 GTCCAGCACAGCACGCAGACTGG + Intronic
1124134996 15:27027447-27027469 GTGCAGCAGGGAGCACAGGCAGG - Intronic
1124557852 15:30744687-30744709 GTCCAGCAGGTGCCGCGGGCTGG - Intronic
1124673384 15:31660969-31660991 GTCCAGCAGGTGCCGCGGGCTGG + Intronic
1125769169 15:42153721-42153743 GCCAAGCAGGGCTGGCAGGCAGG - Intronic
1126408708 15:48349743-48349765 CTCCAGCAGGGCTCCCTGGTAGG + Intergenic
1128331328 15:66757529-66757551 GTCCAGCAGGACCCTCAGGCTGG + Intronic
1128647463 15:69387934-69387956 TGCCAGCATGGCTGGCAGGCTGG - Intronic
1128679187 15:69635463-69635485 GCCTCGCAGGGCTCTCAGGCTGG + Intergenic
1129708691 15:77809237-77809259 GTCCAGTAGGGCTGGGAGGATGG - Intronic
1129737696 15:77975191-77975213 GTCCAGCAGGGGCAGCAGGCTGG + Intergenic
1129848384 15:78778425-78778447 GTCCAGCAGGGGCAGCAGGCTGG - Intronic
1130109006 15:80949701-80949723 GTCCAGTAGGGCAGGCAGTCAGG + Exonic
1130253537 15:82315513-82315535 GTCCAGCAGGTACAGCAGGCTGG + Intergenic
1130382020 15:83379387-83379409 GTTCCGCAGGGCTTGGAGGCAGG - Intergenic
1131111102 15:89765895-89765917 CTCCAGCAGAGCAGGCAGGCAGG + Intronic
1132347332 15:101116216-101116238 GTCCTGCAGGGGCCCCAGGCTGG - Intergenic
1132504714 16:302023-302045 GCCCAGTAAGGCTCCCAGGCAGG + Intronic
1133177298 16:4025039-4025061 GGCCAGCAGGGCTCTGAGGAGGG + Intronic
1134090069 16:11386858-11386880 CTCCAGCAGTGCCCGCAGGGAGG + Intronic
1134438839 16:14285641-14285663 GTCCCGCAGGTCCCGCGGGCGGG - Intergenic
1138226776 16:55302734-55302756 CTCCAGCAGGGATGGCAGGGAGG - Intergenic
1138591044 16:58000108-58000130 GCCCAGCTGGGCCTGCAGGCAGG - Intronic
1139593295 16:67944732-67944754 GGCAAGCAGGGCTGGCAGGTGGG + Exonic
1142255252 16:89010822-89010844 GGACAGCGGGGCTCACAGGCGGG - Intergenic
1143766053 17:9138442-9138464 GTCCTGCAGGGCTCGGTGGCTGG + Intronic
1145274622 17:21422230-21422252 GCCCCGCAGAGCTCGCAGCCTGG - Intergenic
1146255668 17:31390673-31390695 GTCCTGCAGGGCCCCGAGGCTGG + Intergenic
1148218338 17:45846036-45846058 GGCCAGCAGGGCCAGCAGGAAGG - Exonic
1148549764 17:48543479-48543501 GTCCTCCAGGGCTCCCGGGCAGG + Exonic
1148771759 17:50071448-50071470 GTGCTGGAGGGCTCGCAGGTGGG + Exonic
1151407785 17:73900686-73900708 GTCCATCAGGGATGGGAGGCAGG + Intergenic
1151618623 17:75231369-75231391 GTCCAGCAGGTCTGTCAGGTGGG - Exonic
1151932473 17:77241338-77241360 GTCCAGGGGGGCTCGCTGGAGGG - Intergenic
1152680635 17:81666214-81666236 GCCCAGGAGGGCTCGCACACAGG + Intronic
1152782237 17:82231517-82231539 GTCCAGGAGGCCTCGGAGGTGGG + Intronic
1153201876 18:2655642-2655664 ATCCAGCAGGCCGCGCGGGCAGG - Intergenic
