ID: 1166679237

View in Genome Browser
Species Human (GRCh38)
Location 19:44757185-44757207
Sequence GCCTCCAGGTCCAACGTGCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 172}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166679237_1166679244 10 Left 1166679237 19:44757185-44757207 CCGGGCACGTTGGACCTGGAGGC 0: 1
1: 0
2: 1
3: 8
4: 172
Right 1166679244 19:44757218-44757240 GACGGTAAGCATTTACCGCGGGG 0: 1
1: 0
2: 0
3: 0
4: 10
1166679237_1166679243 9 Left 1166679237 19:44757185-44757207 CCGGGCACGTTGGACCTGGAGGC 0: 1
1: 0
2: 1
3: 8
4: 172
Right 1166679243 19:44757217-44757239 TGACGGTAAGCATTTACCGCGGG 0: 1
1: 0
2: 0
3: 1
4: 18
1166679237_1166679245 19 Left 1166679237 19:44757185-44757207 CCGGGCACGTTGGACCTGGAGGC 0: 1
1: 0
2: 1
3: 8
4: 172
Right 1166679245 19:44757227-44757249 CATTTACCGCGGGGCACCGCTGG 0: 1
1: 0
2: 0
3: 1
4: 19
1166679237_1166679242 8 Left 1166679237 19:44757185-44757207 CCGGGCACGTTGGACCTGGAGGC 0: 1
1: 0
2: 1
3: 8
4: 172
Right 1166679242 19:44757216-44757238 ATGACGGTAAGCATTTACCGCGG 0: 1
1: 0
2: 0
3: 1
4: 25
1166679237_1166679246 20 Left 1166679237 19:44757185-44757207 CCGGGCACGTTGGACCTGGAGGC 0: 1
1: 0
2: 1
3: 8
4: 172
Right 1166679246 19:44757228-44757250 ATTTACCGCGGGGCACCGCTGGG 0: 1
1: 0
2: 0
3: 1
4: 23
1166679237_1166679239 -8 Left 1166679237 19:44757185-44757207 CCGGGCACGTTGGACCTGGAGGC 0: 1
1: 0
2: 1
3: 8
4: 172
Right 1166679239 19:44757200-44757222 CTGGAGGCCCGCAATTATGACGG 0: 1
1: 0
2: 0
3: 5
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166679237 Original CRISPR GCCTCCAGGTCCAACGTGCC CGG (reversed) Exonic
900287249 1:1907583-1907605 GGCTCCAGGGGCCACGTGCCTGG - Intergenic
901937177 1:12634954-12634976 GCCTCCATGTTGAACATGCCTGG - Intergenic
902840004 1:19068549-19068571 GCTGCCAGGCCCCACGTGCCCGG + Intergenic
904940886 1:34164487-34164509 GCCCCCAGGACCAGCGTGCCTGG + Intronic
906607572 1:47182631-47182653 GCCTCCAGGTTCAGCCAGCCAGG + Intergenic
906756811 1:48325383-48325405 TCCTCCAGGCCCAAGGAGCCAGG + Intronic
907099521 1:51816344-51816366 GCCTTCATGTCCAACCAGCCAGG + Exonic
907642447 1:56204725-56204747 GCCTCCAGTTCCAGCTGGCCAGG - Intergenic
910070612 1:83208815-83208837 GCCTCCATGTTGAACGTACCTGG + Intergenic
911151899 1:94604205-94604227 GCCTCCAGGGCCAGACTGCCAGG + Intergenic
915897015 1:159819946-159819968 GCCTTCAGCTCCATGGTGCCAGG - Intergenic
916480963 1:165213888-165213910 GCCTCCAGGTCCACATTTCCAGG + Intronic
920247926 1:204602341-204602363 GCCCCCAGGCCCAAGGAGCCAGG - Intergenic
920450313 1:206055893-206055915 GCCCCCATGTCCAAAGTCCCTGG + Intronic
921841565 1:219834404-219834426 GCCTCCATGTGGAACATGCCTGG - Intronic
921984192 1:221292719-221292741 GCCTCCAAGTTGAACATGCCTGG - Intergenic
923868216 1:237963037-237963059 GCCTCCATGTTGAACATGCCTGG - Intergenic
924707917 1:246513261-246513283 GCCTCCTGGGCCAGGGTGCCGGG + Intergenic
