ID: 1166679231

View in Genome Browser
Species Human (GRCh38)
Location 19:44757166-44757188
Sequence CCGGAGCTGCGCTGTCCAGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 134}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166679231_1166679236 -5 Left 1166679231 19:44757166-44757188 CCTGCTGGACAGCGCAGCTCCGG 0: 1
1: 0
2: 1
3: 15
4: 134
Right 1166679236 19:44757184-44757206 TCCGGGCACGTTGGACCTGGAGG 0: 1
1: 0
2: 0
3: 2
4: 51
1166679231_1166679242 27 Left 1166679231 19:44757166-44757188 CCTGCTGGACAGCGCAGCTCCGG 0: 1
1: 0
2: 1
3: 15
4: 134
Right 1166679242 19:44757216-44757238 ATGACGGTAAGCATTTACCGCGG 0: 1
1: 0
2: 0
3: 1
4: 25
1166679231_1166679244 29 Left 1166679231 19:44757166-44757188 CCTGCTGGACAGCGCAGCTCCGG 0: 1
1: 0
2: 1
3: 15
4: 134
Right 1166679244 19:44757218-44757240 GACGGTAAGCATTTACCGCGGGG 0: 1
1: 0
2: 0
3: 0
4: 10
1166679231_1166679235 -8 Left 1166679231 19:44757166-44757188 CCTGCTGGACAGCGCAGCTCCGG 0: 1
1: 0
2: 1
3: 15
4: 134
Right 1166679235 19:44757181-44757203 AGCTCCGGGCACGTTGGACCTGG 0: 1
1: 0
2: 0
3: 2
4: 48
1166679231_1166679243 28 Left 1166679231 19:44757166-44757188 CCTGCTGGACAGCGCAGCTCCGG 0: 1
1: 0
2: 1
3: 15
4: 134
Right 1166679243 19:44757217-44757239 TGACGGTAAGCATTTACCGCGGG 0: 1
1: 0
2: 0
3: 1
4: 18
1166679231_1166679239 11 Left 1166679231 19:44757166-44757188 CCTGCTGGACAGCGCAGCTCCGG 0: 1
1: 0
2: 1
3: 15
4: 134
Right 1166679239 19:44757200-44757222 CTGGAGGCCCGCAATTATGACGG 0: 1
1: 0
2: 0
3: 5
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166679231 Original CRISPR CCGGAGCTGCGCTGTCCAGC AGG (reversed) Exonic
900958987 1:5907356-5907378 CCAGAGCTGCCCTGGCCAGGAGG - Intronic
902699060 1:18159162-18159184 CCGGAGCTGTGCTGGACACCAGG - Intronic
903930245 1:26857700-26857722 CCAGAGCAGCACTGGCCAGCTGG - Intergenic
904539331 1:31222283-31222305 CCACAGCAGCTCTGTCCAGCTGG - Intronic
905959980 1:42035593-42035615 CCGGAGCTGCGGAGGCCAGACGG + Intronic
906657772 1:47561245-47561267 CAGGAGCTGGGCTCTCCAGGGGG - Intergenic
907387701 1:54136686-54136708 CCGGAGCTGTGCCGCCCAGGAGG - Intronic
915319312 1:155047554-155047576 CCAGAGCAGCACTGTCCAACAGG + Intronic
919638682 1:200029140-200029162 CCGGAGCTGCGCGGAGCTGCCGG - Intronic
924740019 1:246789611-246789633 CCGCAGCCGCCCTCTCCAGCTGG + Intergenic
1067118621 10:43455544-43455566 CCTGAGCTGCGTCGTCCAGCCGG - Intronic
1067712420 10:48659433-48659455 CCGGGTCAGCGCTGTCCAACAGG + Intergenic
1070097797 10:73355168-73355190 CAGGAACTGGGCTGTACAGCAGG + Intronic
1071495332 10:86164004-86164026 CCGGTGCTGCTCACTCCAGCTGG + Intronic
1077518792 11:3018848-3018870 CAGGAGCTGCGTTTTCCAGGTGG + Intronic
1081698061 11:45132182-45132204 CTGGAGCTGCGCTGTGCAGGGGG + Intronic
1081772539 11:45658847-45658869 CCGGAGCCCCGGTGTCCAGGGGG - Intronic
1084793921 11:71491671-71491693 GCGGTGCTGGGCTTTCCAGCGGG - Intronic
1085458806 11:76680909-76680931 CCGGGGCTCCGCTGCCCAGCAGG - Intergenic
1088915834 11:114227165-114227187 CCGGAGCAGCGCTGTCCCTGAGG + Intronic