1153502557 18:5763793-5763815 CTCCAGTAGGGCTAGCAGCCTGG - Intergenic
1159946283 18:74446906-74446928 CTGCAGCAGGGCCCACAGGCTGG + Exonic
1160848976 19:1180626-1180648 GCCCAGGAGGGCTGGCAGGGAGG - Intronic
1160987784 19:1847660-1847682 GTCCAGCATGACTGGCAGGGAGG - Intronic
1161008224 19:1947245-1947267 GGCCATCAGGCCTCACAGGCAGG - Intronic
1161742609 19:6032553-6032575 GGCCAGCAGGGCTGAGAGGCTGG + Intronic
1162391665 19:10393633-10393655 GTAGAGCAGGGCTCCCAAGCAGG - Intronic
1162522503 19:11190080-11190102 CTGCAGCAGGGCTCGAAGGTAGG - Intronic
1163122670 19:15227440-15227462 GTCCAGCAGGTCTTGCAAGAAGG + Exonic
1163152335 19:15422814-15422836 GTCCAGCAGGGGCAGCAGCCAGG - Exonic
1163671782 19:18633572-18633594 GTCTAGCAGAGCCGGCAGGCAGG - Intergenic
1163686664 19:18715751-18715773 GTGCAGGTGGGCTCCCAGGCAGG + Intronic
1164412483 19:28017491-28017513 GCCAAGCAGGGCTGGCAGGAGGG - Intergenic
1164604037 19:29583153-29583175 GGCCAGTGGGGCTGGCAGGCAGG - Intergenic
1164835025 19:31350572-31350594 GTCCAGCAGCCCCGGCAGGCCGG - Intergenic
1165437875 19:35806594-35806616 GTCCTATAGGGCACGCAGGCAGG + Exonic
1165457703 19:35923469-35923491 ATCCAGGATGGCTCCCAGGCAGG - Intergenic
1166530991 19:43543494-43543516 GTCCATCAGGGCCTGCAGGGTGG + Exonic
1166679228 19:44757153-44757175 GTCCAGCAGGGCTCGCAGGCAGG - Exonic
1166797955 19:45439600-45439622 CCCCCGCAGGGATCGCAGGCAGG - Intronic
1166908487 19:46133047-46133069 GGCAAGGAGGGCTGGCAGGCTGG + Intergenic
1167101615 19:47407322-47407344 GCCCAGGAGGGCCCGCGGGCCGG - Intronic
1168108906 19:54181048-54181070 GCGCAGCAGGGGCCGCAGGCTGG + Exonic
925203548 2:1988215-1988237 GTGCAGCTGGGCTGGCAGGAGGG - Intronic
925302421 2:2826701-2826723 GAGCAGCAGGGCAAGCAGGCGGG - Intergenic
926914287 2:17878318-17878340 GCCCAGGAGGGCGCGCAGGTGGG + Intronic
932316013 2:70783523-70783545 GTCCAACAGGACTGGCAGGAAGG + Intronic
932764552 2:74461647-74461669 GTCCAGCAGGGGCCCAAGGCGGG + Exonic
934933940 2:98451200-98451222 GGCCAGCTGGGCTGGCTGGCTGG - Intronic
935592369 2:104855081-104855103 CTCCAGCGGGGCTCGCCGGGCGG - Intergenic
936059063 2:109282803-109282825 GTCCTCCAGGGCTGGCAGGCAGG + Intronic
937858198 2:126687782-126687804 TTCCAGCAGGGCAGCCAGGCTGG - Intronic
937900664 2:127016645-127016667 GTCCAGCAGGGCTTCCTGCCTGG + Intergenic
938238311 2:129723862-129723884 TTCCTGCAGGGCTCCCAAGCCGG - Intergenic
938555255 2:132417796-132417818 AGCCAGAAGGGCTCGCTGGCCGG + Exonic
938583962 2:132670867-132670889 CTCCAGCGGTGCGCGCAGGCGGG - Intronic
