ID: 1166679239

View in Genome Browser
Species Human (GRCh38)
Location 19:44757200-44757222
Sequence CTGGAGGCCCGCAATTATGA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 39}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166679228_1166679239 24 Left 1166679228 19:44757153-44757175 CCTGCCTGCGAGCCCTGCTGGAC 0: 1
1: 0
2: 3
3: 24
4: 209
Right 1166679239 19:44757200-44757222 CTGGAGGCCCGCAATTATGACGG 0: 1
1: 0
2: 0
3: 5
4: 39
1166679231_1166679239 11 Left 1166679231 19:44757166-44757188 CCTGCTGGACAGCGCAGCTCCGG 0: 1
1: 0
2: 1
3: 15
4: 134
Right 1166679239 19:44757200-44757222 CTGGAGGCCCGCAATTATGACGG 0: 1
1: 0
2: 0
3: 5
4: 39
1166679237_1166679239 -8 Left 1166679237 19:44757185-44757207 CCGGGCACGTTGGACCTGGAGGC 0: 1
1: 0
2: 1
3: 8
4: 172
Right 1166679239 19:44757200-44757222 CTGGAGGCCCGCAATTATGACGG 0: 1
1: 0
2: 0
3: 5
4: 39
1166679225_1166679239 29 Left 1166679225 19:44757148-44757170 CCCGACCTGCCTGCGAGCCCTGC 0: 1
1: 0
2: 0
3: 23
4: 345
Right 1166679239 19:44757200-44757222 CTGGAGGCCCGCAATTATGACGG 0: 1
1: 0
2: 0
3: 5
4: 39
1166679226_1166679239 28 Left 1166679226 19:44757149-44757171 CCGACCTGCCTGCGAGCCCTGCT 0: 1
1: 0
2: 0
3: 28
4: 279
Right 1166679239 19:44757200-44757222 CTGGAGGCCCGCAATTATGACGG 0: 1
1: 0
2: 0
3: 5
4: 39
1166679230_1166679239 12 Left 1166679230 19:44757165-44757187 CCCTGCTGGACAGCGCAGCTCCG 0: 1
1: 0
2: 5
3: 18
4: 177
Right 1166679239 19:44757200-44757222 CTGGAGGCCCGCAATTATGACGG 0: 1
1: 0
2: 0
3: 5
4: 39
1166679229_1166679239 20 Left 1166679229 19:44757157-44757179 CCTGCGAGCCCTGCTGGACAGCG 0: 1
1: 0
2: 0
3: 14
4: 166
Right 1166679239 19:44757200-44757222 CTGGAGGCCCGCAATTATGACGG 0: 1
1: 0
2: 0
3: 5
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166679239 Original CRISPR CTGGAGGCCCGCAATTATGA CGG Exonic
903058651 1:20654324-20654346 CTGGAGCCCAGCAATGAGGAGGG + Exonic
904858805 1:33519832-33519854 CACGAAGCCCGCAATAATGAGGG + Exonic
910613254 1:89167610-89167632 CTGGAGTCCCTCATTAATGATGG - Intronic
922881779 1:228986448-228986470 CTGGAGACCTGCAAATCTGAGGG + Intergenic
923737345 1:236623291-236623313 CTGGAGGCTCTCAGTTTTGATGG - Intergenic
924955678 1:248924273-248924295 CTGGAAGCCAGCAGTCATGAAGG - Intergenic
1062905010 10:1173955-1173977 CTGGGGGCCCGCAATGCTTAGGG + Intergenic
1073290489 10:102410883-102410905 CTGGAGGGCCTCAATGATGGCGG - Exonic
1075201132 10:120405151-120405173 CTGGAGGCCAGCACTTCTGGAGG - Intergenic
1081496050 11:43611559-43611581 CTGGAAGTCTGCAGTTATGAAGG - Intronic
1081709680 11:45208791-45208813 CTGGGGGCCAGCAATTAGGAAGG + Intronic
1082686957 11:56250681-56250703 CTGTAGTCCCTCATTTATGAGGG + Intergenic
1084216958 11:67652931-67652953 CTAGAGGCAAGCAATTCTGAAGG + Intergenic
1090904654 11:131064634-131064656 CTGGAGGGCAGCAATTTTAAAGG + Intergenic
1099459871 12:82909316-82909338 CTGGAGTCCTGCATTCATGAAGG + Intronic
1107483728 13:40806761-40806783 CTGGTTGCCCTCAATCATGAAGG + Intronic
1114350039 14:21840076-21840098 CTGTAGGCCAGCAATGATGCAGG - Intergenic
1114702078 14:24688867-24688889 CAGGAGGCCCTCAATAAGGAGGG + Intergenic
1116290284 14:43026444-43026466 CAGGAAGCCTACAATTATGATGG - Intergenic
1120969858 14:90198245-90198267 CTGGAGGCCTCCTATTATGTGGG - Intergenic
1123937265 15:25200004-25200026 CTGGAGCCCTGCAGTGATGACGG + Intergenic
1131508111 15:93033756-93033778 CTGGAGGACCACAGTAATGAGGG - Intergenic
1131862725 15:96671457-96671479 CTGGATGTCCTCATTTATGAAGG - Intergenic
1137521879 16:49201757-49201779 CTGGAGGCCCGACCTGATGATGG - Intergenic
1153743614 18:8154159-8154181 CAGGAGGCCCTCAATTAAAAGGG + Intronic
1161665362 19:5572800-5572822 TTGGACACCAGCAATTATGATGG - Intergenic
1166679239 19:44757200-44757222 CTGGAGGCCCGCAATTATGACGG + Exonic
1167096276 19:47376530-47376552 CTGGAGGCCAGCAACTGCGACGG + Exonic
931514191 2:63033099-63033121 CTGGAGTCCTGCAATAATGTTGG + Intronic
936514728 2:113174363-113174385 CTGGAGGTCTGCAATAGTGAAGG + Intronic
938236422 2:129710004-129710026 CTGGAGGCCTGCAATCCTGATGG + Intergenic
1168879907 20:1197631-1197653 CTTGTGGCCCGCAAGTAAGAGGG - Intergenic
1185106134 22:48871034-48871056 CCGGGGGCACGCCATTATGATGG - Intergenic
952185419 3:30962706-30962728 CTGGAAGCTCGCAATCATGATGG + Intergenic
952406370 3:33008637-33008659 CTGGAGGCTGGCAACAATGAGGG + Intronic
964382325 3:156110020-156110042 CTGGAGGCCCACAGATGTGAGGG - Intronic
978574818 4:110179130-110179152 CTGGAGGCCTAGAATTATGAAGG - Intronic
1010144983 6:72658029-72658051 CTGCAGGCCAGGAAGTATGATGG + Intronic
1010760583 6:79718165-79718187 TTGGAGGCCCGCACTGCTGAAGG + Intergenic
1021539489 7:21741650-21741672 CTGCAGGCCCTAAAGTATGAGGG - Intronic
1033431484 7:141293500-141293522 CTGCAGGCCCCTAATGATGAGGG + Intronic
1051123474 9:13777353-13777375 TTGGGGGCCCACAAGTATGAGGG - Intergenic
1053050404 9:34957482-34957504 CAGAAGGCCAGCAATTCTGAGGG - Intergenic
1062424367 9:136499210-136499232 CTGGATGCCCGCATGCATGATGG - Exonic
1201942792 Y:19477794-19477816 CTGGAGGCCAAGAATTATGAGGG - Intergenic