1091290049 11:134434445-134434467 GCAGAGCCGCGCTGTCCAACTGG + Intergenic
1091936045 12:4435195-4435217 CGGGACCTGGGCTGTACAGCAGG + Intronic
1094841426 12:34344151-34344173 CCGGAGCTGCTGGGTCCCGCTGG - Intergenic
1096157201 12:49347297-49347319 CCAGGGCTGCTCTGTCCCGCGGG - Exonic
1096180694 12:49548954-49548976 CCGGAGCTGTTCCCTCCAGCTGG - Exonic
1097166481 12:57089008-57089030 CCGGAGCTGCGCTGGCTGCCGGG - Exonic
1097284224 12:57865316-57865338 CCGGAGCCGCAGTGTCCAGAGGG + Intergenic
1098914582 12:76244017-76244039 TAGGAGCTGGGCTGTGCAGCAGG - Intergenic
1101865072 12:108514838-108514860 CAGGGGCTGCGCAGTCAAGCAGG + Intergenic
1101969029 12:109299863-109299885 CCGGGGCTGGGCTGCCCCGCTGG - Intronic
1102368990 12:112365560-112365582 CCAGAACTGCACTGTCCAGTTGG - Intronic
1104045153 12:125157180-125157202 TGGGAGCTGCCCTGTCCACCTGG + Intergenic
1106127636 13:26913408-26913430 CCTGAGCTGCACTGTCCCTCTGG - Intergenic
1106242545 13:27922558-27922580 CTTCAGCAGCGCTGTCCAGCTGG + Intronic
1107750311 13:43558122-43558144 CTGGTGCTGAGCTGTCCAGAAGG + Intronic
1108503997 13:51093334-51093356 CTGGAGCAGGGCTGTCCAGTAGG + Intergenic
1113412902 13:110106050-110106072 CCGCTGCTGGGCTGTCCTGCAGG - Intergenic
1115910861 14:38255413-38255435 CCAGAGCGGCGCTGTGCAGCTGG + Exonic
1117846623 14:59919300-59919322 CTGGATCTGCGCAGTCCAGCAGG - Intergenic
1120907388 14:89632472-89632494 CCTGAGCTGGTCTGTGCAGCAGG - Intronic
1122930232 14:104929770-104929792 CTGGAGCTGAGCTGCCCAGAGGG + Intronic
1124416868 15:29479516-29479538 CCATAGTTGTGCTGTCCAGCTGG - Intronic
1125674662 15:41495620-41495642 CCGGGGCTGCTCTGACCACCGGG - Intronic
1129270848 15:74418559-74418581 CCGCAGCAGCGCTGCCCAGCTGG + Intronic
1131383894 15:91986676-91986698 CTGGGGCTGCCCTGTCCAGGAGG - Intronic
1135600120 16:23775745-23775767 CGTGAGATGCACTGTCCAGCTGG - Intergenic
1137289715 16:47043662-47043684 CCTGAGCTGCCGTGCCCAGCCGG - Intergenic
1137883248 16:52074804-52074826 CAGGAGGTGGGCTGTCCAGAAGG - Intronic
1141196322 16:81864280-81864302 CTGGGGCTGCGCTGTCCAGCAGG + Intronic
1142025690 16:87812266-87812288 CCGGAGCGGAGCAGCCCAGCCGG - Intergenic
1142681518 17:1551917-1551939 GGAGAGCAGCGCTGTCCAGCGGG - Intronic
1144866383 17:18338333-18338355 CGGCAGCTGCCCTGTCCGGCAGG + Intronic
1145052838 17:19677107-19677129 CCTGCCCTGCTCTGTCCAGCAGG - Exonic
1147316027 17:39620721-39620743 CAGGAGCTTCGGTCTCCAGCAGG + Intergenic
1149858664 17:60107684-60107706 CTGGAGCTGGGCTGTCCTGGAGG + Intergenic
1150389353 17:64781507-64781529 CCGGAGCCGCGCGGTCGAGGAGG - Intergenic
1151332100 17:73416061-73416083 CCAGAGCAGCGCTGTCCAATAGG + Intronic
1151620532 17:75242284-75242306 CCGGGGCTGCGCTGCCCTTCAGG - Intronic
1151763799 17:76121992-76122014 CGGGGGCTGCGCTGGGCAGCGGG + Intergenic
1152642304 17:81454334-81454356 CCAGAGCTGTGCTGTCCCCCAGG - Intronic
1152751297 17:82063617-82063639 CAGGAGCTGCCCTGTCAGGCGGG + Intronic
1157310904 18:46552552-46552574 CAGGGGCTGTGCTGTCCAGTTGG - Intronic
1162621511 19:11847903-11847925 CTGGAGCTGCTCTGAGCAGCTGG - Intergenic
1162630527 19:11923942-11923964 CTGGAGCTGCTCTGAGCAGCTGG - Intergenic
