ID: 1166679229

View in Genome Browser
Species Human (GRCh38)
Location 19:44757157-44757179
Sequence CGCTGTCCAGCAGGGCTCGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 166}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166679229_1166679235 1 Left 1166679229 19:44757157-44757179 CCTGCGAGCCCTGCTGGACAGCG 0: 1
1: 0
2: 0
3: 14
4: 166
Right 1166679235 19:44757181-44757203 AGCTCCGGGCACGTTGGACCTGG 0: 1
1: 0
2: 0
3: 2
4: 48
1166679229_1166679239 20 Left 1166679229 19:44757157-44757179 CCTGCGAGCCCTGCTGGACAGCG 0: 1
1: 0
2: 0
3: 14
4: 166
Right 1166679239 19:44757200-44757222 CTGGAGGCCCGCAATTATGACGG 0: 1
1: 0
2: 0
3: 5
4: 39
1166679229_1166679236 4 Left 1166679229 19:44757157-44757179 CCTGCGAGCCCTGCTGGACAGCG 0: 1
1: 0
2: 0
3: 14
4: 166
Right 1166679236 19:44757184-44757206 TCCGGGCACGTTGGACCTGGAGG 0: 1
1: 0
2: 0
3: 2
4: 51
1166679229_1166679234 -5 Left 1166679229 19:44757157-44757179 CCTGCGAGCCCTGCTGGACAGCG 0: 1
1: 0
2: 0
3: 14
4: 166
Right 1166679234 19:44757175-44757197 CAGCGCAGCTCCGGGCACGTTGG 0: 1
1: 0
2: 1
3: 9
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166679229 Original CRISPR CGCTGTCCAGCAGGGCTCGC AGG (reversed) Exonic
900559059 1:3294662-3294684 CTCTGTCCCCCAGGCCTCGCGGG + Intronic
901772345 1:11536788-11536810 CGCTGGCCCGCAGGGCGCCCTGG - Exonic
903184325 1:21620678-21620700 CGCCTTCCAGGAAGGCTCGCAGG - Intronic
903759796 1:25689890-25689912 CCCTGGCCTGCAGGGCTGGCAGG + Intronic
903896087 1:26605997-26606019 CTCTGTCCAGCCGGGCGCGGTGG - Intergenic
905457415 1:38097614-38097636 CGGTGTGCAGCAGGACTGGCTGG - Intergenic
905888204 1:41502995-41503017 CGCTGGCCAGCAGGCCTCCCAGG - Intergenic
906840672 1:49135121-49135143 CTCTGTCCTGCCTGGCTCGCAGG + Intronic
914341493 1:146764016-146764038 CCCTGTCCAGCAGGGCTCTGAGG - Intergenic
915145044 1:153791864-153791886 CACACTCCAGCATGGCTCGCAGG - Intergenic
915568313 1:156729080-156729102 CGGGGTCCAGCAGGGAGCGCGGG - Exonic
916218842 1:162422782-162422804 GGCTGCCCAGCAGGGATGGCAGG - Intergenic
918450718 1:184655140-184655162 GGCTCTCCAGCAGGGCCTGCTGG + Intergenic
921297079 1:213714530-213714552 AGCTGGCCATCAGGGCTCTCAGG - Intergenic
921353111 1:214257843-214257865 TGCTGTGCAGCAGGGGTCGGGGG - Intergenic
922725566 1:227921485-227921507 CCCTGTGCAGCAGGGCTGGCAGG + Exonic
924709169 1:246519674-246519696 AGCTGTCCAGCAGGTCTCTGAGG - Intergenic
1064018348 10:11790171-11790193 CGCTGCCCAGCAGAGCAGGCAGG - Intergenic
1067281563 10:44877207-44877229 CCCCCTCCAGCAGGGCTGGCAGG + Intergenic
1069659070 10:70111690-70111712 CACTTTCCAGCAGGGATCGGAGG + Exonic
1069954796 10:72043393-72043415 CACTCTCCTGCAGGGCTGGCAGG + Intergenic
1076056925 10:127383592-127383614 CGCTGGACATCAGGGCTCCCAGG - Intronic