941739209 2:169015273-169015295 GTCCAGCAGGCCCAGCAGCCTGG - Intronic
943748600 2:191487990-191488012 GTTCAGCAGGGCCAGCAGTCTGG - Intergenic
946147268 2:217740625-217740647 GACCAGCAGGGCTTTGAGGCAGG + Intronic
947089546 2:226494904-226494926 TTCCAGCAGGGCTCCCTGGTAGG + Intergenic
947899769 2:233711593-233711615 GTCCACCAGAGGGCGCAGGCAGG - Intronic
948626940 2:239275207-239275229 GACCACCAGGCCGCGCAGGCTGG + Intronic
948627674 2:239279092-239279114 GGGCAGCAGGGCCCACAGGCCGG + Intronic
1170437618 20:16346554-16346576 GTCCAACAGGGCTTTCAGGCTGG + Intronic
1172117630 20:32582144-32582166 GACCAGCAGGCCAGGCAGGCGGG + Intronic
1172389750 20:34558839-34558861 GCCCGGCTGGGCGCGCAGGCCGG - Intronic
1172630890 20:36377597-36377619 GTCCCGAAGGGCAGGCAGGCAGG - Intronic
1172997907 20:39084176-39084198 GCCCAGCAGGGCTGGGAGGATGG + Intergenic
1173678833 20:44861776-44861798 GTCCAGCAGGGCTGGGTGTCAGG - Intergenic
1175796836 20:61776544-61776566 GTCCAGCAGCCCCTGCAGGCAGG + Intronic
1176018857 20:62952657-62952679 GGCCACCAGGGCGGGCAGGCGGG - Exonic
1176147758 20:63573040-63573062 GTCCACCAGGGCACACAGCCGGG + Intronic
1178701854 21:34840695-34840717 GGCCAGGTGGGATCGCAGGCTGG - Intronic
1179893378 21:44349030-44349052 GTCCAGCAGGGCGCGGCTGCGGG + Intergenic
1180588961 22:16919514-16919536 GTCCAGCAGGGTTCGCTTTCTGG + Intergenic
1181052021 22:20242371-20242393 GTACTGCAGGGCACGCAGGGGGG + Exonic
1181572682 22:23776229-23776251 GCATAGCAGGGCTGGCAGGCTGG + Intronic
1182669527 22:31984172-31984194 GAACAGCAGGGCCCCCAGGCTGG - Intergenic
1183293810 22:37018657-37018679 GTCCATCAGGACTGGCAAGCTGG - Exonic
1183630140 22:39027689-39027711 GCCCAGCAGGGCCACCAGGCAGG - Intronic
1183633574 22:39047553-39047575 GCCCAGCAGGGCCACCAGGCAGG - Intronic
1184391597 22:44206452-44206474 CTCCAGCTGGGCTGACAGGCAGG - Exonic
1184470228 22:44692002-44692024 GTCCAGCAGGGTAGGGAGGCAGG - Intronic
1185067673 22:48640218-48640240 CCTCAGCAGGGCTCCCAGGCAGG + Intronic
1185199454 22:49492516-49492538 CTCCAGCAGGGTCCACAGGCTGG + Intronic
950687338 3:14627967-14627989 GTCCAGCGTGGGTCACAGGCTGG + Intergenic
954412361 3:50376347-50376369 CTCCAGCCAGGCCCGCAGGCGGG + Intronic
954614772 3:51964054-51964076 GGTCAGCAGGGCTCCCTGGCAGG + Intronic
955230856 3:57097759-57097781 GTGCAGCAGGGGTTGCAGGGCGG + Exonic
957586038 3:82133177-82133199 GTCCAGCAGGGGCCGCAGTGTGG - Intergenic
957921801 3:86757691-86757713 GGCCGGCAGGGCTGGCCGGCCGG - Intergenic
958442266 3:94170347-94170369 ATGCAGCAGGGGTGGCAGGCTGG - Intergenic
966882826 3:184359692-184359714 TCCCAGCTGGGCTGGCAGGCTGG - Intronic