924712094 1:246537881-246537903 GCCTCCATGTTGAACATGCCTGG - Intergenic
924929280 1:248713218-248713240 GCCTCCATGTTGAACATGCCTGG - Intergenic
1062819617 10:524170-524192 GCCTCCAGTTCCAGCCTCCCTGG - Intronic
1063727377 10:8652741-8652763 GCCTCCAGGTCTAATGTGGTGGG - Intergenic
1064254515 10:13732639-13732661 GCCTCCAGGTGCACAGTGCTGGG + Intronic
1064697375 10:17981738-17981760 GACTCCAGGGCCAGCTTGCCTGG - Intronic
1064903462 10:20318517-20318539 GCCACCAGGTTGAACATGCCTGG - Intergenic
1066066848 10:31767718-31767740 GCCTCCATCTCCAAAGTGCTGGG + Intergenic
1069233106 10:66036660-66036682 GCCACCACGTCCAGCTTGCCAGG + Intronic
1069574609 10:69517636-69517658 GGCTCCTGGTCCATGGTGCCTGG + Intergenic
1070182323 10:74026159-74026181 GCCTCCATGTTGAACATGCCTGG + Intronic
1071264403 10:83951773-83951795 ACCTCGAGGTCCAACCTTCCAGG + Intergenic
1073067983 10:100775152-100775174 CCTTCCAGGTCAAACCTGCCTGG + Intronic
1074633874 10:115290982-115291004 GCCTCCACGTTGAACATGCCTGG + Intronic
1075924602 10:126240623-126240645 GCCTCCAGCTCCAGCCTGCCTGG - Intronic
1076268897 10:129133315-129133337 GCCTCCAATTCCAACATCCCAGG - Intergenic
1077020789 11:416372-416394 GCCCCCAGGTCCACCGTCCAGGG + Intronic
1077487671 11:2846539-2846561 GCCCCCAGGTCCAACCTCCTAGG + Intronic
1077541844 11:3150378-3150400 GCATCCTGGTCCCAGGTGCCCGG - Intronic
1078153496 11:8778644-8778666 GCCTACAGCTCCCACGTACCCGG + Intronic
1082780071 11:57280428-57280450 TCCTCCAGCTCCAATGGGCCTGG - Intergenic
1083176672 11:60954502-60954524 GCCTCCATCTCCAAGGTACCAGG + Intergenic
1084219802 11:67670949-67670971 GCTTCCAGGTCCCAGGTTCCAGG + Intronic
1085763339 11:79261103-79261125 GCCTCCCTCTCCAACCTGCCAGG - Intronic
1085872968 11:80372040-80372062 GTCTTCAGGTCCATCCTGCCTGG + Intergenic
1088952494 11:114585878-114585900 GCCTCCATGTTGAACATGCCTGG - Intronic
1089346783 11:117796288-117796310 GTCCCCAGGTCCAACTGGCCAGG + Intronic
1092636617 12:10457840-10457862 GCCTCCAGGTTGAAAATGCCTGG - Intergenic
1093378167 12:18456659-18456681 GCCTCCAGGTTGAACATACCTGG + Intronic
1097179762 12:57165096-57165118 GCCTCCAGGTCCATGGTCCATGG + Intronic
1097767424 12:63542247-63542269 GCCTCCATGTTGAACATGCCTGG - Intergenic
1097783797 12:63737290-63737312 GCCTCCATGTTGAACATGCCTGG - Intergenic
1098956020 12:76690578-76690600 GCCTCCACTTCCATCCTGCCAGG - Intergenic
1099382200 12:81968737-81968759 GCCTCCATATCGAACATGCCTGG + Intergenic
1103915550 12:124373871-124373893 GCCTCGTTGTCCACCGTGCCCGG - Intronic
1104494529 12:129224655-129224677 GCCTCGACGTCCAAAGTGCTGGG - Intronic
1108319370 13:49272916-49272938 CCCTCCAGATCCAACCTGCTTGG - Intronic
1108520813 13:51245390-51245412 GCCTCCAGGTTGAACATACCTGG + Exonic
1108550492 13:51539058-51539080 GGCTCCAGGTCTAACAGGCCCGG - Intergenic
1109271611 13:60261868-60261890 GCCTCCATGTTGAACATGCCTGG + Intergenic
1114196883 14:20485993-20486015 GCCTCCATGTTGAACATGCCTGG - Intergenic