1076769902 10:132657180-132657202 CTCTGCCCAGCAGGCCTTGCAGG - Intronic
1076818278 10:132925307-132925329 GGCGGTCCAGCAGGGCTTGTGGG - Intronic
1077073427 11:688533-688555 CGTCCTCCAGCAGGGCTCTCTGG + Intronic
1077413027 11:2412282-2412304 AGCTGTCCAGCCGCCCTCGCTGG + Intronic
1078019504 11:7643932-7643954 CTCTGTCCAGCAGTGCTGACTGG - Intronic
1079351846 11:19698399-19698421 GGCTCTCCACCAGGGCTCTCTGG - Intronic
1080457220 11:32428497-32428519 CATGGGCCAGCAGGGCTCGCTGG - Exonic
1083180697 11:60982859-60982881 CGCTGCCCAGCAGGGCATGGCGG + Intronic
1084410889 11:69005358-69005380 CGCCGTCCCGCAGGGCCCGCTGG + Exonic
1084438463 11:69157432-69157454 CGCTGGCGAGCAGGGGGCGCGGG + Intergenic
1084661233 11:70547618-70547640 CGCTGTCCAGCTGGGATTACAGG - Intronic
1084970728 11:72770653-72770675 CGTTGTCTGGCAGGGCTTGCAGG + Intronic
1085461296 11:76695489-76695511 CCCTGTGCAGCAGGGGTCGTGGG - Intergenic
1091001004 11:131910795-131910817 CGCTGTCCGGCGGGGCTCGGCGG - Intronic
1091655287 12:2341562-2341584 CACAGTCCAGCAGGGCTCCGCGG - Intronic
1092617168 12:10225891-10225913 CCCGGGCCAGCAGGGCTGGCTGG + Intergenic
1096474677 12:51901066-51901088 AGCTGTCTACCAGGGCTCTCAGG - Intergenic
1096581793 12:52590459-52590481 CGCTGCTCAGCAGGGGTGGCAGG - Intronic
1096819160 12:54220450-54220472 AAATGTCCAGCAGGGCTCGTTGG + Intergenic
1097692270 12:62744689-62744711 CTCTGCCCAGCAGGCCTCACGGG + Intronic
1099001172 12:77179640-77179662 CTCTTCCCAGCAGGGCTGGCTGG + Intergenic
1099559632 12:84155384-84155406 CCCAGGCCAGCAGGGCTGGCCGG + Intergenic
1102907029 12:116684658-116684680 CTCAGTCCAGCAGAGCTTGCTGG - Intergenic
1108751545 13:53452655-53452677 CCCTGGCCAGCAGGGCTGGCTGG + Intergenic
1113482698 13:110633292-110633314 CCCGGGCCAGCAGGGCTGGCCGG + Intronic
1114454432 14:22846012-22846034 CCTTGTCCAGCAGGGAACGCTGG - Exonic
1115192366 14:30759321-30759343 CGCTGTTCAGCAATGCTCCCTGG + Intergenic
1120995910 14:90418767-90418789 CCCTGCCCAGCAGGGCTCAGGGG - Intergenic
1121301484 14:92875212-92875234 CGCTCTCCAGGAGTGCTCACAGG + Intergenic
1121817408 14:96939390-96939412 CTCTGTCCAGCAGGGCATACAGG + Intergenic
1122124796 14:99573165-99573187 CGCTGAGCAGCAGGTCCCGCGGG - Intronic
1122932829 14:104942619-104942641 CACTGTCCAGCTTGGCTCCCGGG + Exonic
1122935040 14:104952024-104952046 CACTGTCCAGCTTGGCTCCCGGG + Exonic
1123118542 14:105905769-105905791 CACTGTGCAGCAGGGCAGGCGGG - Intergenic
1123994691 15:25710280-25710302 CCCTGCCCAGCAGGGGGCGCCGG - Intronic
1124110625 15:26781959-26781981 CGCTGGCCAGCAAGCCTCGCAGG + Intronic
1124848278 15:33311757-33311779 CCCTGTCCTGCGGGGCTCGCGGG - Intronic
1126735113 15:51724417-51724439 CGCTATCCAGAAGTGCTAGCTGG + Intronic
1129276079 15:74446143-74446165 CGGTGGCCTGCAGGGCCCGCAGG + Exonic
1129706936 15:77799696-77799718 TGGTGGCCAGCAGGGCTCACTGG - Intronic