967596286 3:191329546-191329568 GGCCGGCAGGGCTCGCAGGCCGG - Exonic
967954624 3:194868888-194868910 GTCCTGCAGGGCTGGGAAGCCGG + Intergenic
967977009 3:195041120-195041142 GAACAGCAGGTCTCGAAGGCTGG + Intergenic
968298987 3:197599146-197599168 TCCCAGCAGGGCTCAGAGGCAGG + Intergenic
968568220 4:1326120-1326142 GGGCAGCAAGGCTGGCAGGCGGG + Intronic
968832931 4:2942572-2942594 GGCCAGCAGGCCTCTCAGGCAGG - Intronic
968966389 4:3771047-3771069 ATACAGCAGGGCACGCAGCCTGG + Intergenic
969427858 4:7136362-7136384 GGACAGCAGGGCTCACAAGCAGG - Intergenic
969796724 4:9532843-9532865 GTCCAGCGGGTCTCCCAGCCAGG - Intergenic
969811477 4:9651783-9651805 GCCCAGCTGGGTTGGCAGGCAGG - Intergenic
972815490 4:42640708-42640730 TTTCAGAAGGGCTCACAGGCAGG - Intronic
979606700 4:122646006-122646028 GGCCAGCAGGGCTGGAAGTCAGG - Intergenic
981617311 4:146655238-146655260 GCGCAGCAGGGGGCGCAGGCGGG - Intergenic
982797610 4:159664303-159664325 GTGCAGCAGGGCCCTCAGCCAGG + Intergenic
982921256 4:161277345-161277367 GTCCGGCAGGGCGGGCCGGCCGG - Intergenic
984243811 4:177250272-177250294 GTCCAGCAGCGCTCCCAGGAGGG - Intergenic
985195190 4:187421210-187421232 GGCCAGTAGGGCTGGCTGGCTGG + Intergenic
985586005 5:734682-734704 ACCCAGCAGGGCTACCAGGCTGG - Intronic
985600424 5:826094-826116 ACCCAGCAGGGCTACCAGGCTGG - Intronic
985611959 5:894154-894176 GTCCAGGAGGGCTCAGAGGGAGG + Intronic
991548250 5:67807519-67807541 GACCAGCAGGGCCTGCTGGCTGG + Intergenic
995757094 5:115517694-115517716 GTCCAACAGTGCTCACAGGGAGG - Intergenic
996384976 5:122901507-122901529 GTCCAGCGGGGCTGGTATGCAGG + Intronic
1001403902 5:171462353-171462375 CTCCAGCTGGGCAGGCAGGCAGG - Intergenic
1002062862 5:176636640-176636662 GTCCTGCAGGGCAGGCAGGACGG + Intronic
1002655202 5:180740519-180740541 GTCAAACAGGGCTCCCAGCCTGG - Intergenic
1003176861 6:3758261-3758283 GGCCAGCAGGTCCCGCCGGCCGG + Intergenic
1006114777 6:31769777-31769799 GTGCAGCAGGGCCAGCTGGCAGG + Exonic
1007417285 6:41699142-41699164 GTCAAGCAGGGCTTGCCAGCTGG + Intronic
1007724541 6:43907125-43907147 CTCCAGCAGGGCTTGCCAGCTGG + Intergenic
1013170762 6:107634777-107634799 GTGCTGCAGGGCCCGCAGGACGG + Exonic
1013403369 6:109820078-109820100 ATCAGGCAGGGCTCCCAGGCAGG + Intronic
1015926057 6:138311522-138311544 GTCCAGCTGGGCTCCCGGCCTGG + Intronic
1016894966 6:149042542-149042564 GTCCAGCAGGGCCCTGAGGCAGG + Intronic
1017691747 6:156972716-156972738 GTCCTGCAGGTCTCTCTGGCTGG - Intronic
1017713807 6:157193547-157193569 GCCCAGCAGAGCTCTCAGCCTGG - Intronic
