ID: 1166679230

View in Genome Browser
Species Human (GRCh38)
Location 19:44757165-44757187
Sequence CGGAGCTGCGCTGTCCAGCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 5, 3: 18, 4: 177}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166679230_1166679236 -4 Left 1166679230 19:44757165-44757187 CCCTGCTGGACAGCGCAGCTCCG 0: 1
1: 0
2: 5
3: 18
4: 177
Right 1166679236 19:44757184-44757206 TCCGGGCACGTTGGACCTGGAGG 0: 1
1: 0
2: 0
3: 2
4: 51
1166679230_1166679243 29 Left 1166679230 19:44757165-44757187 CCCTGCTGGACAGCGCAGCTCCG 0: 1
1: 0
2: 5
3: 18
4: 177
Right 1166679243 19:44757217-44757239 TGACGGTAAGCATTTACCGCGGG 0: 1
1: 0
2: 0
3: 1
4: 18
1166679230_1166679242 28 Left 1166679230 19:44757165-44757187 CCCTGCTGGACAGCGCAGCTCCG 0: 1
1: 0
2: 5
3: 18
4: 177
Right 1166679242 19:44757216-44757238 ATGACGGTAAGCATTTACCGCGG 0: 1
1: 0
2: 0
3: 1
4: 25
1166679230_1166679239 12 Left 1166679230 19:44757165-44757187 CCCTGCTGGACAGCGCAGCTCCG 0: 1
1: 0
2: 5
3: 18
4: 177
Right 1166679239 19:44757200-44757222 CTGGAGGCCCGCAATTATGACGG 0: 1
1: 0
2: 0
3: 5
4: 39
1166679230_1166679244 30 Left 1166679230 19:44757165-44757187 CCCTGCTGGACAGCGCAGCTCCG 0: 1
1: 0
2: 5
3: 18
4: 177
Right 1166679244 19:44757218-44757240 GACGGTAAGCATTTACCGCGGGG 0: 1
1: 0
2: 0
3: 0
4: 10
1166679230_1166679235 -7 Left 1166679230 19:44757165-44757187 CCCTGCTGGACAGCGCAGCTCCG 0: 1
1: 0
2: 5
3: 18
4: 177
Right 1166679235 19:44757181-44757203 AGCTCCGGGCACGTTGGACCTGG 0: 1
1: 0
2: 0
3: 2
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166679230 Original CRISPR CGGAGCTGCGCTGTCCAGCA GGG (reversed) Exonic
900177331 1:1296647-1296669 TGGAGCTGCTCGGTCCCGCAGGG + Intronic
900583940 1:3423468-3423490 CGGTGCTGCCCTGTACAGGAGGG - Intronic
900953502 1:5873078-5873100 CGGAGCTGCCCTGCCCAGCGAGG + Intronic
901451875 1:9340828-9340850 CGGAGCAGCTCTGCCCAGCAAGG + Intronic
901739585 1:11333674-11333696 AGGAGCTAAGCTGCCCAGCAGGG - Intergenic
902774502 1:18666111-18666133 CGGAGCTACGCTGCCCAGACTGG - Intronic
904040572 1:27582098-27582120 TGGAGCTGCGCTGGAGAGCAGGG - Intronic
908248448 1:62246402-62246424 GGAAGCTCTGCTGTCCAGCAGGG - Intronic
909344751 1:74572112-74572134 CAGAGAAGAGCTGTCCAGCAGGG - Exonic
909806317 1:79876835-79876857 CAGAGCTGCGGTGTGCAGCCTGG + Intergenic
921167443 1:212517156-212517178 AGGACCTGCACAGTCCAGCAGGG - Intergenic
921830474 1:219722972-219722994 CGGAGCTTCCCTGTCCTCCATGG - Intronic
922579226 1:226684861-226684883 CTGAGCTGCTCTGCCCATCATGG + Intronic
923552399 1:234974373-234974395 CGGCGCTGTGCTGGCCTGCATGG + Intergenic