1114616187 14:24069526-24069548 GCCTCCAGCTCCCCCATGCCTGG - Exonic
1115248357 14:31319793-31319815 GCCTCCACCTCCAACGTGCTGGG - Intronic
1120632258 14:86905455-86905477 GCCTCCTGCTCCAAGGCGCCTGG - Intergenic
1121868369 14:97384101-97384123 GCCTCCATTTCCAAGGTGGCTGG - Intergenic
1122815975 14:104314286-104314308 ACCTCAAGGTCCCCCGTGCCAGG + Intergenic
1122939576 14:104975214-104975236 GCCTCCAGTTCCAATGCCCCAGG - Intronic
1125477097 15:40054839-40054861 GCCTGCAGGTGCAAGGGGCCTGG - Intergenic
1129890215 15:79066842-79066864 GCCTCCAGGAACCCCGTGCCTGG - Intronic
1130038868 15:80386920-80386942 GCCTCCATGTTGAACATGCCTGG + Intronic
1130937812 15:88485124-88485146 GCCTACAGGTCCTTCGTGGCTGG + Intergenic
1131979060 15:97978136-97978158 GCCTCCATGTTGAACATGCCTGG + Intergenic
1132016351 15:98320806-98320828 GCCTCCAGGTCCCCCGTGCCAGG + Intergenic
1133780728 16:8937142-8937164 GCCTCAGGGTCCTAAGTGCCTGG - Intronic
1134831042 16:17323084-17323106 GCCTCCATGGCCAGCTTGCCTGG - Intronic
1137579229 16:49623187-49623209 GCCTCCAACTCCCACGTTCCTGG + Intronic
1142249806 16:88986103-88986125 GCCTGCAGGGCCAGCTTGCCTGG - Intergenic
1143466520 17:7140453-7140475 GCCTCCATGTTGAACATGCCTGG + Intergenic
1145269990 17:21399716-21399738 GACACCAGGGCCAACGTGCGTGG + Intronic
1145760928 17:27425251-27425273 GCCTCCTGGGCCAGGGTGCCGGG - Intergenic
1146160968 17:30559408-30559430 GCCTCCTGGGCCAGGGTGCCGGG - Exonic
1151173872 17:72270942-72270964 GCTTCCAGGACCATAGTGCCAGG + Intergenic
1151320949 17:73352106-73352128 ACCTCCAGCCCCAACGTGGCAGG - Intronic
1151686338 17:75649025-75649047 TCCCCCATGTCCAATGTGCCTGG + Intronic
1153075473 18:1157184-1157206 GCCTCCATGTTGAACATGCCTGG + Intergenic
1154020275 18:10658538-10658560 GCCTCCATGTTGAACATGCCTGG + Intergenic
1155040881 18:22064825-22064847 GTCTCCAGTTGCAACTTGCCTGG + Intergenic
1155602631 18:27567099-27567121 GCCTCCCGAGCCACCGTGCCCGG - Intergenic
1156437853 18:37152953-37152975 GCCTCCATGTTGAACATGCCTGG - Intronic
1159368755 18:67504796-67504818 ACCTCCAGATCCAAAGTGCCAGG - Intergenic
1159799840 18:72884321-72884343 GCCTCCAGGTCCCCCATTCCTGG - Intergenic
1159828427 18:73243613-73243635 GCCTCCATGTTGAACATGCCTGG - Intronic
1161220532 19:3116098-3116120 GGCTCCAGGTCCACTGTGGCTGG + Intronic
1162406221 19:10475639-10475661 GCCACCACGTCCAAAGTGCTGGG - Intergenic
1162880151 19:13652834-13652856 GCCTCCATGTTGAACATGCCAGG - Intergenic
1163277726 19:16296008-16296030 GCCTCCTGGTCCAGAGTGGCGGG - Intergenic
1163575916 19:18110614-18110636 GCCGCCAGGTTCACCGTCCCCGG + Intronic
1164001766 19:21106939-21106961 GCCTCCAGCTCCTAAGTGGCTGG + Intronic
1166654690 19:44602126-44602148 GCCTCCAGGTTGAACATACCTGG - Intergenic
1166679237 19:44757185-44757207 GCCTCCAGGTCCAACGTGCCCGG - Exonic
1167112585 19:47470978-47471000 TCCTCCAGGTCCCCCCTGCCAGG + Intronic
1167626339 19:50592185-50592207 GCCTCCATGTTGAACATGCCTGG + Intergenic