1131052617 15:89358768-89358790 CGCTGTCCAACAGCGCCCTCTGG - Intergenic
1132840583 16:1976753-1976775 AGCTGGCCATCAGGGCTGGCTGG + Intronic
1136348912 16:29694692-29694714 AGCTGTCCACCAGGGCTGCCAGG - Exonic
1139992786 16:70953426-70953448 CCCTGTCCAGCAGGGCTCTGAGG + Intronic
1142711564 17:1726540-1726562 GGCTCTCCAGCAGGGCTCGGTGG - Exonic
1143766052 17:9138438-9138460 AGGTGTCCTGCAGGGCTCGGTGG + Intronic
1143974426 17:10819719-10819741 CACTGCACAGCAGGGCTCTCTGG - Intergenic
1146757856 17:35448914-35448936 CGCTGTCTAGAAGGCCTGGCGGG + Intergenic
1147158936 17:38559629-38559651 CGCTGTTCTGCAGGCCTCGCAGG + Exonic
1148747534 17:49927064-49927086 TGCTGTCCAGCAGGGGTGGGAGG - Intergenic
1148871516 17:50661147-50661169 CCCTGGGCAGCAGGGCTGGCTGG + Intronic
1151570613 17:74923680-74923702 CGCACTCCAGCAGGGGGCGCTGG + Intergenic
1160605021 18:80043685-80043707 CATTGTCCAGCAGGGCTTGTGGG + Intronic
1160691010 19:460730-460752 CGCGGCGCAGCGGGGCTCGCAGG + Exonic
1165060644 19:33203765-33203787 CTCTGTCCTGCAGGGGTGGCTGG + Intronic
1166679229 19:44757157-44757179 CGCTGTCCAGCAGGGCTCGCAGG - Exonic
1166822842 19:45591233-45591255 CGCTGCCCCGCACGGCCCGCAGG + Exonic
1167214107 19:48152648-48152670 CACTGGCCAGCAGGTGTCGCTGG - Intronic
1168364887 19:55777752-55777774 CGCTGCCCAGCTGGGGGCGCTGG + Intergenic
925162440 2:1695303-1695325 CTCTGTCCAGCAGGGCACAGGGG - Intronic
925162466 2:1695422-1695444 CTCTGTCCAGCAGGGCACAGGGG - Intronic
925162477 2:1695466-1695488 CTCTGTCCAGCAGGGCACAGGGG - Intronic
925162487 2:1695510-1695532 CTCTGTCCAGCAGGGCACAGGGG - Intronic
925162497 2:1695554-1695576 CTCTGTCCAGCAGGGCACAGGGG - Intronic
925162508 2:1695598-1695620 CTCTGTCCAGCAGGGCACAGGGG - Intronic
925162535 2:1695717-1695739 CTCTGTCCAGCAGGGCACAGGGG - Intronic
925162546 2:1695761-1695783 CTCTGTCCAGCAGGGCACAGGGG - Intronic
925162557 2:1695805-1695827 CTCTGTCCAGCAGGGCACAGGGG - Intronic
925162567 2:1695849-1695871 CTCTGTCCAGCAGGGCACAGGGG - Intronic
925162578 2:1695893-1695915 CTCTGTCCAGCAGGGCACAGGGG - Intronic
925240920 2:2326442-2326464 TGGTGTCTAGCAGGGCTCGATGG - Intronic
929646955 2:43637452-43637474 CCCCGTCCAGGGGGGCTCGCGGG + Intronic
929974264 2:46616818-46616840 GTCTGTCCATCAGGGCACGCCGG + Intronic
931232429 2:60386113-60386135 TGCTTTCCAGCAGAGCTGGCAGG + Intergenic
932036651 2:68252626-68252648 CGCCGCCCAGCGGGGCGCGCAGG - Intronic
932402367 2:71489761-71489783 GGCTGTCCATCAGAGCTTGCAGG + Intronic
932486459 2:72086979-72087001 CCCGGGCCAGCAGGGCTGGCTGG - Intergenic
935592371 2:104855085-104855107 CTCGCTCCAGCGGGGCTCGCCGG - Intergenic
936008109 2:108907928-108907950 CCCTGACAAGCAGGGCTCCCCGG - Exonic
946402437 2:219475697-219475719 GGCTGTGCTGCAGGGCTCTCAGG - Intronic