923565049 1:235070190-235070212 CGGAGCTGCGACGTTCAGGAGGG - Intergenic
923606267 1:235445939-235445961 TAGAGCTGCGCTGTCCAGTGTGG + Intronic
923786516 1:237073424-237073446 CAGAGCCCCGCTGTCCAGTATGG + Intronic
1063520728 10:6738438-6738460 CGGCGCTGTGCTTTCCAGGATGG + Intergenic
1063606830 10:7529866-7529888 AGGAACTGGGCTGCCCAGCAAGG - Intergenic
1067118620 10:43455543-43455565 CTGAGCTGCGTCGTCCAGCCGGG - Intronic
1067566802 10:47345546-47345568 CGGAGCTGGGCAGTACAGGAAGG - Intergenic
1067712421 10:48659434-48659456 CGGGTCAGCGCTGTCCAACAGGG + Intergenic
1068390468 10:56389503-56389525 TAGAGTTGCACTGTCCAGCATGG - Intergenic
1069572759 10:69504321-69504343 CAGAGTTGCACCGTCCAGCAGGG - Intronic
1070285330 10:75079369-75079391 TAGACCTGGGCTGTCCAGCATGG - Intergenic
1070955268 10:80459562-80459584 TGGAGTTGGGCTGTCCTGCATGG + Intronic
1072469083 10:95694810-95694832 CGTAGCTGCACTGTCCAGCATGG + Intergenic
1074312977 10:112338398-112338420 CGGATCTGCACTGTCCAATATGG - Intergenic
1075588975 10:123677808-123677830 TAGAGCTGTGCTGTCCAGCACGG + Intronic
1076085084 10:127620390-127620412 GGGAGCTGGGCTCTCCAGGATGG - Intergenic
1079076452 11:17388076-17388098 CGGAGCCATGCTGTCCCGCAAGG - Exonic
1084793920 11:71491670-71491692 CGGTGCTGGGCTTTCCAGCGGGG - Intronic
1085458805 11:76680908-76680930 CGGGGCTCCGCTGCCCAGCAGGG - Intergenic
1091797593 12:3306140-3306162 CAGAGCTGTGCTGTCCAATACGG - Intergenic
1091903423 12:4164263-4164285 CGGAGCTGCGGAGACCAGAAGGG - Intergenic
1098658025 12:73057590-73057612 AGGACCTGGGCTGCCCAGCAGGG + Intergenic
1101747624 12:107555613-107555635 CAGAGCTGCACTGTCCAGCATGG + Intronic
1101811429 12:108111467-108111489 CAGAGCTGGGCTGTCCTCCAGGG + Intergenic
1104043640 12:125146333-125146355 GGGAGATGTGCTGCCCAGCAGGG + Intergenic
1108761593 13:53572888-53572910 GGGAGCTGCTCTGTGCTGCAGGG + Intergenic
1111144490 13:84163178-84163200 CTGAGCTGCACTGTCCAAAAGGG + Intergenic
1112623908 13:101080235-101080257 CAGAGCTGTGCTATCCAACATGG + Intronic
1116082194 14:40188186-40188208 TAGAGCTGTGCTGTCCAACATGG + Intergenic
1117846622 14:59919299-59919321 TGGATCTGCGCAGTCCAGCAGGG - Intergenic
1119472436 14:74908408-74908430 AGCAGCTGCCCTGTCCAGCCTGG - Intronic
1119706770 14:76787969-76787991 CGGATTGGCTCTGTCCAGCAAGG - Exonic
1121797824 14:96750172-96750194 CAGAGCTGCGCTGTCCAGTATGG + Intergenic
1121817407 14:96939382-96939404 AGAGGCTGCTCTGTCCAGCAGGG + Intergenic
1121955582 14:98209971-98209993 CAGATGTGCACTGTCCAGCAAGG - Intergenic
1124382229 15:29176664-29176686 CGGTGCTGCCCCGTCCAACAGGG - Intronic
1125430004 15:39584103-39584125 CTGTGATGAGCTGTCCAGCATGG + Exonic