927200912 2:20577575-20577597 GCCTCCAGGCCCAAGGTGAGGGG + Intronic
948049612 2:234969656-234969678 CCCTCCAAGTCCAGCCTGCCAGG - Intronic
1170449051 20:16462846-16462868 GCCTCCATGTCGAATGTGCTTGG - Intronic
1171279548 20:23884165-23884187 GTCTCCAGCTCCTACCTGCCAGG + Intergenic
1172763155 20:37336229-37336251 GGCTCCAGGTCCAAAGGGCAGGG + Intergenic
1173831561 20:46092192-46092214 GCCCCCTGCTCCAAGGTGCCTGG + Intergenic
1179495526 21:41769200-41769222 GCCTGCATGGACAACGTGCCCGG + Intergenic
1180101546 21:45590127-45590149 GTCTTCAGGTCCAACCCGCCCGG + Intergenic
1181001146 22:19988298-19988320 GCATCTAGGGCCAACCTGCCTGG + Intronic
1181338325 22:22158287-22158309 GCCTCTTGATCCAATGTGCCTGG + Intergenic
1183107764 22:35627249-35627271 GCCTCCAAGTTCAACCTGCAGGG - Intronic
1183191119 22:36322613-36322635 GTCAGCATGTCCAACGTGCCAGG + Intronic
1184039062 22:41932776-41932798 GCCCCCAGGGCCAACCTCCCAGG + Intergenic
1184741226 22:46430057-46430079 GCCTCCACGTGCAACCTGCGGGG - Intronic
1184807296 22:46803327-46803349 GCCTCCAGGTCACACGTTTCTGG + Intronic
1185393162 22:50573426-50573448 GCCTCCAGTTCCAGGGTGGCAGG + Intronic
952820016 3:37478239-37478261 GCATCCAGGTCCACAGTGCACGG - Intronic
955569723 3:60291476-60291498 GCCTCCATGTCGGACATGCCTGG + Intronic
956916475 3:73877207-73877229 CCCTCCTGGTCCAATCTGCCAGG + Intergenic
958762391 3:98325100-98325122 GCCTCCATGTTGAACATGCCTGG - Intergenic
962963791 3:140335232-140335254 GTCACCAGGTCCAAAGGGCCTGG - Intronic
968965591 4:3767609-3767631 GCCTCCAGGTCCCCGGGGCCCGG + Exonic
969568386 4:7993356-7993378 GCCTCCAGGCCCCATGTGCTTGG - Intronic
971030824 4:22635077-22635099 GCCCCCTGCTCCAAAGTGCCTGG + Intergenic
976190828 4:82485115-82485137 GCCTTCAGGTCCAAAGGGCTTGG - Exonic
985489255 5:169659-169681 GCCTACAGGGCCCACGTGTCAGG + Intronic
987736131 5:21845998-21846020 GCCTCCATGTTGAACATGCCTGG - Intronic
999946151 5:156597946-156597968 CCCTCTATGTCCAACATGCCAGG - Intronic
1001731499 5:173963927-173963949 GCCTCCATGTTGAACATGCCTGG - Intergenic
1003265893 6:4564863-4564885 GCCTCCAGGGCAGATGTGCCTGG - Intergenic
1003694338 6:8388261-8388283 GCCTCCATGTTGAACATGCCTGG + Intergenic
1006235225 6:32625052-32625074 GCCTCCAGGTCTAAGGTGAGTGG + Intergenic
1008220053 6:48844293-48844315 GCCTCCACGTTGAACATGCCTGG - Intergenic
1009947097 6:70352729-70352751 GCCTACAGGCCCACCTTGCCTGG - Intergenic
1010277906 6:73990695-73990717 GCCTCCTGCTCCACAGTGCCTGG - Intergenic
1015587347 6:134789577-134789599 TCCTCCTGGTCCAAACTGCCTGG - Intergenic
1016235794 6:141864853-141864875 GCCTCCATTTCCAAGGTGCTGGG - Intergenic
1019750409 7:2725605-2725627 GCCTCCAGGTCCCAGGTTCATGG - Intronic
1019897095 7:3991074-3991096 GCCTCCACGTCGCACGTTCCCGG + Intronic
1020112041 7:5452653-5452675 GCCTCCAGGTCCTGCCCGCCAGG + Intronic
1022717018 7:32907818-32907840 GCCTCCATGTTGAACATGCCTGG + Intergenic