946688538 2:222294408-222294430 CGCTGCCCTGCACTGCTCGCGGG + Intronic
948289642 2:236815793-236815815 GGCTCTCCAGCAGGTCTGGCTGG + Intergenic
1169123201 20:3109760-3109782 CCCTGTCCAGCAGGGCACTGTGG - Exonic
1169344828 20:4821814-4821836 GGCAGTCCAGCAGGCCTCACAGG - Intronic
1175441616 20:58996306-58996328 CCCTCTCCAGCAGTGCTCACAGG + Intronic
1176092465 20:63325310-63325332 TGGAGGCCAGCAGGGCTCGCCGG + Intronic
1176303000 21:5107607-5107629 TGGTGTCCAGCATGGCTCGTGGG + Intergenic
1176303431 21:5110926-5110948 TGGTGTCCAGCATGGCTCGTGGG - Intergenic
1176710773 21:10147477-10147499 CCCTGTCCTGCAGGTCTCACAGG + Intergenic
1179853601 21:44151024-44151046 TGGTGTCCAGCATGGCTCGTGGG + Intergenic
1179854025 21:44154317-44154339 TGGTGTCCAGCATGGCTCGTGGG - Intergenic
1180967183 22:19796710-19796732 GACTGTCCAGCTGGGCTCCCTGG - Intronic
1181499814 22:23309429-23309451 CTCTGTCCTGCAGGGCCTGCGGG - Exonic
1181705036 22:24644745-24644767 CTCTGTCCTGCAGGGCCTGCGGG - Intergenic
1181804015 22:25364416-25364438 CTCTGTCCAGCCAGGCTGGCAGG + Intronic
1183924662 22:41197386-41197408 CGCTGTCCAGCAGTCCCGGCTGG + Intergenic
1184060010 22:42075637-42075659 CACTTACCAGCAGGGCTCACTGG - Exonic
1184101886 22:42345104-42345126 GACTGTCCAGGAGGGCCCGCAGG + Intergenic
1184433952 22:44458718-44458740 CTCTTTCCACCAGGGCCCGCGGG - Intergenic
1184663574 22:45976427-45976449 GGCGGTCCGGCCGGGCTCGCGGG - Intronic
1185134922 22:49064022-49064044 CTCTGTCCAGAGGGGCTCCCAGG + Intergenic
1185398353 22:50603828-50603850 CCCTGCCCAGCAGAGCTCCCGGG + Exonic
954614771 3:51964050-51964072 CTCTGGTCAGCAGGGCTCCCTGG + Intronic
955179951 3:56658146-56658168 CGTTTTCCAGCAGGCCTCACTGG - Intronic
955334906 3:58077263-58077285 AGCTGTCTACCAGGGCTCCCAGG - Exonic
960611641 3:119560056-119560078 CACTGTCCAGCGTGGCTGGCAGG - Intergenic
967920049 3:194607831-194607853 CACTGTCCAGCTGGGCTGGCAGG - Intronic
968713750 4:2139243-2139265 CTCTGCCAAGCAGGGCTGGCCGG + Intronic
969704447 4:8784316-8784338 TGCCGCCCAGCAGGGCTCGGTGG + Intergenic
979632769 4:122922335-122922357 CGCCTTCCAGAAGGGCTTGCAGG - Exonic
984243813 4:177250276-177250298 CACGGTCCAGCAGCGCTCCCAGG - Intergenic
986748067 5:10761310-10761332 CGCGGCCCAGCAGGGCGGGCGGG - Intergenic
991161971 5:63513780-63513802 GGTTGTCTAGCAGGGCTCACTGG - Intergenic
999709328 5:154302460-154302482 AGCAGCCCAGCAGGGCTCCCAGG - Intronic
1001083770 5:168685790-168685812 CGCTGCCCACCAGGCTTCGCCGG - Exonic
1002444236 5:179279457-179279479 CGTTGTCCAGCAGATCTCCCAGG - Intronic
1002614033 5:180439265-180439287 GGCTGTCCAGCAGAGGTGGCCGG - Intergenic
1002696779 5:181097661-181097683 CGCCTTCCAGCAGGATTCGCTGG + Intergenic
1002697843 5:181101712-181101734 CGCCTTCCAGCAGGATTCGCTGG - Intergenic
1002707763 5:181174231-181174253 CGCCTTCCAGCAGGATTCGCGGG + Intergenic