1126145255 15:45467851-45467873 CGGAACTGTGCTGTCCAATATGG - Intergenic
1126425371 15:48521911-48521933 AGGAACTGGGCTGTACAGCAGGG + Intronic
1127075713 15:55323488-55323510 TAGAGCTGCACTGTCCACCATGG + Intronic
1128811224 15:70574282-70574304 GGGTGCTGCGCTGCCCAGTAGGG + Intergenic
1128919410 15:71596762-71596784 CAGAGCTGCGCTCCCCAGCCAGG - Intronic
1129246427 15:74281729-74281751 GGAAGCTGCCCTGGCCAGCATGG + Intronic
1131377313 15:91936304-91936326 TGGAGCTGCACTGTCCAATATGG + Intronic
1132955202 16:2588313-2588335 TGGAGCTGCGCAGCACAGCACGG - Intronic
1136561742 16:31043074-31043096 AGGGGCGGCGCTGTCCAGCATGG - Intergenic
1137632188 16:49954752-49954774 TAGAACTGTGCTGTCCAGCATGG + Intergenic
1138315877 16:56069681-56069703 CAGAACTGTGCTGTCCTGCAAGG - Intergenic
1141196323 16:81864281-81864303 TGGGGCTGCGCTGTCCAGCAGGG + Intronic
1142681517 17:1551916-1551938 GAGAGCAGCGCTGTCCAGCGGGG - Intronic
1143012957 17:3876288-3876310 CGACGCTCAGCTGTCCAGCACGG - Exonic
1146240782 17:31222853-31222875 CAGAGCTGCACTGTCTAACATGG - Intronic
1146431596 17:32801436-32801458 TGCAGCTGGGTTGTCCAGCAGGG + Intronic
1147316028 17:39620722-39620744 AGGAGCTTCGGTCTCCAGCAGGG + Intergenic
1149991715 17:61387249-61387271 CTGAGCTGGGCCGTGCAGCATGG - Intronic
1150389352 17:64781506-64781528 CGGAGCCGCGCGGTCGAGGAGGG - Intergenic
1150693923 17:67387980-67388002 CAGACCTGCACTGTCCAGTATGG - Intronic
1151458868 17:74242922-74242944 CAGAGCTGTGCTGTCCAGGGTGG + Intronic
1155996223 18:32333850-32333872 AGGAGCAGCTGTGTCCAGCATGG + Intronic
1156023745 18:32629034-32629056 TCGAGCTGTGCTGTCCAGCATGG - Intergenic
1157963177 18:52179452-52179474 GGGACCTGGGCTGTCCACCATGG + Intergenic
1158182687 18:54735234-54735256 CTGTGCTGTGCTGTCCAGTAAGG + Intronic
1161551037 19:4912235-4912257 CGGAGCTCCTCTGTCGAGCCCGG - Intronic
1162900661 19:13793862-13793884 CAGACCTGCACTGTCCAGTATGG - Intergenic
1165521639 19:36318964-36318986 CAGAGCTGTGCTGTCCAATAAGG + Intergenic
1165622566 19:37260529-37260551 CAGAGCTGCGCTGTCCAATAAGG - Intergenic
1165634130 19:37326262-37326284 CAGAGCTGTGCTGTCCAATAAGG - Intronic
1166679230 19:44757165-44757187 CGGAGCTGCGCTGTCCAGCAGGG - Exonic
1166862276 19:45817299-45817321 CGGACCTCCGCTGTTTAGCAGGG - Intronic
1168094956 19:54109240-54109262 CGTACCTGTGCTGTCCAGCACGG - Intronic
1168394899 19:56039377-56039399 TAGAGCTGTGCTGTCCAGAATGG - Intronic
925193997 2:1908630-1908652 CGGGGCTGCGTAATCCAGCAAGG - Intronic
927586290 2:24308888-24308910 CCGAGCCCCGCTGTCCAGCCCGG - Intronic
927647684 2:24888330-24888352 AGGAGCTGAGCCGTCCAGCTGGG - Intronic
928037958 2:27843899-27843921 AAGAGCTGTGCTGTCCAACATGG + Intronic