1162654205 19:12116583-12116605 CTGGAGCTGCTCTGAACAGCTGG - Intronic
1166428137 19:42697947-42697969 CCGAAGCTGCGCAGCCAAGCGGG + Intronic
1166679231 19:44757166-44757188 CCGGAGCTGCGCTGTCCAGCAGG - Exonic
1166961380 19:46498045-46498067 CCAGAGCAGCGTTGTCCAGCAGG + Intronic
1168054847 19:53857339-53857361 CATGAGCTGCCCTGTCCGGCAGG + Intergenic
1168110534 19:54189379-54189401 CCGGAGCTGCGGCGGCAAGCGGG - Exonic
925005627 2:441064-441086 CAGCAGCTGCCCTGTCCTGCTGG - Intergenic
927647685 2:24888331-24888353 CAGGAGCTGAGCCGTCCAGCTGG - Intronic
930189739 2:48445257-48445279 CTGTATCTGTGCTGTCCAGCAGG + Intronic
934545005 2:95207373-95207395 CTGGAGGAGCGCTGACCAGCTGG - Intergenic
935692628 2:105744915-105744937 CCGGAGCCGCGCGGCCGAGCGGG + Exonic
936938431 2:117859538-117859560 CCCGAGCGGCGCCGTCCTGCCGG + Intergenic
937903080 2:127037615-127037637 CAAGAGCTGGGCTCTCCAGCTGG - Intergenic
938072898 2:128317768-128317790 CGGGCGCTGCGCAGTCAAGCCGG + Intronic
948526061 2:238571573-238571595 CCAGAGCTGCCCCATCCAGCTGG + Intergenic
1173986854 20:47268016-47268038 CAGGATCTGCGCTGGCCAGCAGG + Intronic
1174062029 20:47839621-47839643 CCCAGGCTGCGTTGTCCAGCTGG - Intergenic
1174069479 20:47889610-47889632 CCCAGGCTGCGTTGTCCAGCTGG + Intergenic
1175424618 20:58855591-58855613 CTGGCGCTGGCCTGTCCAGCCGG - Intronic
1175827270 20:61942929-61942951 CCTGAGCTGGGCTGCCCAGAGGG - Intergenic
1176767814 21:13037795-13037817 CAGGAGCGGCTCTGTCAAGCAGG + Intergenic
1178288254 21:31344010-31344032 CCCGAGCTGAGCTGTGCAGCTGG - Intronic
1179480247 21:41672316-41672338 CCGGAGCTCTGCCGCCCAGCAGG - Intergenic
1179515318 21:41902514-41902536 CCAGAGCTGAGATGACCAGCAGG + Intronic
1180056787 21:45363005-45363027 CAGGAACAGAGCTGTCCAGCAGG - Intergenic
1180122296 21:45761880-45761902 CGGGAGCTGCGCTGGGCAGCTGG - Intronic
1180623223 22:17176118-17176140 CCAGAGCAGAACTGTCCAGCTGG + Intergenic
1181045729 22:20213447-20213469 CAGTGGCTGCGGTGTCCAGCTGG + Intergenic
1185055156 22:48575530-48575552 CCGGAGCAGCGGCGTCCCGCGGG + Intronic
1185175194 22:49322466-49322488 CAGGGGCTGCCCTGCCCAGCAGG + Intergenic
950420836 3:12898445-12898467 CTGGAGCTGTGCTGGGCAGCAGG - Exonic
954325148 3:49859407-49859429 CTGGGGCTGTGCTGTCCGGCTGG + Exonic
956213826 3:66827899-66827921 CTGGAACTGGGCTGCCCAGCAGG - Intergenic
957791954 3:84952846-84952868 CTAGAGCTGTGCTGTCCACCAGG - Intergenic
963827391 3:149970520-149970542 CCGGGGCTGCGCTGACAGGCTGG - Intronic
966652384 3:182315556-182315578 ACGGTGCTGTGCTGGCCAGCGGG + Intergenic
967920056 3:194607840-194607862 CCCGAGCCCCACTGTCCAGCTGG - Intronic
969273239 4:6117073-6117095 CACGAGCTGTGCTGTCCTGCAGG - Intronic
970195533 4:13547413-13547435 GCGGAGCTGCGCGGCCCGGCCGG + Intergenic
971941696 4:33224045-33224067 TAGGAGCTGCGCAGTACAGCAGG - Intergenic
973652140 4:53006876-53006898 CAGGAGCTGCCCTGTTCAGGTGG - Intronic
975344787 4:73281652-73281674 CCGAAGCTGAGCTGGCCAACAGG + Intergenic
975693655 4:76990466-76990488 CCGGAACTGGGCTGGCCAGCAGG + Intronic