1019170221 6:170129564-170129586 CTCCAGCAGGGCTGGCAGCCAGG - Intergenic
1019305190 7:330981-331003 GTCCAGCAGGCATCTCAGCCAGG + Intergenic
1019507990 7:1402933-1402955 GAGCAGCACGGCTCTCAGGCAGG - Intergenic
1021513824 7:21461502-21461524 GGCCAGCAGGGCCGGCCGGCAGG + Intronic
1024517548 7:50272179-50272201 GGCCAGCAGGGGTCCCAAGCTGG - Intergenic
1031974519 7:128085253-128085275 GAGCAGCAGTGCTCACAGGCCGG + Intronic
1033742154 7:144283939-144283961 GTCCAGCTGGCCCCACAGGCGGG - Intergenic
1033751748 7:144365675-144365697 GTCCAGCTGGCCCCACAGGCGGG + Exonic
1035566064 8:642216-642238 GTCCATCAGGGCCCACAGGTCGG + Intronic
1036359305 8:8066020-8066042 GTCCAGCGGGTCTCCCAGCCAGG - Intergenic
1036723739 8:11201103-11201125 GCCCAGGAGGGAGCGCAGGCAGG + Exonic
1036891652 8:12600932-12600954 GTCCAGCGGGTCTCCCAGCCAGG + Intergenic
1040454389 8:47581543-47581565 GTCCAGCAGGGCTACTATGCTGG - Intronic
1043709863 8:83403037-83403059 GGCCAGCAGGGCTGGCTGGCTGG - Intergenic
1049002220 8:139833373-139833395 GGCCAGCAGTGTTCCCAGGCAGG + Intronic
1049268253 8:141681041-141681063 CTCCAGCAGGACTCGCAGGCAGG + Intergenic
1049269177 8:141685086-141685108 GGCCAGCAGGGCTGGCAGGGAGG - Intergenic
1049682221 8:143924496-143924518 TTCCGCCAGGGCACGCAGGCGGG + Exonic
1052790966 9:32875352-32875374 GTTCAGCAGAGCTCTCAGTCAGG - Intergenic
1053433759 9:38061406-38061428 TTCCAACAGAGCTCGCATGCTGG - Intronic
1057152763 9:92809132-92809154 GGCCAGGAGGGCCCTCAGGCCGG + Intergenic
1058005134 9:99906571-99906593 GCCCCGCAGGGCCCCCAGGCCGG - Intergenic
1058786479 9:108393608-108393630 GGCCACCAGGGCTGGCTGGCTGG - Intergenic
1058892771 9:109375068-109375090 GTCCTGCAGGGCTGCCAGGGTGG - Intergenic
1060224055 9:121780739-121780761 GGCCAGGAGGGCTCCCAGGCAGG + Intronic
1061329764 9:129885217-129885239 GTCCAGCAGGTGCCGCAGGGAGG + Intergenic
1061495728 9:130973279-130973301 CTCCAGCAGACCTCGGAGGCTGG + Intergenic
1061863945 9:133482476-133482498 GTGCAGCAGGGTTCGCAGCAGGG + Intergenic
1062623632 9:137433547-137433569 GCCCAGCAGTGCCCGCAGGCTGG - Exonic
1187669894 X:21657534-21657556 GTCCAGCAGGCGCTGCAGGCCGG + Exonic
1189304254 X:39974617-39974639 GGCCTGCTGGGCTTGCAGGCTGG + Intergenic
1192267916 X:69552651-69552673 GGCCAGCAGGACACCCAGGCTGG + Intergenic
1197795994 X:130299383-130299405 GGTCAGCAGGTCTGGCAGGCTGG + Intergenic
1198312643 X:135436720-135436742 GCCCAGCAGGCCTCGCTCGCGGG - Intergenic
1200274584 X:154719534-154719556 GTTCAGCAGGGCTGGAAGGCAGG + Intronic
1202604544 Y:26627383-26627405 GTCCCGCAGGGCCCGCACCCTGG + Intergenic