928385556 2:30864833-30864855 CAGAGCTGTGCTGTCCAATATGG + Intergenic
929026591 2:37610250-37610272 TGGAGATGCGATGTGCAGCATGG + Intergenic
929999818 2:46853720-46853742 CTGAGCTGTGCTGTCCAATATGG - Intronic
930189740 2:48445258-48445280 TGTATCTGTGCTGTCCAGCAGGG + Intronic
930823831 2:55675742-55675764 CAGAGCTGTGCTGTCCAATATGG + Intronic
932185006 2:69687037-69687059 AGGAGCGGCGCTGTGCAGCCTGG + Intronic
932584400 2:73016972-73016994 GGGAGCTGCACTGCCCAGCATGG + Intronic
935754734 2:106268181-106268203 TGGGGCTGCTCTGCCCAGCAGGG + Intergenic
935755883 2:106275954-106275976 GGGACCTGCGCACTCCAGCAAGG - Intergenic
936113718 2:109685619-109685641 TGGGGCTGCTCTGCCCAGCAGGG - Intergenic
937122755 2:119452122-119452144 GGGAGCTGGGCTAACCAGCAAGG + Intronic
939182492 2:138820115-138820137 TGGAGCTGTGCTGTCCAACATGG + Intergenic
939884569 2:147666899-147666921 CAGAGCTGCACTGTTCAACATGG - Intergenic
946411899 2:219519709-219519731 CAGAGCTGCGCTGTCCAACACGG - Intronic
948597594 2:239090174-239090196 CTGAGCTGCTCTGCCCAGCCAGG - Intronic
1169293798 20:4375360-4375382 TGGAGCTGCTCTTTGCAGCAGGG + Intergenic
1170740265 20:19049820-19049842 GGGAGGTGCGCAGCCCAGCAGGG + Intergenic
1171346581 20:24470130-24470152 CGGAGCCAGGCTGCCCAGCAGGG + Intronic
1171545109 20:25994375-25994397 CAGAGCTGTGCTGTCCAACAAGG + Intergenic
1172565551 20:35927596-35927618 TGGAACTGCACTGTCCAGTATGG - Intronic
1173142983 20:40500895-40500917 TAGAGCTGTGCTATCCAGCATGG - Intergenic
1174054381 20:47787976-47787998 CAGAGTTGCACTGTCCAGCATGG - Intergenic
1175089523 20:56490472-56490494 CAGATCTGTGCTGTTCAGCATGG + Intronic
1178288252 21:31344009-31344031 CCGAGCTGAGCTGTGCAGCTGGG - Intronic
1179480246 21:41672315-41672337 CGGAGCTCTGCCGCCCAGCAGGG - Intergenic
1179614518 21:42573149-42573171 TTAAGCTGCGCTGTCCTGCACGG + Intronic
1180056786 21:45363004-45363026 AGGAACAGAGCTGTCCAGCAGGG - Intergenic
1180122295 21:45761879-45761901 GGGAGCTGCGCTGGGCAGCTGGG - Intronic
1180157593 21:45985693-45985715 CGAGGCTGCCCTGTCCAGCCAGG + Intronic
1182685769 22:32121007-32121029 GGGGGCTGCACTGCCCAGCAGGG - Intergenic
1183477263 22:38042475-38042497 AGGAGCCGCACTGTCCAGGAGGG + Intergenic
1185175195 22:49322467-49322489 AGGGGCTGCCCTGCCCAGCAGGG + Intergenic
1185364876 22:50432880-50432902 CCGAGCTGGGCTGTACAGCATGG + Intronic
949926003 3:9042345-9042367 GAGAGCTGTGCTGTCCAGTATGG - Intronic
950420835 3:12898444-12898466 TGGAGCTGTGCTGGGCAGCAGGG - Exonic
952738765 3:36715830-36715852 TCGAGCTGTGCTGTCCAACATGG - Intronic
953727917 3:45416755-45416777 TGGAGCTGTGCTGTCCAATATGG - Intronic