976445683 4:85127968-85127990 CCGGAGCTGCGCCACCAAGCAGG - Intergenic
982258245 4:153470763-153470785 CCTGACCTGCTCTGTCCTGCAGG + Intronic
983499233 4:168480316-168480338 CTGGAGCGGAGCTGTCCCGCGGG - Intronic
985895762 5:2749278-2749300 CCGGACCTGGGGTGTCCGGCGGG + Intronic
990148374 5:52788274-52788296 CGGGAGCTGCGCTCTCTGGCTGG - Exonic
990334628 5:54760202-54760224 AAGGAACTGCGCTGGCCAGCAGG - Intergenic
990410336 5:55535038-55535060 CCGGTCCTGCGCTGCTCAGCGGG - Intronic
990690731 5:58360945-58360967 CCTGAGCTGTCCTGCCCAGCAGG + Intergenic
990993900 5:61712099-61712121 CAGGTGCTGCCCTGTCCAACCGG - Intronic
991391064 5:66144197-66144219 CCGGGGCTGCGCGCGCCAGCCGG - Exonic
993384797 5:87251616-87251638 CCGTAGCTGCTCTCTGCAGCTGG + Intergenic
1001982961 5:176048678-176048700 CTGGAGATGGGATGTCCAGCTGG + Intergenic
1002193005 5:177488548-177488570 CTGGAGCTGCCCTGTCCTGCTGG + Intronic
1002234502 5:177795378-177795400 CTGGAGATGGGATGTCCAGCTGG - Intergenic
1006133985 6:31884667-31884689 CCCGAGCTGCGATGTGCAGGGGG + Exonic
1006641586 6:35492236-35492258 CCTGAGCTGGGCTGACCAGCCGG + Intronic
1010625492 6:78132866-78132888 CCCTAGCTGCGCTGTCAGGCAGG + Intergenic
1015328459 6:131950922-131950944 CCGGCGCCGCGCTGCCCGGCGGG - Exonic
1015742871 6:136476280-136476302 CAAGAGCTGTGCTGTCCAGTAGG + Intronic
1018156601 6:160991532-160991554 GCGGAGCCGGGCTGTGCAGCGGG - Intergenic
1019111889 6:169723890-169723912 CCGGGGCTGCGCTGTCCCCGCGG - Exonic
1019155710 6:170037620-170037642 CAGGAGCTGGGATGTCCTGCTGG - Intergenic
1019401107 7:854494-854516 CTGCATCTGTGCTGTCCAGCAGG - Intronic
1023810308 7:43906479-43906501 CCGGAGCGGCTCTGGCCTGCGGG - Intronic
1024262207 7:47581487-47581509 CCCTAGCTGCGCTCTCCACCTGG + Intronic
1025232425 7:57211542-57211564 CCTAGGCTGCGTTGTCCAGCTGG + Intergenic
1028768639 7:94589515-94589537 ACGGAACTGGGCTGCCCAGCAGG + Intronic
1031055519 7:116989295-116989317 CCAGAGCTGCACTGTCCAAAAGG - Intronic
1033031262 7:137829518-137829540 CTGTAACTGTGCTGTCCAGCAGG + Intronic
1034449631 7:151130342-151130364 CCTGAGCTCTGCTCTCCAGCTGG - Intronic
1037607176 8:20447792-20447814 CAAGAGATGAGCTGTCCAGCTGG - Intergenic
1039256527 8:35724877-35724899 AGGGAGCTGCGCTTTCTAGCAGG - Intronic
1049433465 8:142575758-142575780 CCAGAGCTGTGCTGACCAGAGGG + Intergenic
1049624011 8:143612084-143612106 CTGGAGCTGACCTGTCCAGCAGG + Intergenic
1049973553 9:841748-841770 CCGGAGCGTCGCTGTCCGTCGGG + Exonic
1053291432 9:36882033-36882055 GAGTAGCTGCCCTGTCCAGCGGG + Exonic
1056746797 9:89310580-89310602 CCGGGGCTGCCCTGCGCAGCCGG - Intergenic
1057525246 9:95793436-95793458 CTGTATCTGTGCTGTCCAGCAGG + Intergenic
1058812305 9:108652814-108652836 CAGGAGATGTGCTGTCCAGGAGG + Intergenic
1061572246 9:131484990-131485012 CCGGAGCAGAGCTCTCCAGGCGG + Exonic
1190776276 X:53554752-53554774 CAGGAGCTGCAGTCTCCAGCTGG - Exonic
1195687822 X:107601879-107601901 CCGCAGCAGCCCTGTGCAGCAGG + Exonic
1198363516 X:135918372-135918394 ACGGAGCAGCCCTGTGCAGCAGG + Intergenic
1201517050 Y:14829757-14829779 GCGGCACTGCCCTGTCCAGCTGG + Exonic