1026117608 7:67509198-67509220 GCCTCCATGTTGAACATGCCTGG + Intergenic
1026131127 7:67621810-67621832 GCCTCCATGTCGAACATACCTGG - Intergenic
1029103345 7:98152847-98152869 GCATCCAGGTTCAAGCTGCCTGG - Intronic
1030407533 7:109133178-109133200 GCCTGCATGTCCATAGTGCCAGG - Intergenic
1031025194 7:116672248-116672270 GCCTCCGGCCCCAACGCGCCCGG + Intergenic
1033815268 7:145063376-145063398 GCCTCCGCCTCCAAAGTGCCAGG + Intergenic
1034477909 7:151298353-151298375 TCCTCCAGGTCTAAGGTCCCAGG + Intergenic
1035270888 7:157719236-157719258 GCTTCCAGGCCCCTCGTGCCAGG + Intronic
1036382404 8:8245517-8245539 GCCTCCATGTTGAACATGCCTGG - Intergenic
1037769663 8:21790905-21790927 GCCTCCAGGCCAAGCCTGCCTGG - Intronic
1037961463 8:23101603-23101625 CCCTCCAGGGCCAAGGGGCCTGG + Intronic
1038443743 8:27588914-27588936 GCAACCAGGTGCAACGGGCCTGG - Intergenic
1038453239 8:27653286-27653308 GCCTCCCGCTCCAGCCTGCCAGG - Intronic
1038612514 8:29069294-29069316 GCCCCCAGGCCCACCGTGCATGG - Exonic
1039896858 8:41723063-41723085 GGCTCCAGGTCCAACAGACCTGG - Intronic
1039961566 8:42252068-42252090 GCCTCCATGTTGAACATGCCTGG - Intergenic
1039980584 8:42406747-42406769 GCCTCCATGTTGAACATGCCTGG + Intergenic
1044317639 8:90768294-90768316 GCCTCCATGCACAAAGTGCCAGG + Intronic
1047445095 8:124912554-124912576 GCCTCCATGTTGAACATGCCTGG - Intergenic
1047504137 8:125465509-125465531 GGCTCCAGGGCCACCCTGCCAGG - Intergenic
1049406134 8:142452592-142452614 GTCCCGAGATCCAACGTGCCCGG + Intronic
1050196373 9:3088219-3088241 GCCTCCATGTTGAACCTGCCTGG - Intergenic
1050910618 9:11064976-11064998 GCCTCCATGTTGAACATGCCTGG - Intergenic
1051374863 9:16392606-16392628 GCCTCCACGTGCAACCTTCCAGG - Intergenic
1051640926 9:19223918-19223940 GCCTACAGGCCAAACGTGGCTGG - Intergenic
1053891824 9:42701429-42701451 GCCTCAGGGTCCAAAGTGGCTGG - Intergenic
1056318014 9:85410071-85410093 TACTTCAGGTCCAATGTGCCAGG + Intergenic
1056783649 9:89572032-89572054 GCCTCCATCTCCACCATGCCTGG - Intergenic
1058824180 9:108759982-108760004 GCCTCCATGTTGAACATGCCTGG - Intergenic
1059142597 9:111868474-111868496 GCCTCCAAGTTGAACATGCCTGG - Intergenic
1061003262 9:127914699-127914721 GGCTCCAGGCCCACTGTGCCGGG - Exonic
1061453721 9:130682355-130682377 GCCTCCACTCTCAACGTGCCTGG - Exonic
1062372877 9:136249212-136249234 GCCTCCATGTCCACAGTCCCTGG - Intergenic
1062639925 9:137513996-137514018 GCCTCCAAGTCCATCCTGCCCGG - Intronic
1185889046 X:3808230-3808252 GCCTCCATGTTGAACGTGCCTGG + Intergenic
1187868732 X:23747038-23747060 GCCTCGAGCTTCAAAGTGCCAGG - Intronic
1189250783 X:39599437-39599459 GCCTCCAGGGCCTGCCTGCCTGG + Intergenic
1197766194 X:130060692-130060714 GCCTCCACGTCCGGCGCGCCGGG + Intergenic
1200095431 X:153657451-153657473 GCCTCCATGTCCAGCAAGCCAGG + Intergenic
1200773021 Y:7144715-7144737 GCCTCCATGTTGAACGTGCCTGG - Intergenic
1201276560 Y:12304116-12304138 GCCTCCATGTTGAACGTGCCTGG - Intergenic