954314331 3:49792987-49793009 CGGGGCTGCTCTGGCCAGAACGG + Exonic
960999706 3:123365939-123365961 CAGAACTGAGCTGTCCACCAGGG + Intronic
961051828 3:123753073-123753095 AGGACCTGCACTGCCCAGCACGG + Intronic
961333430 3:126156232-126156254 TGAAGCTGCACTGTCCAACAAGG - Intronic
962150510 3:132888296-132888318 TAGAGCTGTGCTGTCCAGCATGG - Intergenic
965586560 3:170324037-170324059 GGGAGCTGTGTTGTCCACCATGG + Intergenic
966152927 3:176884601-176884623 TAGAGCTGTGCTGTCCAACATGG + Intergenic
966652385 3:182315557-182315579 CGGTGCTGTGCTGGCCAGCGGGG + Intergenic
968055980 3:195692138-195692160 CGTAGCTGCACTGTCCAGTGAGG - Intergenic
968214014 3:196872652-196872674 CGGAGCTGCACTATCCAGTGTGG + Intronic
969273238 4:6117072-6117094 ACGAGCTGTGCTGTCCTGCAGGG - Intronic
970195534 4:13547414-13547436 CGGAGCTGCGCGGCCCGGCCGGG + Intergenic
971354345 4:25881271-25881293 CGTACCTCCTCTGTCCAGCATGG - Intronic
972831281 4:42816391-42816413 CGTAGCTGCTCTGGCAAGCAGGG - Intergenic
982258246 4:153470764-153470786 CTGACCTGCTCTGTCCTGCAGGG + Intronic
986613066 5:9589241-9589263 CTGAGCTGCGCTGAGCAGAAGGG - Intergenic
992377498 5:76202711-76202733 TAGAGCTGCGTTGTCCAACATGG + Intronic
994085154 5:95750378-95750400 TAGACCTGCGCTGTCCAGTATGG + Intronic
997367661 5:133336204-133336226 CAAAGCTGGGCTGTCCAGCTCGG + Intronic
1002178656 5:177417790-177417812 AGGAGCTGCACTGTCCAACATGG - Intronic
1002330054 5:178434903-178434925 CGGGGCTGGGCTGCCCTGCAAGG - Intronic
1004065053 6:12235859-12235881 CAGAGCTGCACTGTCCAATATGG - Intergenic
1005298791 6:24451076-24451098 CGTAGCTGTGCTGTCCAGTGCGG - Intronic
1005374977 6:25172872-25172894 TGGAGCTGAGATGTCCAGGAAGG - Intergenic
1006641587 6:35492237-35492259 CTGAGCTGGGCTGACCAGCCGGG + Intronic
1006747110 6:36350751-36350773 AGAAGCTGCGCATTCCAGCAAGG + Intergenic
1007669800 6:43542285-43542307 TGAAGCTGTGCTGTCCAGCATGG - Intronic
1009953299 6:70421403-70421425 TAGAGCTGCTCTGTCCAACATGG - Intronic
1010378277 6:75200224-75200246 CAGAGCTGTGCTGTCCGACACGG + Intronic
1013322544 6:109009280-109009302 CCGAGCTGCCCTGTGCAACACGG - Intronic
1015217680 6:130768685-130768707 GGGAACTGCACTGTCCAACAGGG - Intergenic
1015742872 6:136476281-136476303 AAGAGCTGTGCTGTCCAGTAGGG + Intronic
1017237191 6:152129040-152129062 CAGCTCTGCTCTGTCCAGCACGG - Intronic
1018646397 6:165952695-165952717 CGCAGCTGCCCTGACCAGCCTGG + Intronic
1019401106 7:854493-854515 TGCATCTGTGCTGTCCAGCAGGG - Intronic
1023879207 7:44308958-44308980 CTGAGCTGCGGTGACCAGCCTGG + Intronic
1024584623 7:50831279-50831301 TGGAGCTGGGCTGTCCAATATGG - Intergenic
1025296521 7:57779444-57779466 CGGAGCTGTGCTGTTCAATAAGG + Intergenic