1004208325 6:13613383-13613405 TGCTGTCCAGCAGGTGTCACAGG + Exonic
1004820885 6:19366677-19366699 CGCTCTGCAGAAGGGCTCGTAGG - Intergenic
1005470242 6:26156250-26156272 CGCTGTCCAGCCCGCCTCGCTGG - Intergenic
1007775305 6:44221703-44221725 GGCTGTCCAGCAGGGGGCCCTGG + Intronic
1008091556 6:47298874-47298896 AGCTGTCCTGCAGGGCCTGCTGG - Intronic
1013017154 6:106170184-106170206 AGCTGCCCAGCAGGGCTAGGAGG - Intergenic
1013170770 6:107634821-107634843 CGTTGTGCAGCCGGGCTCGGTGG - Exonic
1015078453 6:129192793-129192815 AGCTGTGCGGCAGGGCTTGCCGG - Exonic
1018744888 6:166754480-166754502 CCCTGTGCAGCAGGGCCCACGGG - Intronic
1019165946 6:170097666-170097688 CACTGGCCAGCAGAGCTCCCAGG + Intergenic
1019983284 7:4637570-4637592 CGCTGGCCAGCAGGGTTGGGAGG - Intergenic
1024306363 7:47932639-47932661 CCCACTCCTGCAGGGCTCGCTGG - Intronic
1025208796 7:57009155-57009177 CGGTGGCCAGCAGGGCCCGGCGG - Intergenic
1026900371 7:74033696-74033718 CGCTGCACAGCTGGGCTTGCTGG - Intronic
1027761463 7:82284658-82284680 CGCTGTACAGAAGGGCTTGAAGG - Intronic
1032054270 7:128672254-128672276 GGCTGTCCACCAGGGCTGGGAGG - Intergenic
1034878817 7:154748566-154748588 CCCCGCCCCGCAGGGCTCGCAGG - Intronic
1035089808 7:156299186-156299208 CGGGGTCCAGCATGCCTCGCTGG + Intergenic
1038019587 8:23541628-23541650 CGCTGCCCGGCAGGTCTGGCTGG - Intronic
1049268252 8:141681037-141681059 TGCTCTCCAGCAGGACTCGCAGG + Intergenic
1049269179 8:141685090-141685112 TGCAGGCCAGCAGGGCTGGCAGG - Intergenic
1050343372 9:4662681-4662703 CGATGGCCAGCAGGGAGCGCAGG - Exonic
1053034128 9:34810095-34810117 CGCTGCCCAGCGGAGCTCGAGGG - Intergenic
1053157492 9:35791403-35791425 CGCCGGCCAGCAGGGTTCCCGGG - Intergenic
1053647756 9:40133173-40133195 CCCTGTCCTGCAGGTCTCACAGG + Intergenic
1053757975 9:41330670-41330692 CCCTGTCCTGCAGGTCTCACAGG - Intergenic
1054536824 9:66242997-66243019 CCCTGTCCTGCAGGTCTCACAGG - Intergenic
1057383939 9:94591406-94591428 CGGGGGCCAGCAGGGCTGGCTGG + Intronic
1057543878 9:96001981-96002003 CGGGGACCAGCAGGGCTGGCTGG + Intronic
1057838671 9:98467486-98467508 CGCTGTGAAGCTGGGCTCTCTGG + Intronic
1059703084 9:116794863-116794885 TGCAGTCCAGCAAGGCTTGCTGG + Intronic
1062109308 9:134773293-134773315 CGCAGCCCAGCAGGCCCCGCAGG - Intronic
1062144387 9:134980853-134980875 CGCTGTGAAGGAGGACTCGCTGG - Intergenic
1062262558 9:135670227-135670249 CTCAGTCCAGCAGGGCTCCAGGG + Intergenic
1202795533 9_KI270719v1_random:116465-116487 CCCTGTCCTGCAGGTCTCACAGG + Intergenic
1190737417 X:53264715-53264737 TGGTGTCCAGGAGGGCTTGCTGG - Intronic
1195896384 X:109749582-109749604 CCCAGTGCAGCAGGGCTGGCTGG + Intergenic
1200108395 X:153726609-153726631 CGGCGTCCAGCAGAGCTGGCTGG + Intronic
1200215825 X:154367851-154367873 AGCTGTCCACCAGGGCGCCCAGG + Exonic