1026471295 7:70695285-70695307 CGGAGCTGCGCGGTCGTGCCCGG + Intronic
1026517411 7:71084889-71084911 CAGAGCTGCACTGTCCAACCAGG + Intergenic
1026846086 7:73699915-73699937 CAGAGCTGGGCTGTCCCTCAGGG + Exonic
1030537318 7:110784855-110784877 TAGAGCTGCACTGTCCAGCATGG + Intronic
1031055518 7:116989294-116989316 CAGAGCTGCACTGTCCAAAAGGG - Intronic
1033520588 7:142156586-142156608 CAGAGCTGTGCTGTCCACTATGG - Intronic
1035643613 8:1201524-1201546 CGGAGATGCGATGTCCAAAACGG - Intergenic
1037974031 8:23196830-23196852 AGGGGCTGCCCTGTCCTGCATGG - Intronic
1038573155 8:28680642-28680664 CGGAGATCTGCTGTACAGCATGG - Intronic
1040847705 8:51861640-51861662 CAGAGCAGCACTGTCCAGTATGG - Intronic
1044866718 8:96578249-96578271 TAGAGCTGCACTGTCCAGTATGG + Intronic
1045211664 8:100106029-100106051 CGGAGCTACGCTGGCTAGCGTGG + Exonic
1046486341 8:114893889-114893911 CAGAGCTGCAGTGTGCAGCATGG - Intergenic
1047198012 8:122739038-122739060 CAGAACTGCCCTGTCCAGTATGG + Intergenic
1047893117 8:129334865-129334887 GGGAGCTTTGCTTTCCAGCATGG - Intergenic
1049033066 8:140051290-140051312 TGGAGCTGCTCTGTCCATCCTGG - Intronic
1049646574 8:143738391-143738413 CGGTGCTGCGGGCTCCAGCAAGG - Intergenic
1049848698 8:144819354-144819376 AGGACCTGCAGTGTCCAGCATGG - Intergenic
1053084169 9:35204019-35204041 TGGAGCTGTGCAGTGCAGCAAGG - Intronic
1053291433 9:36882034-36882056 AGTAGCTGCCCTGTCCAGCGGGG + Exonic
1057186350 9:93059272-93059294 TGGAGCTGCGCTGGTCACCAAGG - Intronic
1057458552 9:95237517-95237539 CACAGCTGCCCTGTCCAACACGG + Intronic
1057525247 9:95793437-95793459 TGTATCTGTGCTGTCCAGCAGGG + Intergenic
1057770159 9:97960405-97960427 CAGAGCTGTGCTGTCCAATATGG - Intergenic
1058897247 9:109410998-109411020 TGGAGCTGCACTGTCTAGTATGG + Intronic
1060894262 9:127207701-127207723 CAGAGTTGCCCTGCCCAGCACGG + Intronic
1186684864 X:11915526-11915548 CAGAGCTGTGCTGTCCAATATGG + Intergenic
1187018251 X:15351626-15351648 TTGAGCTGGGCTGTCCAACAAGG + Intronic
1190308800 X:49101975-49101997 CTGAGATGGGCTGTGCAGCAGGG + Intergenic
1191663734 X:63676758-63676780 CAGAGCTGTACTGTCCAACATGG + Intronic
1195687823 X:107601880-107601902 CGCAGCAGCCCTGTGCAGCAGGG + Exonic
1196960191 X:120992735-120992757 CAGAGATGCGCTGCCCAGAAAGG + Intergenic
1197571627 X:128156994-128157016 TGGAGCTGCTCTCTCCTGCATGG + Intergenic
1198053635 X:132972884-132972906 TAGAGCTGTGCTGTCCAGTATGG - Intergenic
1198526212 X:137503631-137503653 GAGAGCTGCCCTGACCAGCAGGG - Intergenic
1199246356 X:145609645-145609667 ATGAGCAGCGCTGTCCAGTAGGG - Intergenic
1201517051 Y:14829758-14829780 CGGCACTGCCCTGTCCAGCTGGG + Exonic